Logout succeed
Logout succeed. See you again!

1 1 2 3 Disulfide bonding within components of the Chlamydia type-III secretion apparatus 4 ... PDF
Preview 1 1 2 3 Disulfide bonding within components of the Chlamydia type-III secretion apparatus 4 ...
JB Accepts, published online ahead of print on 14 October 2011 J. Bacteriol. doi:10.1128/JB.05163-11 Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 2 3 4 Disulfide bonding within components of the Chlamydia type-III secretion apparatus 5 correlates with development D 6 o w n 7 H. J. Betts-Hampikian and K. A. Fields* lo a d 8 e d f 9 1 Department of Microbiology and Immunology, University of Miami Miller School of ro m 10 Medicine, Miami, FL 33136 h t t p : 11 // jb . a 12 s m . 13 o r g / 14 o n A 15 p r il 3 16 , 2 0 17 1 9 b 18 y g u 19 e s t 20 *Corresponding Author 21 Phone (305) 243-6711 22 Fax (305) 243-4623 23 [email protected] 1 24 SUMMARY 25 Chlamydia spp exhibit a unique bi-phasic developmental cycle whereby 26 infectious elementary bodies (EBs) invade host epithelial cells and differentiate into non- 27 infectious, metabolically active reticulate bodies (RBs). EBs posses a unique outer 28 envelope where rigidity is acheived by disulfide bonding among cysteine-rich envelope- D 29 associated proteins. Conversely, these disulfide bonds become reduced in RBs to o w n 30 accommodate vegetative growth; thereby linking the redox status of cysteine rich lo a d 31 envelope proteins with progression of the developmental cycle. We investigated the e d f r 32 potential role of disulfide bonding within the chlamydial type-III secretion system (T3SS) o m 33 since activity of this system is also closely linked to development. We focused on h t t p : 34 structural components of the T3S apparatus that contain an unusually high number of // jb . a 35 cysteine residues compared to orthologs in other secretion systems. Non-reducing SDS- s m . 36 PAGE revealed that EB-localized apparatus proteins such as CdsF, CdsD, and CdsC form o r g / 37 higher order complexes mediated by disulfide bonding. The most dramatic alterations o n A 38 were detected for the needle protein CdsF. Significantly, disulfide bonding patterns p r il 3 39 shifted during differentiation of developmental forms and were completely reduced in , 2 0 40 RBs. Furthermore, at later time points during infection following RB to EB conversion, 1 9 b 41 we found that CdsF is re-oxidized into higher order complexes. In aggregate we y g u 42 conclude that the redox status of specific T3SS apparatus proteins is intimately linked to e s t 43 the developmental cycle and constitute a newly appreciated aspect of functionally- 44 significant alterations within proteins of the chlamydial envelope. 45 46 2 47 INTRODUCTION 48 Chlamydia trachomatis is one of three medically significant species of Chlamydia 49 responsible for a considerable disease burden worldwide. Trachoma serovars A-C are the 50 leading cause of infectious blindness (7), while the genital serovars D-K and biovar 51 lymphogranuloma venereum (LGV, serovars L1-L3) are agents of sexually transmitted D 52 disease (37). Infections with the respiratory pathogen C. pneumoniae or zoonotic o w n 53 pathogen C. psittaci represent the remaining chlamydial species significantly affecting lo a d 54 humans. e d f r 55 Chlamydiae are obligate intracellular, Gram-negative organisms that parasitize host o m 56 epithelial cells while developing within a parasitophorous vesicle termed an inclusion h t t p : 57 (31). All species display a unique bi-phasic developmental cycle which initiates when // jb . a 58 infectious, yet metabolically inert, elementary bodies (EBs) invade cells and differentiate s m . 59 into metabolically active reticulate bodies (RBs). RBs replicate by binary fission within o r g / 60 the expanding inclusion before undergoing asynchronous differentiation back to EBs o n A 61 which are finally released from the cell (1). p r il 3 62 The chlamydial EB is “spore-like” in that it is generally perceived to be metabolically , 2 0 63 dormant and has a densely cross-linked outer envelope. Crosslinking is achieved via 1 9 b 64 disulfide bonding among cysteine rich proteins in the outer membrane and results in the y g u 65 formation of a “supramolecular disulfide complex” (4). Envelope proteins currently e s t 66 known to participate in this complex include the major outer membrane protein (MOMP), 67 the small and large Chlamydia specific cysteine rich outer membrane proteins (OmcA 68 and OmcB, respectively), and polymorphic outer membrane proteins (Pmps) (4, 14, 17, 69 21, 33, 40, 45). It is postulated that this high degree of cross-linking is likely required to 3 70 confer rigidity in the absence of peptidoglycan (19) and regulate envelope permeability 71 (4). Interestingly, the supramolecular disulfide-bonded complex is reduced in RBs, 72 rendering this larger developmental form osmotically fragile but capable of vegetative 73 growth (17, 19, 33). MOMP is found predominantly in a reduced form whilst the late- 74 cycle gene products OmcA and B are not detectable (32). Significantly, it has been D 75 shown that treatment of EBs with the reducing agent dithiothreitol (DTT) results in o w n 76 induction of several changes that are normally associated with RBs. These characteristics lo a d 77 include reduced infectivity, decreased osmotic stability and changes in Macchiavello e d f r 78 staining properties (17). Evidence thus indicates that reduction of EB envelope proteins o m 79 could play a role as a triggering factor for EB to RB differentiation. h t t p : 80 Later in development, during RB to EB conversion, envelope-localized sulfhydryls // jb . a 81 must be re-oxidized prior to release of EBs from the host (17, 18, 33). Disulfide s m . 82 crosslinking of MOMP correlates with accumulation of EBs and ca. 60% of MOMP was o r g / 83 found to have become cross-linked late in development. In the same study, cross-linking o n A 84 of OmcA was similiar to MOMP whilst OmcB was 80% cross-linked by the end of the p r il 3 85 developmental cycle (32). Furthermore, it has been speculated that at later time points, , 2 0 86 oxidation of reduced sulfhydryls in RB envelope proteins could promote the 1 9 b 87 condensation process involved in re-differentiation of RBs to EBs (17). This is consistent y g u 88 with observations that cultivation of cells in cysteine depleted media does not affect RB e s t 89 replication but severely retards formation of EBs (20). In aggregate, reduction and 90 oxidation of disulfide bonding between proteins in the chlamydial outer envelope is 91 integral to progression of the developmental cycle. 4 92 Chlamydiae employ a type III secretion system (T3SS) throughout development 93 to mediate interactions with the host cell and promote pathogenesis (reviewed in (5, 43). 94 This specialized secretion machinery is an essential virulence mechanism utilized by a 95 variety of Gram-negative pathogens to translocate anti-host effector proteins directly into 96 host cells. The T3SS has been referred to as a “molecular syringe” and comprises a D 97 multi-protein basal apparatus spanning both bacterial membranes, an exogenous needle o w n 98 filament composed of a single protein, and a terminal multimeric protein forming a tip lo a d 99 complex (22, 24). In Chlamydia spp., activity of this secretion system is uniquely linked e d f r 100 to the developmental cycle (5, 34, 44). Since a pre-formed T3SS exists in EBs (16) and o m 101 secretion activity begins as early as invasion (10, 23), T3S components must be able to h t t p : 102 negotiate the highly cross-linked envelope. It is possible that T3S apparatus proteins may // jb . a 103 themselves represent integrated members of the supramolecular disulfide-bonded s m . 104 complex (5). In this study we investigate the possibility that developmentally responsive o r g / 105 disulfide bonding occurs among T3S apparatus proteins of the outer Chlamydia envelope. o n A 106 Indeed, our bioinformatic analyses revealed an unusual distribution of cysteine residues p r il 3 107 in distal components of the chlamydial T3S apparatus, and EB-localized apparatus , 2 0 108 proteins CdsF, CdsC, and CdsD exhibit evidence of disulfide bonding. Evidence was 1 9 b 109 most dramatic for the needle protein CdsF and disulfide bonding patterns correlated with y g u 110 development. Taken together, our data suggest that reduction and oxidation of specific e s t 111 chlamydial T3S apparatus proteins is integral to progression of development in a manner 112 similar to other cysteine-rich proteins of the chlamydial envelope. 113 114 5 115 MATERIALS AND METHODS 116 Cell culture and organisms 117 Chlamydia trachomatis serotypes L2, D and B, Chlamydia pneumoniae AR39, C. 118 psittaci 6BC and C. caviae GPIC were used in these studies. Chlamydial propagation 119 was performed in HeLa 229 epithelial cells (CCL 1.2; American Type Culture Collection, D 120 Manassas, VA) maintained in RPMI-1640 (Invitrogen, Carlsbad, CA) supplemented with o w n 121 10% fetal bovine serum (Sigma, St Louis, MO) and 10 µg·mL-1 gentamicin (Mediatech, lo a d 122 Herdon, VA). Cultures were incubated at 37°C in an atmosphere of 5% CO /95% e 2 d f r 123 humidified air. Pure EBs and RBs were obtained by density gradient (DG) purification o m 124 through MD-76®R (Mallinckrodt, Inc. St. Louis, MO) density gradients as described h t t p : 125 previously (8). Saccharomyces cerevisiae MaV203 (Invitrogen) was cultivated at 30oC // jb . a 126 on non-selective YPD media, or selective media (broth and agar) lacking the appropriate s m . 127 amino acids, supplemented where appropriate with 35 mM 3-Amino-1,2,4-triazole, o r g / 128 approx. 95% TLC (3-AT) (Sigma). Escherichia coli BL21 A1 (Invitrogen) was o n A 129 propagated at 37oC in Luria-Bertani (LB) broth with shaking at 200 rpm, or on LB agar p r il 130 plates supplemented with carbenicillin (carb; Sigma) at 100 μg ml-1. 3, 2 0 131 1 9 b 132 Biochemical cross-linking studies y g u 133 For cross-linking studies, DG purified EBs were suspended in 1 ml Hank’s e s t 134 balanced salt solution (HBSS; Invitrogen) and covalently cross-linked by treatment with 135 bismaleimidohexane (BMH; Thermo Fisher Scientific, Inc, Rockford, IL) at a final 136 concentration of 3 mM dissolved in dimethyl sulfoxide (DMSO; Sigma, St. Louis- 137 Aldrich Co., MO). Samples were incubated at ambient temperature for 30 min. 6 138 Following incubation reactions were quenched by washing with RPMI plus 10% FBS and 139 processed for immunoblot analysis. For samples that were pre-treated with dithiothreitol 140 (DTT; Thermo Fisher Scientific), DG pure EBs were suspended in 1 ml phosphate 141 buffered saline pH 7.2 (PBS; 135 mM NaCl, 2.7 mM KCl, 10 mM Na HPO , 1.8 mM 2 4 142 KH PO ) containing 5 mM final concentration of DTT and incubated for 30 min at 2 4 D 143 ambient temperature. DTT was then removed by centrifugation and EBs were washed o w n 144 twice in PBS. After the final wash, EBs were suspended in 1 ml HBSS, treated with lo a d 145 BMH as above and processed for immunoblot analysis. e d f r 146 o m 147 Time course assays h t t p : 148 For chlamydial infections, ca. 5 x 105 HeLa cells were treated in separate // jb . a 149 experiments with C. trachomatis L2 at a multiplicity of infection (MOI) of 10 (early s m . 150 time-points; 0-2 hrs) or 1 (late time-points; 20-26 hrs) in Hank’s balanced salt solution o r g / 151 (HBSS; Invitrogen). Inocula were removed after incubation for 1 hr at 37°C, and o n A 152 cultures were washed thoroughly with HBSS prior to addition of culture medium RPMI- p r il 153 1640 (Invitrogen). RPMI containing 15 μg·ml-1 Heparin (Sigma) was used in early time- 3, 2 0 154 point experiments to prevent subsequent attachment and invasion of any remaining 1 9 b 155 chlamydiae. Where indicated, infections were performed in the presence of 2.5 μg·ml-1 y g u e 156 cytochalasin D (Sigma) as described (9). For early time-point experiments, cultures were s t 157 harvested immediately (T = 0) or 2 hrs (T = 2) after RPMI addition. Late time-point 158 cultures were lysed at 20 and 26 hrs post infection. All cultures were harvested by 159 addition of 1 ml ice-cold sterile ddH O containing 150 μM IAM and protease inhibitors 2 160 cocktail (Roche, Indianapolis, IN) and incubation on ice for 5 min. Material was 7 161 transferred to a micro-centrifuge tube and TCA precipitated over night at 4oC before 162 being processed for immunoblot using SDS-PAGE buffer without β-Me. For Ampicillin 163 treatment, cultures were supplemented with a final concentration of 20 μg/ml ampicillin 164 dissolved in ddH O at 15 hr pi and harvested 7 hr later as above. Progeny infectious 2 165 forming units (IFUs) were determined in duplicate for all time-points as previously D 166 described (8) and cytochalasin D efficiency was evaluated as described (9). Inclusions o w n 167 were enumerated after specific detection of chlamydiae with α-MOMP followed by lo a d 168 incubation with secondary antibodies conjugated to Alexa Fluor-488 (Invitrogen). e d f r 169 Inclusions were visualized by epi-fluorescence microscopy using a 40X apochromat o m h 170 objective on a TE2000U inverted photomicroscope (Nikon). t t p : / 171 / jb . a 172 Ectopic expression studies s m . o 173 Gateway technology (Invitrogen) and QuikChange site directed-mutagenesis r g / o 174 (Stratagene, La Jolla, CA) were used according to the manufacturer’s instructions to n A 175 generate alanine replacement of CdsF cysteine residues at positions 6 and 19. Briefly, p r il 3 176 pDONR221-CT666 (6) was used as a template for site-directed mutagenesis using a , 2 0 177 QuikChange kit (Stratagene), according to the manufacturer’s instructions, with primers 1 9 b 178 5'-AAAAGCAGGCTTCATGGCGAGCGGAAGTGCGTCGGCTTTTAATTTC-3' and , y g u 179 5'-GAAATTAAAAGCCGACGCACTTCCGCTCGCCATGAAGCCTGCTTTT-3' to e s t 180 convert Cys 6 to Ala or 5'AACCAGATGCTGGATGGCGTAGCGAAATACGTTCAGG 181 GAGTACAA-3' and 5'-TTGTACTCCCTGAACGTATTTCGCTACGCCATCCAG 182 CATCTGGTT-3' to convert Cys19 to Ala. Genes containing single point mutations C6A, 183 C19A and the double point mutation C6,19A were created. Each mutation generated in 8 184 pDONR221-CT666 (Betts et al, 2008) was confirmed by DNA sequencing (Genewiz, 185 South Plainsfield, NJ) prior to subsequent LR recombination reactions to transfer 186 unaltered CdsF, CdsF-C6A, CdsF-C19A, and CdsF-C6,19A coding sequences to the 187 Gateway destination vectors pDEST22 (expressing the yeast Gal4 activating domain), 188 pDEST32 (expressing the yeast Gal4 DNA binding domain), and pDEST17 (expressing D 189 6xHIS fusion tag) respectively. o w n 190 For yeast two-hybrid interaction assays, constructs were paired as follows: lo a d 191 pDEST22-CdsF + pDEST32-CdsF, pDEST22-CdsF-C6A + pDEST32-CdsF-C6A, e d f r 192 pDEST22-CdsF-C19A + pDEST32-CdsF-C19A and pDEST22-CdsF-C6,19A + o m 193 pDEST32-CdsF-C6,19A and co-transformed into yeast strain MaV203 (Invitrogen) using h t t p : 194 the S.c EasyComp transformation kit according to the manufacturer’s instructions // jb . a 195 (Invitrogen). Transformants were initially plated onto SD-agar (Clontech Laboratories s m . 196 Inc, Mountain View, CA) lacking tryptophan and leucine to select for successful o r g / 197 transformation of the vectors. Interactions were analyzed by transferring transformants to o n A 198 SD-agar lacking tryptophan, leucine and histidine, supplemented with 35 mM 3-AT p r il 199 (Sigma). All plates were incubated at 30oC for 3 days. Positive and negative controls 3, 2 0 200 consisted of pairings of pEXP32-Krev1+pEXP22-RalGDS-wt (positive) and pDEST22- 1 9 b 201 Empty+pDEST32-Empty (negative), respectively. y g u 202 For analysis of wild type and mutant CdsF constructs in an E. coli ectopic e s t 203 expression assay, vectors p17CdsF, p17CdsF-C6A, p17CdsF-C19A and p17CdsF- 204 C6,19A were individually transformed into E. coli BL21 A1 (Invitrogen) according to the 205 manufacturer’s instructions and plated onto LB agar supplemented with carb. Strains 206 were grown over night at 37oC, 200 rpm, in LB broth plus carb, then diluted to an OD 600 9 207 of 0.05 in 50 ml LB broth plus carb. Cultures were incubated at 37oC, 200 rpm, until an 208 OD of 0.395 was reached. Protein expression was induced by incubation for 3 hrs in 600 209 the presence of 0.2% L-arabinose (wt/vol; Sigma). The OD was measured for each 600 210 culture, and duplicate 1 ml samples were harvested by centrifuged at 14,000 rpm. 211 Proteins were concentrated via TCA precipitation and were resuspended in 3 x SDS- D 212 PAGE solubilization buffer with or without β-ME in volumes based on final OD600 to o w n 213 ensure equal amounts of material. CdsF was assayed for by immunoblot using primary lo a d 214 antibodies specific to the 6xHIS-tag encoded on the pDEST17 vector. e d f r 215 o m 216 Immunodetection h t t p : 217 For immunoblot analysis of DG pure EBs and RBs proteins, bacteria were treated // jb . a 218 with 150 μM iodoacetamide (IAM; Sigma) followed by concentration by addition of s m . o 219 trichloroacetate (TCA; Sigma) to 10% (v/v). Material was subsequently solubilized in r g / o 220 laemmli sodium dodecyl sulfate polyacrylimide gel electrophoresis (SDS-PAGE) n A 221 solubilization buffer lacking reducing agent or containing 5% (v/v) β-mercaptoethanol p r il 3 222 (β-ME; Sigma) where appropriate. Proteins were resolved by SDS-PAGE (25) in 4-20% , 2 0 223 (v/v) gradient (Biorad Laboratories, Inc., Hercules, CA) polyacrylamide gels and 1 9 b 224 transferred to Immobilon-P (Millipore, Corp., Billerica, MA.) in Tris-glycine buffer (25 y g u 225 mM Tris, 192 mM glycine, 10% methanol, pH 8.8). Specific proteins were identified by e s t 226 probing with primary antibodies to CdsF (6), CdsC (16), CdsD (16), MOMP (3), or 227 CT584. Polyclonal antisera specific to CT584 was generated by immunization of female 228 New Zealand White rabbits (Proteintech Group, Inc., Chicago, IL) with purified His- 229 tagged full-length CT584 prepared and purified by standard methods (15). Antibody 10