Logout succeed
Logout succeed. See you again!

1 Identification of a Novel Antiviral Inhibitor of the Flavivirus PDF
Preview 1 Identification of a Novel Antiviral Inhibitor of the Flavivirus
JVI Accepts, published online ahead of print on 6 June 2012 J. Virol. doi:10.1128/JVI.00384-12 Copyright © 2012, American Society for Microbiology. All Rights Reserved. 1 Identification of a Novel Antiviral Inhibitor of the Flavivirus Guanylyltransferase Enzyme 2 3 Hillary J. Stahla-Beek1, Daniel G. April2, Bejan J. Saeedi2, Amanda M. Hannah1, Susan M. Keenan1* and 4 Brian J. Geiss2,3* 5 1School of Biological Sciences, University of Northern Colorado, Greeley, CO, USA D 6 2Department of Microbiology, Immunology, Pathology, Colorado State University, Fort Collins, CO USA o w n 7 3Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, CO USA lo a d 8 e d f 9 *Correspondence can be sent to either: ro m 10 Susan Keenan Brian Geiss h t t p : 11 School of Biological Sciences Department of Microbiology, Immunology, and Pathology // jv i. 12 University of Northern Colorado Colorado State University a s m 13 Greeley, CO 80639 Fort Collins, CO 80523 .o r g / 14 Phone: (970) 351-2510 Phone: (970) 491-6330 o n 15 Fax: (970) 351-2335 Fax: (970) 491-2221 A p r 16 e-mail:[email protected] e-mail: [email protected] il 1 2 , 17 2 0 1 18 Running Title: Thioxothiazolidins as Anti-Flaviviral Inhibitors 9 b y 19 Keywords: Flavivirus; RNA capping; Antiviral; Guanylyltransferase g u e 20 s t 21 22 23 24 1 25 Abstract 26 Arthropod-borne flavivirus infection causes serious morbidity and mortality worldwide, but there are 27 currently no effective antiviral chemotherapeutics available for human use. Therefore, it is critical that 28 new therapeutics to virus-specific targets be developed. To identify new compounds that may be used 29 as broadly active flavivirus therapeutics, we have performed a high-throughput screen of 235,456 D 30 commercially available compounds for small molecule inhibitors of the dengue virus NS5 RNA capping o w n 31 enzyme. We identified a family of compounds, the 2-thioxothiazolidin-4-ones, that show potent lo a d 32 biochemical inhibition of GTP binding and guanylyltransferase function of the capping enzyme. During e d f 33 the course of structure-activity relationship analysis, a molecule within this family (E)-(3-(5-(4-tert- ro m 34 butylbenzylidene)-4-oxo-2-thioxo-1,3-thiazolidin-3-yl)propanoic acid (BG-323)) was found to possess h t t p : 35 significant antiviral activity in a dengue virus subgenomic replicon assay. Further testing of BG-323 // jv i. 36 demonstrated that this molecule is able to reduce the replication of infectious West Nile and yellow a s m 37 fever viruses in cell culture with low toxicity. The results of this study describe the first inhibitor that .o r g / 38 targets the GTP-binding / guanylyltransferase activity of the flavivirus RNA capping enzyme. o n 39 A p r 40 Introduction il 1 2 , 41 Arthropod-borne virus infections remain a major cause of morbidity and mortality worldwide. More 2 0 1 42 than two billion people are at risk of infection with dengue virus (DEN) and 600 million people at risk of 9 b y 43 infection with yellow fever virus (YF) (20). Globally, an estimated 50-100 million cases of DEN and g u e 44 200,000 cases of YF reported each year, which result in respectively ~20,000 to ~30,000 deaths annually s t 45 (11). There are currently no clinically useable chemotherapeutic options for the treatment of any 46 flavivirus infection, making it essential that new strategies and targets for the treatment of flavivirus 47 infections be identified. 48 2 49 Flaviviruses are small enveloped, single-stranded positive sense RNA viruses with genomes consisting of 50 approximately 11,000 kb RNA with a 5’ type 1 RNA cap (23). The viral genome is translated as a single 51 open reading frame (ORF) encoding a polyprotein precursor that is processed into three structural 52 proteins (capsid, premembrane, and the envelope) and eight nonstructural proteins (NS1, NS2A, NS2B, 53 NS3, NS4A, 2K, NS4B and NS5) by viral and cellular proteases (16). Currently, four viral enzymes are D 54 being studied as targets for antiviral drug discovery, including the NS3 helicase and protease enzymes o w n 55 and the NS5 RNA dependent RNA polymerase and capping enzymes (reviewed in (8)). lo a d 56 e d f 57 In particular, the capping enzyme has received a good deal of attention as a novel antiviral drug target in ro m 58 recent years. The flavivirus capping enzyme has three distinct functions that can be targeted for h t t p : 59 therapeutic intervention: the N7/2’-O methyltransferase reactions (2, 3, 6, 9) and the recently // jv i. 60 discovered guanylyltransferase reaction (10, 13, 14). The formation of the 5’ cap structure is critical to a s m 61 the survival of the virus for several reasons, including directing viral polyprotein translation and .o r g / 62 protecting the 5’ end of the genome from cellular exonucleases. It has also been recently shown that a o n 63 fully mature type 1 cap is a mechanism that cells use to discriminate self from non-self RNAs, and A p r 64 interference with the formation of a mature type 1 cap on the flavivirus genome limits viral replication il 1 2 , 65 (5, 28). The flavivirus NS5 N-terminal capping enzyme is highly conserved across the flavivirus genus, 2 0 1 66 and the guanosine triphosphate (GTP) and S-adenosyl methionine (SAM) binding sites, as well as the 9 b y 67 overall structure of the enzyme, are well conserved (4, 7, 9, 18, 27). The critical nature of the capping g u e 68 enzyme in viral replication and immune evasion, as well as its conservation across the flavivirus genus, s t 69 position the capping enzyme as an important target for antiviral development efforts. The 70 methyltransferase activity has been the primary capping enzyme target for drug development (15, 21), 71 and Ribavirin triphosphate has been observed to bind to and displace GTP from the enzyme (1). 3 72 In this manuscript we describe the identification and characterization of the 2-thioxothiazolidin-4-one 73 family of compounds as novel inhibitors of the flavivirus RNA capping enzyme guanylyltransferase. We 74 previously reported an analysis of the capping enzyme GTP binding site (9) and a pilot high throughput 75 screen (HTS) of 46,323 small molecule compounds using a fluorescence polarization assay (10). A screen 76 for compounds capable of displacing GTP from the dengue capping enzyme was performed against D 77 235,456 compounds from the NSRB library located at the National Screening Laboratory (Harvard o w n 78 Medical School (Longwood Campus)). We detail the process of developing structure activity lo a d 79 relationships (SAR) with analogs within this family, which have lead to a solid understanding of the e d f 80 binding parameters of these compounds to the capping enzyme. During this process we identified a ro m 81 lead compound (E)-(3-(5-(4-tert-butylbenzylidene)-4-oxo-2-thioxo-1,3-thiazolidin-3-yl)propanoic acid) h t t p : 82 (referred to as BG-323 hereafter), that competes with GTP binding to the capping enzyme, inhibits // jv i. 83 capping enzyme protein guanylation activity in vitro, and displays antiviral activity against multiple a s m 84 different flaviviruses in cell culture. These findings demonstrate that the 2-thioxothiazolidin-4-one .o r g / 85 family is a novel scaffold for developing effective and specific antiviral molecules targeting the GTP o n 86 binding pocket of the flavivirus RNA capping enzyme. A p r 87 il 1 2 , 88 Materials and Methods 2 0 1 89 Expression and Purification of flavivirus NS5 Capping Enzymes 9 b y 90 Recombinant NS5 capping enzyme domains from yellow fever virus (strain 17D, AA 1-268) and dengue g u e 91 virus type 2 (strain 16681, AA 1-267) were previously described (9). Briefly, yellow fever virus capping s t 92 enzyme was produced in BL21 (DE3) Codon Plus E. coli cells (Novagen). Dengue virus capping enzyme 93 was produced in BL21 (DE3) pLysS E. coli cells (Novagen). Yellow fever and dengue virus proteins were 94 induced and purified using the same protocol. Cultures (750 ml) were induced with 400 μM IPTG 95 overnight at 22oC, and the bacterial pellets were collected and stored at -80oC in low imidizole lysis 4 96 buffer. Frozen pellets were thawed and lysed with a microfluidizer, and the lysate was clarified by 97 centrifugation at 18K RPM in a SS-24 rotor. The histidine-tagged proteins are purified from clarified 98 lysates using a nickel-sepharose column on an AKTA Purifier FPLC system. The eluted protein was 99 concentrated using 10K Amicon Ultra concentrators (Millipore) and buffer exchanged into 400 mM NaCl, 100 20 mM Tris pH 7.5, 0.02% sodium azide, 20% glycerol, and 5mM Tris (2-carboxyethyl) phosphine D 101 hydrochloride (TCEP-HCl) on a Superdex 200 gel filtration column (Amersham). Purified proteins were o w n 102 concentrated using 10K Amicon Ultra concentrators to 100 µM and the concentrations were determined lo a d 103 by the absorbance at 280 nm using extinction coefficients obtained from the ExPASy web site. Isolated e d f 104 proteins were >99% pure as estimated from SDS-PAGE and Coomassie blue staining. Purified protein ro m 105 was stored at -80 °C in single-use aliquots. h t t p : 106 // jv i. 107 High-Throughput Screening a s m 108 High throughput screening was performed at the National Screening Lab (NRSB) located at the Harvard .o r g / 109 Medical School Longwood campus (ICCB-Longwood Screening Facility). To perform the screen, 500 nM o n 110 of purified dengue virus capping enzyme was complexed with 10 nM of GTP-Bodipy γ-phosphate labeled A p r 111 analog (Invitrogen, Catalog # G22183) in binding buffer (50 mM Tris-Base (pH 7.5), 0.01% NP40, 2 mM il 1 2 , 112 dithiothreitol). 30 µl was dispensed into low-binding opaque black 384 well plates (Catalog # 3654, 2 0 1 113 Corning, Corning NY) using a Matrix WellMate liquid handler (Thermo Fisher Scientific, Waltham, MA). 9 b y 114 One column of 10 µM GTP (final concentration) was used as a positive control on each plate, and one g u e 115 column was treated with dimethyl sulfoxide (DMSO) as a negative control. Screening compounds were s t 116 added to each plate with an Epson compound transfer robot fitted with a 100 nl 384 pin transfer array. 117 Plates treated with 100 nl of compound (5 mg/ml stock concentrations) were allowed to incubate for 1 118 hr at 23oC, then total fluorescence and fluorescence polarization signals were detected on an Envision 119 2103 Multimode platereader with plate stacker attachment (Perkin Elmer, Waltham, MA). Each 5 120 compound was tested in duplicate. The overall Z’ score of the screen was >0.7. Compounds that 121 reduced both total fluorescence and fluorescence polarization signals by greater than 50% were cherry- 122 picked and re-tested on a Victor 3V platereader. 123 124 Determination of apparent K values i D 125 Compounds were obtained from ChemDiv and Hit2Lead. All small molecules were diluted in DMSO to o w n 126 10 mM and were stored in a -20°C freezer. All compounds were stored in small aliquots in a desiccator lo a d 127 to prevent freeze/thaw cycles. Kvalues for each compound were determined based on the equation e i d f 128 detailed in (17) using a fluorescence polarization assay as previously described (9, 10). Compounds were ro m 129 tested at least 3 times each, and standard deviations for each K value are reported. h i t t p : 130 // jv i. 131 Guanylation Inhibition Assay a s m 132 Capping enzyme protein guanylation as performed as described previously (10). Briefly, 3 µM dengue .o r g / 133 capping enzyme was incubated with 1 µM GTP-ATTO-680 (Catalog # NU-830-680, Jena Bioscience, Jena, o n 134 Germany), 500 nM MgCl, 0.1% NP-40, and 1 µM TCEP. Reactions were treated with compounds at final A 2 p r 135 concentrations of 100 µM, 50 µM, 25 µM, 10 µM, and 2.5 µM or mock DMSO controls for 4 hours at il 1 2 , 136 37oC. At the end of the incubation, samples were quenched with 1 µl of 1 M EDTA and 6X Laemmli 2 0 1 137 buffer was added. Samples were boiled for 15 minutes and resolved on 12% SDS-PAGE gels. The gels 9 b y 138 were imaged for ATTO-680 signal on a Licor Odyssey UV scanner (Licor, Lincoln, NE), then the gels were g u e 139 stained with Coomassie blue to verify protein equivalence. Coomassie-stained gels were analyzed using s t 140 the NIH Image J software package. ATTO-680 signals for experimental samples were normalized for 141 protein concentration as compared to on-gel control samples. Inhibition values were determined using 142 non-linear regression analysis in the Prism Software package (Graphpad Software Inc, La Jolla, CA). 6 143 Average EC values and standard error of the mean values are reported. Each experiment was 50 144 performed three times. 145 146 Antiviral (Replicon) Assay 147 BHK cells harboring a stable dengue type 2 virus subgenomic replicon (BHK-pD2hRucPac) expressing D 148 Renilla luciferase have been previously described (26). BHK-pD2hRucPac cells were grown in DMEM o w n 149 media supplemented with 10% fetal bovine serum and 3 µg/ml puromycin to maintain stability of the lo a d 150 replicon. Working stocks of BHK-pD2hRucPac cells were used for two months and then replaced with e d f 151 fresh stocks to maintain the sensitivity of the replicon to antiviral drugs. Antiviral assays were ro m 152 performed by seeding white opaque 96-well cell culture plates (Catalog # T-3021-13, Bioexpress, h t t p : 153 Kaysville, UT) with 2000 cells/well in 100 µl DMEM supplemented with 10% FBS but without puromycin. // jv i. 154 Cells were allowed to attach overnight at 37oC. The next day, test compounds were diluted in DMSO a s m 155 and 1 µl of each dilution was added to appropriate wells (200 µM to 78 nM final concentrations). Each .o r g / 156 plate included a control column of DMSO with no drug and several rows of Ribavirin (200 µM to 78 nM o n 157 final concentrations) to verify the sensitivity of the replicons to drug. Cells were incubated at 37oC for A p r 158 72 hours, when cells were tested for Renilla Luciferase activity and cell viability. Media was replaced il 1 2 , 159 with 25 µl of DMEM containing 1:1000 dilution of Viviren Live Cell Renilla Luciferase Reagent (Catalog # 2 0 1 160 E6492, Promega, Madison, WI), and the plates were incubated for 10 minutes at 37oC. Renilla Luciferase 9 b y 161 signal was detected on a Victor Multi-Mode plate reader (Perkin Elmer). After reading the Renilla g u e 162 Luciferase signal, 25 µl of CellTiter-Glo cell viability reagent (Catalog # G7571, Promega, Madison, WI) s t 163 was added to each well, and the cells were incubated for 10 minutes at 37oC. CellTiter-Glo signal was 164 detected in the same manner as the Viviren signal. Renilla and CellTiter-Glo experimental samples were 165 converted to percent of the averaged on-plate DMSO controls, and non-linear regression curves 166 (variable slope) were generated with the Prism software. EC values were calculated for Renilla 50 7 167 luciferase and CC values calculated for CellTiter-Glo curves, and averaged values and standard 50 168 deviations over at least three experiments for each are reported. Therapeutic index (TI) is calculated as 169 CC /EC . 50 50 170 171 Viral assays D 172 West Nile virus (Kunjin subtype) and yellow fever (17D) virus growth curves were performed in BHK o w n 173 cells. Cells were plated in 6-well plates at 100,000 cells/well and allowed to attach overnight. The next lo a d 174 day cells were treated with BG-323 or DMSO at the indicated concentrations and concurrently infected e d f 175 with Kunjin or yellow fever virus at a multiplicity of infection (MOI) of 0.01. 250 µl media samples were ro m 176 taken at 4, 12, 24, 36, 48, 72, 96, and 120 hours post infection and stored at -80oC. Samples were h t t p : 177 titered for virus concentration by plaque assay on BHK cells as previously described (19). Viral growth // jv i. 178 curves were generated with Prism (Graphpad Inc., La Jolla, CA). Renilla luciferase expressing Sindbis a s m 179 virus pBG451 was previously described (24). Renilla signal was detected in infected BHK cells with .o r g / 180 Viviren live cell reagent (Promega), and cell viability was detected with CellTiter Glo reagent (Promega). o n 181 Each experiment was performed three times and the average plaque forming unit (PFU)/ml and A p r 182 standard error of the mean is reported. il 1 2 , 183 2 0 1 184 Quantitative Reverse Transcriptase Real-Time PCR Analysis 9 b y 185 West Nile virus (Kunjin) RNA was extracted from cell culture media with Trizol LS (Invitrogen, La Jolla, g u e 186 CA) following the manufacturer’s protocol. Quantitative reverse transcriptase real-time PCR reactions s t 187 for Kunjin genomic RNA were performed using the Brilliant III Ultra-Fast SYBR QRT-PCR Master Mix 188 (Catalog # 600886, Agilent, Santa Clara, CA) with primers Fwd 6170 (5’- 189 TGGACGGGGAATACCGACTTAGAGG) and Rev 6278 (5’-ACCCCAGCTGCTGCCACCTT). To set up qRT-PCR 190 reactions, 2 μl of extracted RNA was added to 5 μl of 2X master mix, 1 μl of 5 μM Fwd 6170 primer, 1 μl 8 191 of 5 μM Rev 6278 primer, and 1 μl of 100 mM DTT in 96-well PCR plates with optically clear sealing films. 192 No RNA and no primer controls were included in each experiment. qRT-PCR reactions were performed 193 on a BioRad CFX384 real-time PCR thermal cycler using the following cycling conditions: Reverse 194 transcriptase step = 50oC, 10 minutes; Denature step = 95oC, 3 minutes; PCR (40 cycles) = 95oC, 5 195 seconds / 60oC, 10 seconds. Melt curves were performed at the end of each run, to verify the specificity D 196 of the detected SYBR signal. Cq values were determined by setting the threshold to 40 for all o w n 197 experiments. Standard curves were generated from diluted media containing Kunjin virus of known titer lo a d 198 (PFU/ml), and the Cq values from experimental samples were compared to the standard curve to e d f r 199 establish PFU equivalent/ml values for each sample (y=-3.475x + 27.577 , y=Cq , X=Log (PFU)). The limit o 10 m 200 of detection in these experiments was determined to be 10 PFU equivalents/ml. All experiments were h t t p : 201 performed three times, and the average and standard error of the mean reported. // jv i. 202 a s m 203 Western blot analysis .o r g / 204 BHK cells were infected with Kunjin virus at MOI = 0.1 and treated with increasing concentrations of BG- o n 205 323 or DMSO. At 72 hrs post-infection, cells were collected and lysates were prepared by boiling in 1X A p r 206 laemelli buffer. Lysates were resolved on 12% PAGE gel and protein was transferred to nitrocellulose il 1 2 , 207 membranes. Western blot analysis was performed with anti-NS5 antibody 5D4 (12) and anti-β-actin 2 0 1 9 208 (Abcam #6276) on a separate membrane. Bands were detected with an IR-DYE-800 anti-mouse b y 209 secondary antibody (Rockland Scientific) on an Odyssey UV Imaging system. g u e 210 s t 211 Modeling Analysis 212 Each molecular structure was drawn using Maestro and minimized using Macromodel (Schrodinger, NY). 213 For minimization of all small molecules, the dielectric constant was set to 4.0 (aqueous), the maximum 9 214 iterations was set to 1000 and the convergence threshold was set to 0.05 kJ/Å-mol. The OPLS_2005 215 forcefield was used and conjugate gradient methodology applied. 216 217 Docking and scoring 218 All small molecules were evaluated with GOLD (25) to determine potential orientations of association D 219 with dengue virus capping enzyme (PDB Code: 3EVG) and yellow fever virus capping enzyme (PDB Code: o w n 220 3EVD). Unless discussed below, default parameters were applied. The centroid of the docking sphere is: lo a d 221 x=16.37, y=-52.73 and z=17.934, with an active site radius of 10 Å. Each run consisted of 50 iterations e d f 222 per small molecule. The fitness function and search settings had the annealing parameters such that ro m 223 van der waals radii = 4 Å and hydrogen bonding distance = 2.5 Å. Fifty docked conformations were h t t p : 224 obtained for each compound and DSViewerPro 5.0 (Accelrys, CA) was used to visualize properties // jv i. 225 between the small molecule and the capping enzyme protein. For the majority of compounds one a s m 226 predominant conformation was obtained and was chosen as the physiologically relevant orientation for .o r g / 227 further analysis. For compounds with multiple orientations (generally observed for compounds with o n 228 lower binding affinity), the orientation most similar (via visual inspection) to the conserved A p r 229 physiologically relevant orientation was chosen for further analysis. The docking protocol used was il 1 2 , 230 previously validated for ligand binding to the dengue capping enzyme (10) and can recapitulate the 2 0 1 231 association of GTP, GDP, and GMP within the binding site (data not shown). 9 b y 232 g u e 233 s t 234 Results 235 High-throughput screening 236 Based on our previous screen of 46,323 compounds against the yellow fever virus capping enzyme (10), 237 we performed a second screen of the remaining 235,456 compounds in the NRSB library for molecules 10