loading

Logout succeed

Logout succeed. See you again!

ebook img

2014 Human coronavirus NL63 replication is cyclophilin A-dependent and inhibited by non-immunosuppressive cyclosporine A PDF

release year2014
file size1.83 MB
languageEnglish

Preview 2014 Human coronavirus NL63 replication is cyclophilin A-dependent and inhibited by non-immunosuppressive cyclosporine A

VirusResearch184(2014)44–53 ContentslistsavailableatScienceDirect Virus Research journal homepage: www.elsevier.com/locate/virusres Human coronavirus NL63 replication is cyclophilin A-dependent and inhibited by non-immunosuppressive cyclosporine A-derivatives including Alisporivir JavierCarbajo-Lozoyaa,1,YueMa-Lauera,1,MiroslavMalesˇevic´b,MartinTheuerkornc, Viktor iaKahlertc,ErikPre llc,2 ,Brigittevon Brunna,D oreenMuth d,Thom asF.Baumerte, Christian Drosten d,Gu nterFisc herc,Al brec htvonB runna,∗ aMax-von-PettenkoferInstitut,Ludwig-Maximilians-Universität,München,Germany bMartin-Luther-Univer sitätHa lle-Wittenberg,InstituteofBioche mistryand Biotechnology,DivisionofEnzymology,Halle,Germany cMax-Planck-InstituteofBio physicalChemistr yGötting en ,BOHalle(Sa ale), Germany dInstitutfürVirologie, Un iversitätBo nn,Bonn,G ermany eInserm U11 10,Institu tdeRecher chesu rlesM aladiesViralesetHépatiques,UniversitédeStrasbourg,Strasbourg,France a r t i c l e i n f o a b s t r a c t Articlehistory: Untilrecently,therewerenoeffectivedrugsavailableblockingcoronavirus(CoV)infectioninhumans Receiv ed15January2014 anda nimals.W ehav eshow n beforetha tCsA andFK506 inhibitc oronavirusr eplicat ion(Carba jo -Lozoya, AReccceepivteedd i1n3 r Feevbisreuda rf yor2m0 1142 February 2014 J., M üller, M.A ., K allies , S., Thi el, V., D rost en, C ., vo n Brun n, A. Re plication of human coro naviruses SARS- CoV,HCoV-NL63andHCoV-229EisinhibitedbythedrugFK506.VirusRes.2012;Pfefferle,S.,Schöpf, Availableonline22February2014 J.,Kögl,M.,Friedel,C.,Müller,M.A.,Stellberger,T.,vonDall’Armi,E.,Herzog,P.,Kallies,S.,Niemeyer,D., Ditt,V.,Kuri,T.,Züst,R.,Schwarz,F.,Zimmer,R.,Steffen,I.,Weber,F.,Thiel,V.,Herrler,G.,Thiel,H.-J., Keywords: Schwegmann-Weßels,C.,Pöhlmann,S.,Haas,J.,Drosten,C.andvonBrunn,A.TheSARS-Coronavirus-host HCoV-NL63 interactome:identificationofcyclophilinsastargetforpan-Coronavirusinhibitors.PLoSPathog.,2011). Cyclosporine/FK506-non- immunosuppressive Here we demonstrate that CsD Alisporivir, NIM811 as well as novel non-immunosuppressive derivatives derivatives ofCsAandFK506stronglyinhibitthegrowthofhumancoronavirusHCoV-NL63atlowmicromolar,non- Inhibitionofviralreplication cytotoxicconcentrationsincellculture.WeshowbyqPCRanalysisthatvirusreplicationisdiminishedup CyclophilinA tofourordersofmagnitudetobackgroundlevels.KnockdownofthecellularCyclophilinA(CypA/PPIA) FKBP ge nein Caco-2 ce llsprevent sre plicationof HCoV- NL63,sugges tin gth atCypA isrequired fo rvirusrepli- cation.Collectively,ourresultsuncoverCyclophilinAasahosttargetforCoVinfectionandprovidenew strategiesforurgentlyneededtherapeuticapproaches. ©2014ElsevierB.V.Allrightsreserved. 1. Introduction associated with respiratory tract i.e. common cold-like diseases. SARS-CoV(severeacuterespiratorysyndrome-CoronaVirus)isa Coronaviruses cause severe diseases of the respiratory and highlyagg ressiveh uman agent,causi ngthelungdisease SARS,w it h gastrointestinal tr act an d the ce ntral ner vou s sy stem in ani mals oftenf ataloutcom e(Dros tenet al.,2003 ).Th isvi rusappe ared asan (PerlmanandNe tland ,200 9).T heinfe ctionofh umansw it hHCoV- epide mici n2003aft erithad cro sse dthes pecie sbar riermostl ike ly OC43 and HC oV-229E are k now n since t he mid si xities to be frombats to civet cats an dhu mansd em onstrati ngthep oten tialof coronaviruses to cause high morbidity and mortality in humans (Lauetal.,2005;Lietal.,2005).Asnotreatmentwasavailable,the Abbreviations: EC50, 50% effective inhibitory concentration; CsA/CsD, epidemic could eventually be controlled by highly effective tradi- cyclosporineA/D;PPIase,peptidylprolylcis/transisomerase;CypA/B,cyclophilin tionalpublichealthmeasuresofquarantineandcaseisolation.The A/∗B;C AoLrrVe,s Aplois npdoinrigv iaru; tFhKoBrP .,T FeKl.5:0+64-9 b8in9d2i1n8 g0 p7r2o8t3e9in. . strains HCoV -NL63 and HCoV -H KU1 were d isco vered in 2004 and 2005,respectively(vanderHoeketal.,2004;Wooetal.,2005).They E-mailaddress:[email protected](A.vonBrunn). 12 CProensternib tuatdeddr eesqs u:aLlelyib tnhiez wInosrtikt.uteofPlantBiochem istr y,Ha lle(Saale),Germany. coaliutisse amndorpen seeuvmeroen lioaweesrp erecsiaplilryatinoryyo turancgt cihnifledcrteionn(sv lainked berroHnocheki-, http://dx.doi.org/10.1016/j.virusres.2014.02.010 0168-1702/©2014ElsevierB.V.Allrightsreserved. J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 45 2007).In2012,anewhumanCoVMERS(MiddleEastRespiratory (2011). Inhibition of feline CoV replication was also found by Syndromevirus,previouslycalled“EMC”)emergedfromtheMiddle Tanaka et al. (2012). Similarly, we showed that FK506 inhibits Eastwithclinicaloutcomessuchasrenalfailureandacutepneumo- thereplicationofSARS-CoV,HCoV-NL63andHCoV-229Eandthe nia,similartothoseofSARS-CoVbutwithanevenhighermortality dependence of HCoV-NL63 on FKBP1A/B (Carbajo-Lozoya et al., rateofabout50%(deGrootetal.,2013;vanBoheemenetal.,2012; 2012). Zakietal.,2012). Cyclophilins and FKBPs represent large, independent fami- Humancoronavirusescauseapproximately10–15%ofallupper lies of peptidyl-prolyl cis/trans isomerases (PPIases, EC number andlowerrespiratorytractinfections.Theyaccountforsignificant 5.2.1.8) thus exerting important functions on folding, matu- hospitalizationsofchildrenunder18yearsofage,theelderlyand ration and trafficking of proteins within the eukaryotic cell immunocompromisedindividuals.Accordingtoanumberofinter- (Blackburn and Walkinshaw, 2011; Davis et al., 2010). Both nationalstudies1-10%oftheacuterespiratorydiseasesarecaused CsA and FK506 act as tight-binding, reversible and competitive byHCoV-NL63(forreviewseeAbdul-RasoolandFielding,2010). inhibitors of the active site of these enzymes (Fischer et al., These numbers are probably an underestimation with regard to 1989). Physical interaction of cyclophilins with viral proteins, thegeneralpopulationsinceduringroutinediagnosticscreening and thus replication sensitivity to CsA have been shown for forrespiratoryvirusestestsforHCoVarefrequentlynotincluded. several viruses, e.g. the capsid proteins of Human Immunode- An important aspect of HCoV-NL63 infection is the co-infection ficiency Virus (HIV-1) (Strebel et al., 2009; Ylinen et al., 2009) withotherhumancoronaviruses,influenzaA,respiratorysyncy- and Human Papilloma virus (HPV) types 16 (Bienkowska-Haba tialvirus(RSV),parainfluenzavirusorhumanmetapneumovirus et al., 2009), the N protein of Vesicular stomatitis Virus (Bose (Abdul-RasoolandFielding,2010).Inchildrentheyareassociated etal.,2003),theNS5aofHepatitisCVirus(HCV)(Fernandesetal., with acute respiratory tract illness, pneumonia and Croup lead- 2010; Fischer et al., 1989), the NS4A protein of the mosquito- inginmanycasestohospitalization.Inarecentepidemiological borne Japanese encephalitis virus (Kambara et al., 2011), the studyoutof1471hospitalizedchildren(<2years)207(14%)were NS5 protein of West Nile virus (Qing et al., 2009) and the M1 HCoV-positive(Dijkmanetal.,2012).Infectionfrequenciesinchil- protein of influenza A virus (Liu et al., 2009). The most promi- dren with mild symptoms and in hospitalized children occurred nent cyclophilins thought to be involved are CypA and CypB. intheorderHCoV-OC43>HCoV-NL63>HCoV-HKU1>HCoV-229E. PPIase-independentactivitiesofCsAandFK506exertedbygain- In a large-scale survey on 11,661 diagnostic respiratory samples of-function,resultfromthebinarycomplexesformedbybinding collectedinEdinburgh,UK,between2006and2009,267(2.30%) of the drugs to Cyps and FKBPs, respectively. Based on the inhi- were positive for at least one coronavirus accounting for 8.15% bition of the protein phosphatase activity of calcineurin, these of all virus detections (Gaunt et al., 2010). 11% to 41% of coron- complexes block the cellular calcineurin (CaN)/NFAT pathway avirusesdetectedwerepresentinsamplestestedpositiveforother thereby interfering with T-cell activation and Il-2 production. respiratoryviruses(e.g.RSV). Chemicallychangedderivativescoveringspecificside-chainmod- Inhibitorsofcoronavirusenzymes(reviewedbyTong,2009a,b) ifications, the so-called non-immunosuppressive cyclosporine andcompoundsinhibitinginvitroreplicationhavebeendescribed or FK506 analogues, can discriminate between alternative (Kono et al., 2008; Milewska et al., 2013; Pyrc et al., 2006; te signalling pathways either based on PPIase- or CaN-inhibiting Velthuis et al., 2010; Vincent et al., 2005). The most instensely functions. studiedanti-viralcompoundsaredirectedagainstviralproteases IdentifyingtheinteractionoftheSARS-CoVNsp1proteinwith notpresentinthemammalianhost(Chaudhurietal.,2011;Chuck Cyps and FKBPs, and the sensitivity of CoV replication to both et al., 2011, 2013; Yang et al., 2005; Zhu et al., 2011). However, drugs, CsA and FK506, we suggested CsA as a potential pan-CoV clinically licensed antivirals for coronavirus infection are absent. inhibitor (Pfefferle et al., 2011). Here we demonstrate, by using Coronavirusesrepresentthegroupofthelargestsingle-stranded Alisporivir, NIM811 and a series of newly synthesized CsA and RNAviruseswithplusstrandorientation.Ingeneral,RNAviruses FK506 derivatives, inhibition of HCoV-NL63 replication indepen- replicateatlowfidelityandarethuspronetorapidevolutionary dentoftheimmunosuppressivecharacterofthecompounds.We changes. Although coronaviruses encode a proofreading exori- furthershowthatCypAbutnotCypBisrequiredforvirusreplica- bonuclease (nsp14 ExoN) increasing replicative robustness of its tion. large genomes, mutations within this domain increase mutation rates significantly (Smith and Denison, 2013). Virus replication depen dsonavari etyofh ostfa ctors(de Haana ndRo ttier,2006; 2. Materialsandmethods Vogels et al., 2011; Wang and Li, 2012) which represent poten- tial an tiv iral target s. The se m igh t be more p referable targets 2.1. Antibodiesanddrugs than viral proteins as development of resistance is much less likely . Mouse antibody 1H11 (1:20,000) recognizing HCoV-NL63 N- In a recent study we performed a genome-wide SARS-CoV protein was obtained from INGENASA, Spain (Sastre et al., yeast -tw o-hybr id inte ract ion screen wi th human cDN A libraries 2011). Anti-L amin A ( 1:20,0 00) was pu rchased from Biom ol, identifying human immunop hilins (i nclud ing cycl ophilin s [Cyps] Hambu rg, German y. Goat-anti-L amin B (1:400) , rabb it anti- and FK506 -binding proteins [FKBP s] as inte raction partn ers of CypA (1:2 000) and rabbit anti-CypB (1 :1000) w ere ob tained CoV non-structural protein 1 [Nsp1] (P fefferle et a l., 2011). A from Santa Cru z Bio techno logy, Enzo Life Scien ces an d Abcam, pron ouncedfeature ofmost ma mmalia ncycloph ilin sis theirab il- respe ctively . Seco ndary antibodi es we re re ceived fr om Dianova ity to bind the imm u nosup pressive dru g cyclospor in e A ( CsA). (goat anti-ra bbit-Ig-hor se radish p eroxid ase HRP, [1:30 00] and We sh owed th at the drug acts as a rep lication inhib ito r of a rabbi t-anti-goat-Ig-HRP[1 :3000]) andSigma (anti- mouse-Ig- HRP num ber of h uman (SA RS-Co V, H CoV -N L63 and H CoV-229E) an d [1:40,000]). animal cor onaviru ses (Feline CoV [serotyp es I and II], por cine Compounds 1, 2, 3, 4, and 5 were synthesized as previously transm issible gastroen teritis virus (TGEV), an d avia n in fectious described (Male se vic et a l., 20 13 ; Prel l et al., 2013 ). T he synthe- bronchitis vir us [IBV]) sugg esting host cy clop hilins as targets sisof6wi llbedescrib ed els ewher e.Alis po rivi randN IM8 11were for pan-co ronav irus inh ibition (Pfe fferle et al., 2011) . In hibition gen er ou slyp ro videdbyN ovartis(Sw itzerland).C sA,C sDandF K506 of SARS-CoV, HCoV -229E and in additi on of Mouse Hepatitis wereobtain edfromS igm a-Aldric h,SantaCruz( Germ any )an dEnzo vir us(MHV)w assubseque ntly als oconfirm ed bydeW ildeetal. LifeS ciences(G erm any),respective ly. 46 J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 Table1 shRNAsequencesusedforlentiviral-basedgeneknockdown(A)andsequencesofprimersusedforquantificationofgeneknockdown(B). Particleset Target shRNAsequence(5(cid:3)≥3(cid:3)) (A) Non-targetcontrolTRC1.5Vector(pLKO.1-puro) CCGGCAACAAGATGAAGAGCACCAACTCGAGTTGGTGCTCTTCATCTTGTTGTTTTTG PPIA:SHVRS-NM021130 TRCN000049232 CCGGGTTCCTGCTTTCACAGAATTACTCGAGTAATTCTGTGAAAGCAGGAACTTTTTG PPIB:SHVRS-NM000942 TRCN000049251 CCGGGTTCTTCATCACGACAGTCAACTCGAGTTGACTGTCGTGATGAAGAACTTTTTG (B) qRT-PCRprimer Sequence(5(cid:3)≥3(cid:3)) hPPIAF CAGACAAGGTCCCAAAGACAG hPPIAR TTGCCATCCAACCACTCAGTC hPPIBF CTCTCCGAACGCAACATGAAG hPPIBR ACCTTGACGGTGACTTTGGG 2.2. NFATreportergeneassay pH7.5,150mMNaCl,10mMDTTandProteaseInhibitorCocktail (Ho ffma nnL aRo che)in 25 0(cid:2)l lysis buff er.Protei nswerese parated Thetestswereperformedasdescribed(Prelletal.,2013).Briefly, by 8% or 12.5% SDS-PAGE and electroblotted onto nitrocellulose Jurkat cells were transfected with NFAT reporter gene plasmid membranes. Latter were blocked with 5% milk powder in TBST and in cubat ed wi th 0.5(cid:2)M in hibito r or 0 .5% DMSO (con trol) for (150mM Na Cl, 20m M Tr is–HCl [p H 7.6 ], 0 .1% T ween 20 ) b uffer. 30m in. Ca2+ m obiliz atio n w as initiat ed by ph orbol 12-myrist ate Incub atio nwith pr imar yantibod iesw asu sually carried out at4◦C 13 -acet ate/ionomycinort umor necrosis fac tor-(cid:3)an dculturedfor overnight. Secon daryant ibodyincub atio nwasp erforme da tro om additional5hbeforeharvestinganddeterminingluciferaseactivity temperaturefor2h.Aftereachincubationstepmembraneswere incelllysates.NFATactivitiesareexpressedasmeanSDoftripli- washedthreetimeswithTBSTfor10min.HRPwasdevelopedwith catesinthreeindependentexperiments. Immobilon Western blot HRP chemiluminiscent substrate from Milipore.MembraneswereexposedtoX-rayfilm(Agfa). 2.3. NFAT-GFPnucleartranslocationassay 2.6. Cyclophilinknockdowncelllines. HeLacellswereculturedinDulbecco’sModifiedEagleMedium (DMEM) containing 10% FCS and 1% penicillin/streptomycin. CaCo-2 cells were cultured in Dulbecco’s Modified NFAT3-G FPplasmidw astr ansfe cted into HeLacellsbyusingLipo- Eagle Med ium ( DMEM) containin g 1 0% FCS and 1% peni- fectamine L TX and Plus Reagent (L ife Techn ologi es) when the cillin/ streptomy cin. Cycl ophilin kno ckdow n c ell l ines were cellswere 70% confl uent .Subsequ ently, drugsweread dedto the generated using s hRNA expre ssion vector s (S irion GmbH, medi um a t a fi nal concen tration of 40n M. 19 h late r, iono my cin Martinsrie d, Ger many) a s recently describe d for F KBP1A/B wasadde d at afin alconcentratio no f2 (cid:2)M to in duce NFAT3-GFP (Carbajo-Loz oyaetal.,20 12) .Briefly,ce llsweretra nsdu cedatMOI tran slocatio n. P icture sweretakenu sin g aflu ore scence microscope 30withMISSION TM le ntivira lnon-ta rget contr olgene,PPI Af rom (LeicaDM400 0B)10m inaft erion omyc in induction. at arget setSHVRS-N M02113 0(TRCN000 049232 )and PPIB from a target set SHVRSNM000942 (TRCN0000049251). Sequences 2.4. RNAisolationandreal-timereversetranscription-PCR used for gene knockdown are listed in Table 1. Stably shRNA- (RT- PCR) expre ssin gcell sweregener ated throug h3 week so fbulk-s election in 10–15(cid:2) g/m l pur omycin-co ntaining mediu m (DMEM+10% CaCo-2cellswereinfectedwithHCoV-NL63atMOI0.004for1h. FC S+2mM l-glu tamine+1mMNa-pyruv ate). AfterremovalofvirusinoculumandtwoPBSwashes,freshmedium supplementedwithincreasinginhibitorconcentrationswasadded. 3. Results After48hRNA wase xtractedfr om10(cid:2)l culturesupern atan tusing theH igh P ure Vira lNucleicA cidK it (Ro che)an delutedin 13(cid:2)l. 3.1. Characterizationofnon-immunosuppressiveCsA-and Qua ntific ation wasd onebyr eal-ti me PCRSen siFAS TProb eH i-R OX FK5 06-derivatives One-Stepkit(BiolineGmbH,Germany)allowingreversetranscrip- tion,cDNAsynthesisandPCRamplificationinasinglestep.Samples First CsA analogues were isolated in 1977 from Trichoderma were analy zed by A BI P rism 7000 Cycler I S e quenc ing D etection polyspor um( Trabereta l.,197 7).CsD wa sdesc ribed in1993asa Syste m. A stan dar d cu rve wa s pro duced u sing serial d ilutions of weakimmu nosuppr es sant inlym phoc ytep roliferatio na ssays wit h viralRN Ao fHCoV-N L63vi russ tockwith known virus titer. about 10%oftheCsAactivi ty (Sadegetal., 1993a,b).InC sDav aline PC R p rim ers (Herzo g et al., 20 08) used w ere N L-63RF2for isloca ted at pos ition 2instea dofl- (cid:3)- am inobutyric a cid.T h etwo 5(cid:3)-CTTC TGGTGA CGCTAGT ACA GC TTAT-3 (cid:3) (ge nome position nt pr ominen tC sAderiva ti vesNIM 81 1(containsameth yl-is oleu cine 14459–14484)andNL-63RR2rev5(cid:3)-AGACGTCGTTGT AGATCCC TAA atposition 4in steadofthe methyl– leucine)a n dAlisporivir(con- CAT-3(cid:3) (genom e p osition nt 1 4573–14597) and NL-63 probe ta ins a met h yl–alani ne at p osition 3 instead of sarcosine a nd an was 5(cid:3)-FAMC AGGTTGC TTA GTGTCCCATCAG ATTC AT-TAM RA-3(cid:3) N-eth y l valine at posit ion 4, inste ad of N-m eth yl leucine ) w ere (gen omepositionnt14532–14560). intensiv elytest ed inclinica ltr ialsasan ti- HIV-1anda nti-HCV drugs (Fischer et al., 2010; Gallay and Lin, 2013; Lin and Gallay, 2013; 2.5. Westernblotting Membrenoetal.,2013;VermehrenandSarrazin,2011). A further set of CsA analogues was developed, fine-tuned by TodetermineN-proteinexpressioninthepresenceofinhibitors derivatizationatMeBmtresidue1ofCsAandaFK506derivative Caco-2cellswereinfectedatvirusMOI0.004foronehourinsix- withdifferentpropertiesregardingtheinhibitionofdrug-Cyp/FKBP well plates. Virus was washed off with PBS and inhibitors were complexes, CaN phosphatase-, NFAT activities (Fig. 1, Table 2). addedtothemediumattherespectiveconcentrations.After48h Synthesisofdrugderivativescompounds1and2werepreviously cellswereharvestedandlysedwith1%NP-40in50mMTris–HCl, described (Prell et al., 2013). The CsA derivatives 3, 4, 5 were J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 47 Fig.1. ChemicalstructuresofnovelCsAderivatives(compounds1–5)andtheFK506derivative(compound6)usedinthiswork.ThepositionwheretheRsubstituentsare attachedtotheCsAringcoreatposition1ismarkedwithanasterisk.ParentFK506issubstitutedatpositionC-21(dottedcircle). synthesized as recently published (Malesevic et al., 2013). The wasstillfoundinthelownanomolarrange.CnAactivitycouldnot chemicalsynthesisofthenon-immunosuppressiveFK506analogue beinhibitedatallbybinaryPPIase/drugcomplexesof1,2,6.Incon- 6startingfromtheparentdrugFK506willbepublishedelsewhere. trast,CnAactivitywasweaklyinhibitedatveryhighconcentrations These PPIase inhibitors were biochemically characterized by ofthedrug/CypAcomplexesasindicatedbyIC valuesintherange 50 determin ing the ir inhibitor y pote ncy in a stand ard PPIase ass ay. of 10(cid:2) Mforcom pounds3 (IC 6.9(cid:2)M ), 4(IC ∼10 (cid:2) M) and5 50 50 Inhibitionof theCa Nphospha tase,thei nfl ue nceonce ll-based NFAT (IC > 10 (cid:2)M )). In additio n , these de rivat ive s also dem ons trate d 50 reporterge n eac tivity andNFATtra nslo cationby th edrugs(Ta ble2) low ab ilit y (IC 1 0(cid:2)M, 1.3 (cid:2)M a nd 1.2(cid:2)M, respe ctively), com- 50 havebeenperformedusingpublishedprocedures(Pfefferleetal., paredwithCsA(IC 1.6nM),toreducetheNFAT-drivenreporter 50 2011;Prelletal.,2013).WhiletheIC valuesforPPIaseinhibition geneexpressioninaluciferase-coupledNFATreportergeneassay 50 weres imila rt oth atofC sA,com po und2(57.5 ±6 .9nM) showeda indic ating a gre atl y diminished immu nosup pressive activ ity in higherIC valueindicatinglowerbindingaffinity,butinhibition a cellular assay. Although, peptides 4 and 5 showed higher CnA 50 48 J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 Table2 BiochemicalcharacterizationofPPIaseinhibitorcompounds. Name InvitroInhibition InvitroInhibition Invitroinhibition NFAT-GFP Inhibitionof [hnu Mm]an CypA IC50 Cn A IC5 0[(cid:2)M] NasF sAaTy rICe 5p0o[r(cid:2)teMr g]ene HTrEaKn-s l2o9c3a tcioelnls in CHaCCooV--2N ELC6 530 i[n(cid:2)M] CsA 9.1±0.8 0.05 1.6±0.0003 no 0.9–2.0 CsD nd nd nd no 2.5 ALV nd nd nd yes 0.8 NIM811 nd nd nd yes 0.8 1 9.1 ±1.4 no no yes 1.6 2 57. 5± 6. 9 no no yes 7.9 3 11.9 ± 0.9 6.9 45% at10(cid:2)M yes 1.1 4 14.1 ± 1.9 ∼10 1.3 yes 8.1 5 16.6 ± 2.3 >10 1.2 yes 2.3 FK506 nd nd nd no 6.6 6 10. 2±1.9* no no yes 4.2 PropertiesofCsA(compounds1–5)andFK506(compound6)analogueswithrespecttoinhibitionofPPIAinaprotease-coupledPPIaseassay,FKBP12inhibition(*),CaN, NFAT, and NFAT-GFP nuclear translocation. Methods are described in Prell et al. (2013). The last column represents the EC50inhibitory values of the peptides on HCoV-NL63 infectionofCaco-2cells. inhibitioninvitroNFATinhibitionwasremarkableindicatingagain and 6. The combination of the two peptides in each individual ofCaNeffe ct sinv ivo.Th e45%NFA Tin hibitoryact ivityat10 (cid:2) Mof grap hw asc hosenarbitra rily .On lyFK 506andit sd eriva tive6were 3stillrepresentsa5000-foldlowerinfluenceoftheCsAderivative groupedtogetherastheybelongtothesamecompoundfamily. onNFAT-regulatedsignalingpathwaysascomparedtoCsA. Fromtheinhibitioncurvesitcanbeconcludedthatallpeptides ThedrugderivativeswerefurthercharacterizedbyaNFAT-GFP tested,i.e.CsA,CsDandFK506aswellasALV,NIM811andthenew nucleartranslocationassay.HeLa93cellsweretransfectedwitha derivatives,clearlyinhibitthereplicationofHCoV-NL63inCaco-2 plasmidencodingaNFAT-GFPfusionconstructunderthecontrol cellsatlowmicromolarconcentrationlevels.TheEC inhibitory 50 oftheCM Vpromo te r(Fig.2).Up onCa2 +mobiliza tionby ion omycin score s( Tabl e2)residein arangebetwe en0.8(cid:2) Ma nd8.1(cid:2)Mwith thecellularphosphataseCaNdehosphorylatestheNFATtranscrip- ALV/NIM811and4showingthelowestandhighestconcentrations, tionfactorwhichissubsequentlytranslocatedtothenucleus.Asthe respectively. 1 and 3 acted similarly. Also, the FK506 derivative cellsarenotsynchronizedNFAT-GFPtranslocationisnotexpected behavedverysimilartoitsancestormolecule.Therewasnoclear tooccursimultaneouslyexplainingminortransferefficienciesin correlationoftheinhibitoryeffecttoinvitroinhibitionofCypA,CnA somecells.TheCyp-bindingimmunosuppressantsCsA,CsDandthe orNFATactivity. FKBP-bindingFK506inducethebindingasproteincomplexesto CaNthusinactivatingitsphosphataseactivity.AsaresultNFATis 3.3. EffectsofinhibitorydrugsonHCoV-NL63Nprotein nottransferredtothenucleus.Complexesofthemodifieddrugs1–6 expression withbothtypesofPPIases,i.e.Cyp/modifiedCsAorFKBP/modified FK506 derivative complexes, have a greatly reduced potency to TostudytheeffectofCsA,ALV,NIM-811andsubstance3onviral inhibitCaNandthusmightallowthetranslocationofNFATtothe proteinexpressioncellswereincubatedwithconcentrationsof0to nucleu sand the tran scriptio nalre gula tionofimmu ne genes .C on- 20(cid:2)Mo ftherespec tive inhib itorsfor48 h.W esternblotanal ys is of sequently,ALV,NIM811andthewholeseriesofnewlysynthesized HCoV-NL63-infectedCaCo-2cellswasperformedutilizingananti- drugderivatives1–6clearlyallowNFAT-GFPtranslocationtothe N–proteinantibody.Fig.4clearlyshowsasignificantdecreaseof nucle us and can be t hus co nsider ed as non- immunosuppr es sive theN-prot einbetwe en1 .2 5(cid:2)Man d5(cid:2)M . Itisnotdet ectablea ny underth ese assa yco nditi ons(Table2 ).I nconclusion,inthreedif- mor eat20(cid:2)M ofther espe ctive inh ib itor. T hi ssu ggeststhat the ferentassaysallsyntheticdrugderivativesprovedtobeinertor drugsinhibitanimportantstepintheviralreplicativecycle. nearlyinertinthesuppressionofthecellularimmuneresponseat analmostunchangedbindingandinhibitorypotencyagainstthe 3.4. HCoV-NL63replicationdependsoncyclophilinA PPIaseactivityoftherespectivedrugreceptor. In order to examine whether cellular CypA or CypB, encoded 3.2. Non-immunosuppressiveCsA-andFK506-derivativesinhibit bythePPIAandPPIBgenes,respectively,arerequiredforHCoV- replicationofHCoV-NL63 NL63 replication, cyclophilin Caco-2 knockdown cell lines were establishedusinglentiviralshRNAexpressionvectorsasrecently To examine the inhibitory effects of the described non- describedforFKBP1A/B(Carbajo-Lozoyaetal.,2012).Ratherhigh immu nosuppres sive CsAandFK 506deri vati veso ntherepli cation puromycin co ncentratio ns(10–15(cid:2)g/ml )w ere neede dfors elec- of HCoV-NL63, Caco-2 cells were infected with HCoV-NL63 as tion as Caco-2 cells are very efficiently depleted from inhibitory described(Carbajo-Lozoyaetal.,2012).Fig.3showstheeffectsof drugmoleculesbecauseofenhancedexpressionofmultidrugresis- CsAandsevennon-immunosuppressivederivatives(ALV,NIM811, tantprotein1gene(Takaraetal.,2002). 1, 2, 3, 4, 5) and of FK506 and its descendant 6 on HCoV-NL63 To characterize Cyp A and CypB knockdown quality, mRNA replication in Caco-2 cells. Left panels represent the percentage expressionwasquantifiedinitiallyfrombulk-selectedknockdown reductionofvirusreplication(leftY-axes)andcellviabilities(right and control cells by real-time RT-PCR. For reverse transcription, Y-axes).Th e right panelsindi cate theresp ectiv elo g10titerr educ- 1(cid:2)g oftotal RNA wa sused.Am plificatio np roducts weredetected tion.Thefigureshowstwoindependentsetsofexperiments(Fig.3A by SYBR I, and amplicon integrity was verified by melting point and B) carried out at different times using different batches of analysis.Humantopoisomerase1gene(hTOP1)servedasarefer- CsA.WhenperformingindividualvirusinhibitionexperimentsCsA encegenefornon-targetcontrol,PPIAandPPIBtodeterminethe wasalwaysincludedasaninternalcontrol.Minorvariationsare specificityoftheknockdown.mRNAexpressionlevelsofPPIAand explainedbytheuseofdifferentcompoundbatches.Fig.3Asum- PPIBwerethendeterminedbyreal-timeRT-PCRwithprimerslisted marizesresultsobtainedwithpeptidesCsA,3,ALVandNIM811. in>Table1.InthecaseofPPIAtheknockdowninthepuromycin Fig.3BdelineatesresultswithpeptidesCsD,1,2,4,5,andofFK506 bulk-selected Caco-2 cells was incomplete >as determined by J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 49 Westernblot(about79%)andqPCRanalysis.HereHCoV-NL63virus growthwasdetectablebyqPCR(notshown).Thiswasnotasurpris- ingresultasCypAcomprises0.1–0.4%oftotalcytosolicproteinof mosteukaryotictissues(Hardingetal.,1986).Wethereforerea- sonedthatthesecellswerenotappropriatefortestingtheeffectof CypAonvirusreplicationandthatitwasnecessarytosearchfor betterqualityknockdownclones.Individualcellcloneswerethen selectedfromtheCaco-2-PPIAbulkKDcellsbylimiteddilutionin thepresenceofpuromycin,andcheckedforknockdownquality. Individualcloneswereexpandedandtestedforexpressionby WesternblotandqPCR(Fig.5).Fig.5AshowsWesternblotanal- yses of the PPIA KD clone (polyclonal rabbit anti-CypA) used for further infection experiments. The CypB KD was demonstrated (Fig.5A)usingapolyclonalrabbitanti-CypBantibody.Forcontrol thehousekeepinggeneLaminBwasprobedwithapolyclonalgoat anti-LaminBantibody.AsLaminBlevelsshowednodifferencesin Caco-2wt,Caco-2shcontrolandbothknockdowncells,CypAwas barely detectable while CypB was completely reduced. By qPCR comparisontonon-targetcontrolstheCypAandCypBknockdown celllinesweredeterminedtobe97%and98%,respectively(Fig.5B). To examine virus propagation on the knockdown cell lines >Caco-2wt,Caco-2shcontrol,Caco-2-PPIAKDandCaco-2-PPIBKD cellswereinfectedwithserialdilutionsofHCoV-NL63.Plaquetitra- tionclearlyshowedcomparablevirustiters(Fig.5C)inbothcontrol and in the Caco-2-PPIB-KD cell lines. The virus did not grow in theCaco-2-PPIAKDcellsatallindicatingthedependenceofvirus replication on CypA. Similar results were obtained by qPCR (not shown). 4. Discussion Commonandinmanycasesverysuccessfulantiviraltherapeutic approachesadheretotheuseofdrugsthatinhibitviralreplication bydirectlyactingonviralcomponentsimportantforthevirallife cyclelikereversetranscriptases,proteases,integrasesetc.Adraw- backofthesedrugsisthehighmutationalsusceptibilityoftheviral genomesdue to the poor proofreadingactivitiesof viral replica- tiveenzymes,especiallyofRNAviruses.Thesedifficultiesmightbe circumventedbynew,promisingtherapeuticdrugstargetinghost factorsinvolvedinviralentry,replication,assemblyandrelease,or ingeneralcellularfunctionssuchasproteintranslationandfolding. AwellcharacterizedexampleisinhibitionofhepatitisCvirusinfec- tionincellculturemodelsandhumansbyhost-targetingagents (Zeiseletal.,2013).Cyclophilinsareaclassofmostlyintracellular enzymesrequiredforthecorrectfoldingandfunctionofavarious cellularandalsoviralproteins(vonHahnetal.,2011).CypAhas beenshowntobindtoseveralHIV-1andHCVproteinsandbeing essentialforreplicationofseveralviruseswhichcanbeinhibited by CsA and non-immunosuppressive derivatives thereof (Baugh and Gallay, 2012; Daelemans et al., 2010; Fassati, 2012; Frausto etal.,2013;Gallay,2012;Membrenoetal.,2013).InHCVpatients safetyandefficacyhasbeenshownforthethreeCypinhibitorsALV, NIM811(bothfromNovartis)andSCY-635(SCYNEXIS)inphaseI andphaseIItrials.ALVisthefirst-in-classandthemostadvanced Fig.2. EffectofCsA,FK506andderivativesonNFAT-GFPnucleartranslocationasa cyclophilininhibitorwithclinicalproof-of-conceptincludingphase mea su re of im m unos uppres sive activity. NF AT 3-GFP expr ession p lasmid was tra ns - III randomi zed clinic al tr ials (Fli siak et al., 2013; Gallay an d Lin, fectedintoHeLacells.Subsequently,inhibitorcompounds(comp.)wereaddedto 2013;Membrenoetal.,2013). themediumatafinalconcentrationof40nM.19hlater,ionomycinwasaddedata fina lconcent ra tio nof 2(cid:2)Mtoinduce N FAT 3-G FP tr ansloc ation.Pictu resw ereta ke n By unbiased yeast-two-hybrid screening we have found that 10m inafterIonom yci n (Ion o. )induct ion.CsD(no tdepictedher e)showe dthe same Nsp1 proteins o f SARS-CoV (Pfeff erle et al., 201 1; Sc höpf e t al., beh avio rasC sA. 2010) andofot he rCoVs(unp ublished) bin dto cyclop hilinsi ncl ud- ing CypA and that CsA inhibits coronaviruses including human SARS-CoV, HCoV-NL63, HCoV-229E and animal CoVs FCoV (two serotypes), IBV, TGEV. We further showed inhibitory action of FK506 on the three human CoVs. The main goal of our study was to test and compare the inhibitory effect of the chemically 50 J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 difficult-to-synthesize cyclosporines ALV and NIM811 with a set of drug derivatives 1–5 which result from the chemically well-tractable side chain in position 1 of CsA. In addition, the FK506 derivative 6 should provide a first indication of feasibil- ityofexpandingtheconceptofantiviralnon-immunosuppressive CypA inhibitors into the field of FKBP inhibitors. Data on the inhibition of HCoV-NL63 replication were compared with the immunosuppressive immunophilin binders CsA, CsD and FK506. AllderivativesinhibitthePPIaseactivityoftheirrespectivebind- ing proteins thus preventing their catalytic function in assisting client proteins to fold correctly. When compared with already knownnon-immunosuppressivedrugs,thenewcompoundswere not only more easily accessible by chemical synthesis but also showed a favorable ratio of PPIase inhibition to cellular toxicity. AllcompoundsweretestedinanNFAT-GFPnucleartranslocation ass ay (Fig. 2). Upon mobil iza tio n of Ca2+ by iono mycin NFAT- GFP remained in the cytoplasm in the presence of CsA, CsD and FK506.ThisindicatesthattheCypA/CsA,CypA/CsDorFKBP/FK506 complexesinactivatetheCaNphosphatasethuspreventingNFAT dephosphorylationandnucleartranslocationwhichconstitutesthe basis for immunosuppression. For CsD it is clear that it exerts a rather strong immunosuppressive activity as opposed to earlier reportsascribingonlyabout10%oftheCsAactivitytothemolecule (Sadegetal.,1993a).InthepresenceofALV,NIM811andallthe newlysynthesizeddrugderivatives1to6NFATmigratedtothe nucleuswithinminutesconfirmingtheirnon-immunosuppressive activity.Thenewsetofdrugswasalsocharacterizedinvitrowith respecttoinhibitionofCypAinaprotease-coupledPPIaseassay, CnAandNFATassayandcellpermeability.ThepotencyofPPIAse inhibitionwascomparabletoCsA.Onlyinthecaseofcompound2 itwasincreasedbyaboutsixfold.TheIC valuesofCnAinhibition 50 w asac hievedfor Cs Aat0.0 5(cid:2)Mw her easforthree o fthe newcom- pounds138-foldto200-foldhigherconcentrationswereneeded. Virusinhibitionexperiments(Fig.3,Table2)clearlyshowthe highlyef fectiveinhi bitionofHCo V-NL 63 byALV (E C :0.8 (cid:2)M) and 50 NIM81 1(EC :0 .8(cid:2)M)wh ic hcloselyres em bles thepa tter nsof CsA 50 (EC :0. 9–2.0(cid:2) M )and CsD(E C :2. 5(cid:2)M).The EC values of the 50 50 50 CsAde rivative sran geb etwe en1.1 (cid:2)M and 8.1(cid:2) M.EC val ue sof 50 FK5 06anditsd erivati ve6wer e6. 6(cid:2)M an d4. 2(cid:2)M ,respective ly. Takentogether,allthederivativesinhibitedvirusreplicationinthe lowmicromolarrangesimilartoourpreviousreportontheinhi- bitionofvarioushumanandanimalCoVswithCsA(Pfefferleetal., 2011).Interestingly,inhibitionofHCVwithCsA,ALVandNIM811is commonlyobservedatnanomolarconcentrationswithALVasthe mosteffectivecompound.Wehavenoexplanationforthisbutitcan bespeculatedthatinthecaseofHCVtheinteractionofviralproteins andcyclophilinAismoresensitivetotheinhibitors.Themicromo- larrangesofCoVinhibitionwasnicelyconfirmedbyanothergroup (deWildeetal.,2011). TheHCoV-NL63-Nproteinplaysacrucialroleinthevirallife cycle.Itwasanalyzedasarepresentativeofviralproteinexpression inthepresenceofincreasingconcentrationsofCsA,ALV,NIM-811 an dsu bstance3 .T heprotein decreasedat1. 25 (cid:2)M andi twasnot dete ctableany m orea tconce ntrationsa bo ve5(cid:2) M. Thus ,t here isa clearinhibitoryeffectofthedifferentpeptidesonNproteinexpres- sionandvirusreplication.Whetherinhibitionisaresultoflacking cyclophilininteractionwithNsp1oranotherviralproteincannot bedecidedatthecurrentstage.AstheNproteinofSARS-CoVwas Fig.3. EffectofCsAandFK506derivativesonHCoV-NL63replicationinCaco-2 cells.(A)and>(B)showindependentsetsofexperimentsusingcompoundsCsA,3, column).RightY-axesindicatethepercentageofthecellviabilities.X-axesindi- ALV,NIM811andCsD,CsA,1,2,4,5,andFK506,6,respectively.CsArepresentsan cateincreasinginhibitorconcentrationsatwhichvirusreplicationwasdetermined. internalcontrolincludedineachset. Closed/opensquaresandclosed/opencirclesrepresentthereductionofgenome GenomeequivalentsweredeterminedbyqPCRandcellviabilitiesbyCellTiter equivalentsandcellviabilityattheindicatedinhibitorconcentrations(X-axes), Glowkit(Promega).Datashownaremeanvaluesofarepresentativeexperiment respectively.ThegraphswereplottedusingPrism5(GraphPadSoftware,Inc.)and performedinatleasttriplicates.LeftY-axesrepresentthepercentageofreduc- byanon-linearregressionwithavariableslopealgorithm,thecurvewasfittedfor tion of virus replication in linear scale (left panel column) and in log scale (right panel each respective inhibitor and the EC50calculated. J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 51 Fig.4. WesternblotanalysisofNproteinexpressioninHCoV-NL63-infectedCaCo-2cellsupontreatmentwithincreasingconcentrationsofCsA,ALV,NIM811andcompound 3.N-ProteinwasdetectedwithamousemabagainstN-protein.Arabbitanti-LaminAantibodywasusedtodetectLaminAasaloadingcontrol. reportedtobindtoCypA(Luoetal.,2004)andCypAisincorporated genomeorganizationandgenomelengthof27to32kband13to intoSARS-CoVparticles(Neumanetal.,2008)theinhibitorsmight 16kb, respectively, and they share a number of enzymatic func- alsoactdirectlyonCypA/N-proteincomplexes,ifthesealsoexistin tions.SincebothfamiliesaresensitivetoCsAtheinvolvementof HCoV-NL63.Itcanalsonotberuledoutthatfurtherviralproteins cyclophilinsinnidovirusreplicationasageneralprincipleisrea- requireCypAfunctions. sonable. An important question was whether CypA is the crucial From our HCoV-NL63 infectivity studies in Caco-2-PPIA/PPIB cyclophilinrequiredforCoVreplication.ForHCVthereweresome KD cells we conclude that the most abundant CypA of the viral discrepanciesonthenecessityofCypAandCypBforvirusgrowth. hostisaprerequisiteofCoVreplication.TheinteractionofSARS- RecentstudiesdemonstratethatCypAisthekeyhostfactorforHCV CoVNsp1inY2Handinmammalianprotein-bindingassayswith replication(BaughandGallay,2012;Kauletal.,2009).Inorderto several cyclophilin isoforms suggests the potential involvement addresstheroleofthetwomembersoftheCypfamilyforHCoV- of additional cyclophilins in the infection process. It has to be NL63replication,wedevelopedCaCo-2celllineswithindividual examined systematically whether CypA and further cyclophilins knockdownsforCypAandCypBonalentiviralbasis(Fig.5).The bind to other viral proteins. Furthermore, knowledge about the characterizationatprotein(Fig.5A)andRNA(Fig.5B)levelsindi- regulatory role of the catalytic activity of the PPIase subfamilies catedefficientKDofthetwoCyps.Inplaquetitrationexperiments of cyclophilins and FK506-binding proteins, both of which were perfor medonC aC o-2 wt, CaC o-2sh (n on-targ et)andC aCo-2(cid:2)CypB sh ownhereto bec riticalinthevir alreplicat ionp roc essreq uires the virus grew at comparable titers (Fig. 5C). In contrast, CaCo- identificationoftheirproteinsubstratesinthecoronaviralback- 2(cid:2) CypA cells d id not support virus grow th a t a ll indicati ng the ground. dependenceonfunctionalCypA. The four non-SARS-related HCoVs (HCoV-OC43/229E/NL63 Regarding Cyp requirement for CoV replication contradictory and/HKU1) are major causes of relatively mild respiratory tract results were reported by de Wilde et al. (2011). While our CoV infectionsinimmunocompetenthosts.However,clinicalmanifes- data on CsA inhibition (Schöpf et al., 2010) were basically con- tationslikebronchiolitisandpneumoniacanbesevereespecially firmed,thereportclaimsthatneitherCypAnorCypBarerequired inyoungchildren,theelderlyandimmunocompromisedpatients forreplicationofSARS-CoVandMouseHepatitisVirus(MHV)on (vanderHoek,2007).Infectionoccursinearlychildhoodandthe thebasisofsiRNAPPIAandPPIBknockdownexperiments.How- detection of anti-S IgG antibodies in >70% of the general human ever, both siRNA knockdowns were rather incomplete in terms populationdemonstratestheirhighprevalence(Zhouetal.,2013). oftheresidualCypAorCypBproteinlevelleavingenoughPPIase Furthermore, the zoonotic transmission potential of HCoV-NL63 activityintheinfectedcellstosupportviralreplication.Atleastfor (Huynh et al., 2012) and of the highly aggressive SARS-CoV and HCoV-NL63weclearlydemonstratethatinlentivirallyproduced MERS-CoV (Gallagher and Perlman, 2013) demand the develop- knockdowncellsCypAbutnotCypBistherequiredmolecule.Inter- mentofeffectivedrugspreventingoralleviatingvirusgrowthand estingly, showing a similarly poor knockdown of PPIA the same pathogenicity. authors claim in a follow-up study on arteriviruses that PPIA is The marked inhibition of HCoV-NL63 replication by the non- therequiredcyclophilinfornidovirusreplication(deWildeetal., immunosuppressivederivativesofCsAandofFK506highlightsthe 2013).CoronaviridaeandArteriviridaearebothfamilieswithinthe functionalrelevanceofhostcellcyclophilinsandFKBPsasantiviral orderofNidovirales.Theyarebothpositive-strandedwithsimilar targets. 52 J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 Acknowledgment This work was supported by the “Bundesministerium fuer Bildung und Forschung” of the German Government (Zoonosis Network,ConsortiumonecologyandpathogenesisofSARS,project code 01KI1005A,F; http://www.gesundheitsforschungbmbf. de/de/1721.php#SARS)toAvB.WethankJuliaSchöpffortechnical help.WearegratefultoNovartis(Switzerland)fortheprovision of Alisporivir and NIM811. Special thanks to Drs. C. Thirion and M.SalomonforhelpwiththeCaco-2KDcelllinesusinglentiviral technology. References Abdul-Rasool,S.,Fielding,B.C.,2010.UnderstandinghumancoroonavirusHCoV- NL63.Ope nV irol.J.4,7 6–84 . Baugh,J., Gallay ,P.,20 1 2. CyclophilininvolvementinthereplicationofhepatitisC viru s andoth er viruse s.Biol.Chem .393(7),579 –5 87. Bienkows ka-H aba, M.,Patel ,H.D .,Sapp ,M., 200 9.Targetcellcyclophilinsfacilitate humanpapillom av irusty pe16 infec tion .PLoS Pathog .5( 7),e1000524 . Blackburn, E.A., Walkinsha w, M .D ., 2011. T arget ing FKB P iso forms with small- molecu lelig ands.Curr.Op in.Pha rmaco l.11(4),36 5–371 . Bose, S., Mat hur, M., Bate s, P., Joshi, N., B ane rjee , A.K., 2003. Requirement for cy clo philin A for the re pli cation of vesicular stom atitis v irus New Jer sey serotype.J. Ge n.V irol. 84(Pt7),16 87– 1699. Carbajo-Lozo ya ,J.,M üller, M.A .,K all ies,S.,Thiel,V.,Drosten,C.,vonBrunn,A.,2012. Replicationo f human coron aviruse sS ARS-C oV ,HCoV-N L6 3an dHCoV -22 9Eis inhibitedby th edrug FK506.VirusRe s.165,112 –117. Chaudhuri,R. ,Ta ng, S.,Zh ao,G.,L u,H., Case ,D.A .,Johnson,M.E.,2011.Comparison ofSARS an dNL6 3p apain- lik epr ote asebi nding sitesand bind ingsit edynamics: in hibito rde signim plications. J.Mol.Bi ol.414( 2),27 2–2 88. Chuck,C.-P., Chen,C .,Ke,Z.,Chi- Ch eong Wa n,D .,Ch ow,H.-F.,Wong,K.-B.,2013. Des ign,s ynthes isa nd cry stallographic analy sis ofnitri le-bas edbroa d-spe ctrum peptido mimetici nhib itorsforcoronav irus3C-l ike proteases.Eu r.J.Med.Chem. 59(0),1–6. Chuck, C.-P .,Chow,H.-F.,Wan,D.C.-C.,Wong,K.-B.,2011.Profilingofsubstratespeci- fici tieso f3C-lik epro tease sfromg roup1 ,2a,2 b,and 3corona vi ruses.PLo SOne 6(11), e2 7228. Daele mans ,D.,Dumont,J.-M.,Rosenwirth,B.,DeClercq,E.,Pannecouque,C.,2010. Debio-0 25 inhibitsH IV-1 byinterferin gw ith anear lye ventinthere plic ation cycle.Antiv iralRes .85(2) ,41 8–421. Davis,T.L .,Walker, J.R., Ca mpa gna-Slater,V.,Finerty,P.J.,Paramanathan,R.,Bern- ste in, G., MacK enz ie, F., Tempel, W ., O uyang, H., Lee, W.H., Eise nm esser, E.Z., D he- Paganon, S., 20 10. Struc tura l and bio che mical chara cterization of the humancycloph ilin famil yofpeptid yl–pr olylisomeras es.PLoSBiol.8( 7), e10 00439. deGroot,R.J.,Baker,S.C.,Baric,R.S.,Brown,C.S.,Drosten,C.,Enjuanes,L.,Fouchier, R.A.,G alia no,M. ,Gor baleny a,A .E.,Mem ish, Z.,Perlm an ,S.,Poon, L.L .,Snijder, E.J.,S tephens ,G.M .,Woo,P.C. ,Zak i,A.M.,Za mb on,M.,Z ieb uhr,J. ,201 3.Mid- dle Eastrespir atory syndr ome coron avirus (MERS-C oV) ;announ ce mento fthe Cor onav irusStudyG roup.J.Vir ol.87(14),7 790–7792. deHaan,C.A.,R ottier, P.J.,20 0 6.Hos tin gthe severeacuterespiratorysyndrome coron aviru s:speci ficc ellfact orsrequ ired forinf ection .Cell.Micro biol.8(8), 1211–1218. deWilde,A.H.,Li,Y.,vanderMeer,Y.,Vuagniaux,G.,Lysek,R.,Fang,Y.,Snijder,E.J., vanH emer t,M .J .,20 13. Cyclop hil ininhibitor sb lockar ter ivirus re plication by inte rferingw ithv iralRN Asynthesis. J.Virol.87 (3),1 454–1464. deWilde,A.H., Zeve nhov en-D obbe,J.C., va nder M eer, Y.,Thiel,V.,Narayanan,K., Makin o,S., Snijder,E.J.,vanHem ert, M.J., 201 1.Cycl osp orinA inh ibitstherep li- cationof di verseco rona viru ses.J.Ge n.Vi rol.92 (Pt11),254 2– 2548. Dijkman,R ., Jebbink ,M.F.,Gaunt,E ., Rosse n,J.W .,T em plet on,K.E.,Kuijpers,T.W., vand er Hoek,L., 2012 .Thedo mi nanceo fhum ancoronav irusO C43and NL63 infe ction sinin fan ts.J.C lin.V irol.53(2), 13 5–139( theofficialp ublica tion ofthe PanAmeri ca nSociet y forC linical Vir olo gy). Drosten ,C.,Gunth er,S.,P reis er,W.,v ander,W.S.,Brodt,H.R.,Becker,S.,Rabenau, H.,Pa nn ing,M.,K ole snikova, L.,F ouch ier, R.A.,B erger, A.,Bu rguiere, A.M .,Cinatl, J.,E ickmann ,M .,Escriou,N., Gr ywna,K., Kram me,S., M anuguerra, J.C.,M uller, S., Rickerts,V .,St urmer,M ., Vieth,S., Kle nk,H.D.,O st erhaus,A.D., Schm itz,H., Do err,H.W. ,20 03.Ident ifica tionof an ovelc orona virusinpat ients withsev ere acuter espira torys yndrome.N.E ng l. J.Med .348(20),19 67 –1976. Fassati,A .,2012.Mu ltipleroles of thec ap sidp rote inin theearlystepsofHIV-1 infe ctio n.Viru sRes.17 0(1–2 ), 15–2 4. Fig.5. CharacterizationofCypAandCypBinCaco-2knockdowncellsandgrowth Fernandes,F., Ansar i,I.U .,Str iker,R .,2010.Cyclosporineinhibitsadirectinteraction anal ys isofHCoV-NL63. Cy pAan dC ypBe xp ression wasdeterm ined byW estern betwee nc ycloph ilins andhep at itisCN S5A.PLoSOn e5(3), e9 815. blotusin ga nanti-CypA andan ti-C ypB(A )antibody andb yqPCR(B). Lam inBwas Fischer,G.,G allay,P.,Hop kins ,S.,2010 .C ycloph ilini nhib it orsf orthetreatmentof dete ctedw ith ananti-la min Bantibod ya saloadin gco ntr ol.hT OP1 wasu se din HCV in fection. Cu rr.Opin.I nve st.Dr ugs11(8),9 11–918. qPCRtos tand ard izecycloph ilin expressi on .G rowtho fHCoV- NL63o nCac o-2w t, Fischer, G., Wittm ann- Liebol d, B., Lang, K., Kie fhaber, T., Schmid, F.X., 1989. Caco- 2s hCtrnon-tar getcells,Ca co-2(cid:2)CypA (CypAK D )andCaco-2 (cid:2)C ypB(C ypB Cycl oph ilinandpeptidyl–pr olyl cis-tra nsis omerasear epr obablyid entic alpro- KD) kn ockdo wn mutant s was analyz ed by p laque t itrat ion a ssay. V irus tite rs are Flisitaeki,nRs.. ,NJaatruors ez e3w3 7ic z(6,2J.0,6P)a, r4fi7e6n–iu4k7 -8K.owerd a,A.,2013 .Em ergingt reatment sfor depicted in (C). hep ati tisC.ExpertO pi n.Emerg.Drugs18(4 ),4 61–47 5. J.Carbajo-Lozoyaetal./VirusResearch184(2014)44–53 53 Frausto,S.D.,Lee,E.,Tang,H.,2013.Cyclophilinsasmodulatorsofviralreplication. Sadeg, N., Pham Huy, C., Martin, C., Warnet, J.M., Claude, J.R., 1993b. Effect of Viru ses5 (7), 16 84–17 01. cyc losp orinA and its metabol ites andana logso nlipidp erox idation inrab bit Gallagher,T ., Per lman,S.,2013.Publichealth:broadreceptionforcoronavirus. renalmicros om es. Dru gChem.Tox icol. 16(2),1 65 –174. Nature 49 5(7440), 176 –177. Sastre,P. ,Dijkman,R., Camu nas,A .,Ruiz,T .,J ebb ink,M.F.,vanderHoek,L.,Vela, Gallay,P.A. ,201 2.Cyclo philininhibitors:anovelclassofpromisinghost-targeting C., Ru eda,P.,20 11 .Different iati onbe tw eenhum anco ron aviru sesN L63 and ant i-HC Vagen ts.Immuno l.Res.52(3 ), 200–2 10. 22 9Eusing a noveld ouble-antibody sandwich enzym e-linkedimmu nosor bent Gallay,P.A.,L in,K.,2 013.Profil eofa lis pori viranditspotentialinthetreatmentof assay based o nspe cificmonoclonal antibodies .Clin.VaccineI mmunol.18(1), hep atiti sC.D ru gDes. Dev.Th er .7,105–11 5. 113–1 18. Gaunt,E.R.,H ar die,A. ,Claa s,E.C .,Sim m onds,P.,Templeton,K.E.,2010.Epidemiology Schöpf,J.,Pfefferle,S.,Kögl,M.,Herzog,P.,Müller,M.A.,Kallies,S.,D.Muth,D.,Kuri, and clin icalpre sen tation sof thefourhu ma ncoronavir uses 229E ,HKU1,NL63, T.,E b el,T.,Frie de l,F., Zim mer,C., W eber,R. ,Haa s,F.,Th iel ,J. ,Herrl er, H.-J., and OC43d etectedover3 ye arsu sing anovel multiplexreal -time PCRm ethod. Sch wegm an nn-Wes sel s,G.,Thie l,C .,Droste n,V .,von Br unn,C .A. ,2010.A pply- J.Cli n.Mic robiol.48 (8), 2 940–2 947. ingsystemsbiologytose ver eacut ere spiratory co rona virusan dits huma nhost: Hardi ng,M .W.,Hand sch um acher,R.E.,Speicher,D.W.,1986.Isolationandamino iden tificatio noface llu lartar getan ditsinhibit orforantivi rali nte rventio n.In: acids equen ceofcyclophilin.J. Biol. Chem.26 1(18), 8547– 8555. FourthEurope an C ongress ofViro logy ,C ernobbio ,Lak eComo, Italy. Herzog, P.,Drosten ,C .,Muller,M.A . ,2008 .Plaqu eas sayfo rhumancoronavirusNL63 Smith,E.C., Denison, M.R.,2013 .C oronaviru sesasDNA Wan nabes: anewmodelfor usin gh umanco lon carcin omac ells.V irol.J.5 ,138. the regu lationof RNA virusr eplicationfide lity .PLo SPathog.9 (1 2),e 100376 0. Huynh,J., Li,S.,Yo unt,B .,Smith,A., Sturg es,L.,O l sen ,J.C.,Nagel,J.,Johnson,J.B.,Agni- Strebel, K.,Luban, J.,J eang ,K.T., 2009.Hum ancellul arres triction fa ctors thattarget hot hr am ,S .,Gates ,J.E .,Friem an ,M.B.,B ari c,R.S., Don aldson ,E .F.,2012. Evid ence HIV -1r eplicat ion .BMC Med .7,48 . supportin ga zoono tico riginofh uma ncoro navi russtrainNL 63. J.Viro l.86(23), Takara,K. ,Tsujimoto, M., Ohnis hi, N.,Yokoyama,T.,2002.Digoxinup-regulates 12816–128 2 5. MD R1 inhumanco lon carcinom aCa co-2cells.B ioc hem.B iophys.R es.Commun. Kambara,H.,Tani,H.,Mori,Y.,Abe,T.,Katoh,H.,Fukuhara,T.,Taguwa,S.,Moriishi,K., 292(1 ),1 90–194 . Matsu ura ,Y.,2 01 1.Inv olv eme nt ofcycl oph ilinBint he replicati on ofJapane se Tanaka, Y.,S ato,Y.,Osawa,S.,Inoue,M.,Tanaka,S.,Sasaki,T.,2012.Suppressionof encephalit isv irus.V irology412( 1), 211–219. felin ec orona vir usrepli cat ionin vitr obycycl osp orinA. Ve t.Res .43(1),41. Kaul,A.,Stauffe r,S.,B erger,C .,Pe rtel, T.,Schmitt,J.,Kallis,S.,ZayasLopez,M., teVelthui s,A.J.,vande nWorm,S. H., Sims ,A. C.,Baric,R.S .,S nijd er,E. J.,v anH emert, L ohm ann,V., Lub an,J.,B art enschla ger ,R.,2009 .E ssentia lr oleof cycloph ilin M.J.,201 0.Z n(2+ )inh ibitsco rona virus anda rteriv irus RNApol yme rase activity Aforhepa titi sCviru s replicationand vir uspro ductiona ndp oss iblelinkto invit roand zincio nophore sblockther eplic ationofthe sevi rusesincell culture. po lyp roteincle av ageki netics.PLoS Path og.5 (8),e100054 6. PL oSPa thog .6(1 1),e100117 6. Kono,M.,Tatsum i,K.,Im ai,A.M., Saito, K.,Kuri ya ma ,T.,Shirasawa,H.,2008.Inhi- Tong,T.R .,2009a .T herap iesforcoronaviruses.Part2:Inhibitorsofintracellularlife bi tion of huma n coron avirus 229E in fection in hu man epithe lia l lung cells cy cle.E xpertO pin.Ther .Pa t.19(4),415–4 31. (L132) by chloroq uine:involv emen tofp38M AP KandE RK.Antivi ralRe s.77 Tong,T.R. ,2009b .Ther apies for cor ona viruses.PartIofII—Viralentryinhibitors. (2),150 –1 52. Ex pert Opin.T her.Pat.19 (3) ,357–367. Lau,S.K .,Woo,P.C.,Li,K.S.,Huang,Y.,Tsoi,H.W.,Wong,B.H.,Wong,S.S.,Leung,S.Y., Traber,R.,K uhn, M.,Lo osli, H. R.,P ache,W.,vonWartburg,A.,1977.[Newcyclopep- C han ,K.H., Yuen ,K .Y.,2 005.Sev er eacu teresp iratory synd romec oron avirus- like tide sf romTr icho derma polys porum (Lin kex Pers.)Rifa i:c yclosp orins B,DandE virusi nCh ineseh orse shoe bats.PN AS10 2(39),140 40–14045. (auth or’st ransl)].Helv. Chim.Acta 60(5) ,15 68–1 578. Li,W.,Sh i,Z .,Yu,M. ,Ren,W.,S mith ,C.,Ep stei n,J.H .,Wang,H.,Crameri,G.,Hu,Z., vanBoheeme n,S.,de Graa f,M., Laube r, C.,B estebroer,T.M.,Raj,V.S.,Zaki,A.M., Zh ang, H. ,Zh ang ,J.,M cEa chern, J., Field,H., Das zak,P., Ea ton,B.T., Zha ng, S., Osterhaus,A .D .,H aagma ns, B.L.,Gor bal enya,A.E.,S nijder ,E.J .,Fou chier ,R.A., Wang, L.F., 2005.B at sarenatural re servoir so fSARS-li kec oronav iruse s.Scien ce 2012.Geno micc haracteriza tion ofanewlydi scove redcoro nav irusassoc iated 310(57 48) ,676– 679. witha cuteresp iratorydistresssy nd r omein humans.M Bio3(6). Lin,K.,G allay,P .,2013.Curingaviralinfectionbytargetingthehost:theexample vanderH oek,L .,2007.Hu mancor onaviruses :w hatdoth eyca us e?AntiviralTher. ofc ycloph ilin inhib itors.An t iviral Res.99(1 ),6 8–77. 12( 4PtB) ,65 1–65 8. Liu,X. ,Sun,L.,Yu, M.,Wang, Z.,Xu,C., Xue, Q., Zha ng,K.,Ye,X.,Kitamura,Y.,Liu,W., vander H oe k,L .,Pyrc,K.,Jebbink,M.F.,Vermeulen-Oost,W.,Berkhout,R.J.,Wolthers, 200 9.C ycl oph ilin Ainter ac tsw ith influ en zaAvir us M1 pro teinandim p airs the K.C. ,Wert he im-va n Dillen,P. M.,K aandorp,J.,Spaar gare n,J.,Berkh out ,B.,2004. early stageofthe vi ralreplica tion. Cell.Micr ob iol.1 1(5 ),730–7 41. Iden tificationofane whum anco ronavirus. N at.Med.10( 4) ,368–373. Luo,C.,Lu o,H., Zh eng ,S.,G ui,C.,Yue, L.,Yu ,C.,Sun,T. ,H e,P. ,Chen,J.,Shen,J.,Luo, Vermehren,J.,Sar raz in ,C.,2 011.Ne wHCVthera pies onth eho rizo n.Clin.Microbiol. X ., Li,Y. ,Li u,H.,B ai, D.,Y ang ,Y., Li, F., Zuo ,J.,H ilg enf eld ,R.,P ei, G.,Ch en ,K., Infect.1 7( 2),122–1 34 . She n, X., Jiang ,H .,200 4.N ucleo cap sid pr otein o fSARScoron av irus tigh tlybin ds Vincent,M .J., Berg eron,E.,Benjannet,S.,Erickson,B.R.,Rollin,P.E.,Ksiazek,T.G.,Sei- tohum an cyclo ph ilinA. Biochem.Biop hys.Re s.C omm un.321(3), 557–56 5. dah, N.G., Nichol,S.T .,2 005.Chloro qu ineisapo tent inhibit orof SARScor onav irus Malese vic,M., Gutknecht ,D .,Prell,E., Klein,C., Schu mann,M. ,Now ak ,R.A.,Simon, infec tion andspr ead. Virol. J.2,69. J.C.,Sch ien e-Fischer,C .,S aalbac h, A.,201 3. Anti-inflam mat oryeffe ctso fextra- Vogels,M.W. ,van Balkom ,B.W ., Ka loyanova,D.V.,Batenburg,J.J.,Heck,A.J.,Helms, cellu larcyclosporins are exclusive lym ediat edbyCD147.J.Med .Chem .5 6(18), J.B., Rottie r,P. J.,deHa an,C.A .,2011.Iden tific ationofhos tfa ctors invo lvedin 7302–7 311. coro navirus repl ica tionby quan titativ eproteomics ana lysis .Proteo mics11( 1), Membreno,F.E.,Espinales,J.C.,Lawitz,E.J.,2013.Cyclophilininhibitorsforhepatitis 64–80. Ctherap y.C lin.LiverD is.1 7(1),12 9–1 39. vonHahn,T.,Ciesek,S.,Manns,M.P.,2011.Arrestallaccessories—inhibitionofhep- Milew ska,A.,C iejka ,J.,Ka min ski ,K., Karewicz,A.,Bielska,D.,Zeglen,S.,Karolak,W., atitisC v irusby co mpound stha ttarg ethost fa ctors.DiscoveryMed.1 2 (64), Nowak ow ska,M .,P otempa,J .,B osch,B.J., Pyr c,K.,Szc zu bialka,K ., 2013.No vel 237– 24 4. polymericinhi bito rsofHCoV -N L63.A ntiv iralRe s. 97(2),112–1 21. Wang,R.Y.,Li,K.,2012.Hostfactorsinthereplicationofpositive-strandRNAviruses. Neuman,B.W. ,Joseph,J.S .,S aikatendu,K .S.,Serran o,P., Ch atte rjee,A.,Johnson,M.A., Ch angG un g Med.J .35( 2),111 –1 24. Liao,L .,Klau s,J.P.,Y ates III,J.R.,Wut hrich ,K.,Stev en s,R.C.,Buch me ier,M.J.,K uhn, Woo,P.C., Lau,S .K.,Ch u ,C .M., Chan,K.H.,Tsoi,H.W.,Huang,Y.,Wong,B.H.,Poon, P.,20 08 .Prote om icsan aly sisu nravelsth ef unctiona lrep ertoireofc oron avirus R .W., Cai, J.J., L uk, W .K., Poon, L.L., Wong , S.S., Guan, Y., Peiris, J.S., Yuen, no nstruc turalprotein 32.J.V irol.82(1 1), 5279–5294 . K.Y.,2 005 .Ch aracte rizatio nand com pletege nom esequ enc eofan ove lcoro- Perlman,S.,Netla nd,J.,20 0 9. Co ronav iru sesp ost-SARS:updateonreplicationand navir us, co ronavirus HKU1, from patients with pn eumonia. J. V irol. 7 9 (2), patho ge nesis.Na t.R ev.M icrobiol.7(6),4 39–450. 884–895 . Pfefferle,S.,Schöp f,J.,K ögl, M.,Friedel, C .,Mü ller,M.A.,Stellberger,T.,vonDall’Armi, Yang,H.,Xie,W.,Xue,X.,Yang,K.,Ma,J.,Liang,W.,Zhao,Q.,Zhou,Z.,Pei,D.,Ziebuhr, E.,He rz og,P.,K a llies, S.,N iemeye r, D.,Ditt, V.,K uri,T.,Züst ,R .,Sc hwarz,F., J., Hil genf eld ,R.,Y ue n,K.Y. ,W ong ,L .,Gao, G.,C hen, S.,C hen,Z .,M a, D., Bartlam, Zim mer,R. ,Ste ffen,I., We ber,F.,Thie l,V .,Her rler ,G.,T hie l,H.-J .,Sc hwegman n- M .,Rao,Z.,200 5. Design ofw ide-sp ect rum inh ibitors ta rgetin gco ron avi rusmain Weßels, C., Pöhlma nn ,S.,Haa s, J.,Dro ste n,C.,vo nB runn, A.,20 11.TheSARS- pro tease s. PLoSB iol.3( 10 ),e324. Coronav iru s-hostinter act ome: ide ntificatio no fcyc lophili nsa starg etfo rpan- Ylinen,L.M.,Sc halle r,T.,P r ice,A .,Fletcher,A.J.,Noursadeghi,M.,James,L.C.,Towers, Coronavirusinhib itors.PLoSPa thog.7(10),e1 00 2331. G.J. ,200 9.Cyclop hil inAle ve lsdictate infe ctionefficien cyo fhum anim muno- Prell,E.,Kahlert ,V.,Ruckn agel, K.P.,Ma le sevic ,M.,Fischer,G.,2013.Finetuning defi ciency virustype1 c apsid escapem utantsA 92EandG 94 D.J.Vir ol.83(4), th ei nhibition pr ofileofcyclo spor ineAbyde riva tization oft heMeB mtr esidue. 2044–2047 . Che mBioChem 14(1) ,6 3–65. Zaki,A.M.,vanBoheemen,S.,Bestebroer,T.M.,Osterhaus,A.D.,Fouchier,R.A.,2012. Pyrc,K.,Bosch,B.J., Ber kho ut,B.,Jebbink,M.F.,Dijkman,R.,Rottier,P.,vanderHoek, Is olatio nof anovelcor on avirusfrom aman withpneu mon iainSaud iArab ia.N. L .,2 006.In hibi tionofhum a ncorona virus NL63infe cti onatea rly sta ges ofthe Engl.J.M ed .3 67(1 9),1814–182 0. rep licatio ncycle.A nti microb. AgentsChem othe r.50(6),2 00 0–20 08. Zeisel,M .B .,Lup berg er,J., Fofana,I.,Baumert,T.F.,2013.Host-targetingagentsfor Qing,M.,Yang, F.,Zh ang,B.,Zou, G.,Robi da,J.M.,Yua n,Z .,T ang,H.,Shi,P.Y.,2009. pre venti onandtrea tm entofc hr onichepa titis C—per spectivesandc halleng es. C yclo sporin e inhibits fla vivir us replicat ion t hroug h b lockin g t he i ntera ction J.Hepatol.5 8(2 ),375–384 . betweenhost cyclophi linsandvi ralNS5prote in.Antim icrob.Age nts Chemother. Zhou, W.,Wan g,W .,W ang,H.,Lu,R.,Tan,W.,2013.Firstinfectionbyallfournon- 53(8),32 26–3 235. se vere acute res pirator ys ynd rom eh uma ncoro navi rusestak es pla ced uring Sadeg, N., Pham-Huy,C.,Rucay,P.,Righenzi,S.,Halle-Pannenko,O.,Claude,J.R., childho od.BM CInfect.Di s.13,433. Bis mu th,H.,Duc,H .T., 1993a. Inv itroandin vi vocomparativest udi esonim mu- Zhu,L.,George ,S.,Sc hmidt ,M.F .,Al -Gharabli,S.I.,Rademann,J.,Hilgenfeld,R.,2011. nosuppre ssi vepr opert iesofc yc lospo rine sA ,C,D andmetabo litesM1 ,M 17and P ep tideald eh ydeinhib itors challenget hes ubstratesp ec ificityofth e SARS- M21.Immunop harmacol. Im munotoxicol. 15 (2 -3 ),1 63–177. coronav irusmain protease.A ntiviralRe s.92 (2),204– 212.

See more

The list of books you might like