loading

Logout succeed

Logout succeed. See you again!

ebook img

2014 MERS coronavirus_ Data gaps for laboratory preparedness PDF

release year2014
file size1.64 MB
languageEnglish

Preview 2014 MERS coronavirus_ Data gaps for laboratory preparedness

JournalofClinicalVirology59 (2014) 4–11 ContentslistsavailableatScienceDirect Journal of Clinical Virology journal homepage: www.elsevier.com/locate/jcv Review MERS coronavirus: Data gaps for laboratory preparedness RitadeSousaa,b,ChantalReuskena,c,MarionKoopmansa,c,∗,1 aCentreforInfectiousDiseaseResearch,DiagnosticsandScreening,DivisionVirology,NationalInstituteforPublicHealthandtheEnvironment,Bilthoven, TheNetherlands bTh eEuropeanProgrammeforPublicHealthMicrobiologyTraining(EUPHEM),EuropeanCenterforDiseaseControl,Stockholm,Sweden cDep artmentof Viroscience ,Er asmus Medica lCentre,Rotte rdam,Th eNetherlan ds a r t i c l e i n f o a b s t r a c t Articlehistory: SincetheemergenceofMiddleEastRespiratorySyndromeCoronavirus(MERS-CoV)in2012,manyques- Receiv ed15October2013 tions rem ain on mo de s of tra nsmi ssion and s ources of v irus. In outb reak situati on s, esp ecially with RAeccceepivteedd i3n0 r Oevcitsoebde fr o2r0m1 329 October 2013 emer ging org ani sms cau sin g severe hum an d isease, it is impor tan t to unde rstand the full spectru m of disease,andsheddingkineticsinrelationtoinfectivityandtheabilitytotransmitthemicroorganism. Laboratoryresponsecapacityduringtheearlystagesofanoutbreakfocusesondevelopmentofviro- Keywords: logicaland immunol ogicalme thods forp atien tdiagn osi s,f orcontact tracing ,an dforepidemi olo gical MiddleEastRespiratorySyndrome studiesintosources,modesoftransmission,identificationofriskgroups,andanimalreservoirs.How- Coronavirus ever,optimaluseofthiscorepublichealthlaboratorycapacityrequiresafundamentalunderstanding Laboratorypreparedness Coronaviru s of kinetics of viral shedding and antibody response, of assay validation and of interpretation of test out- SARS comes.WereviewedavailabledatafromMERS-CoVcasereports,andcomparedthiswithdataonkinetics ofsheddingandimmuneresponsefrompublishedliteratureonotherhumancoronaviruses(hCoVs).We identifyanddiscussimportantdatagaps,andbiasesthatlimitthelaboratorypreparednesstothisnovel disease.Publichealthmanagementwillbenefitfromstandardisedreportingofmethodsused,detailsof testoutcomesbysampletype,samplingdate,inrelationtosymptomsandriskfactors,alongwiththe currentlyreporteddemographic,clinicalandepidemiologicalfindings. © 2013 Elsevier B.V. All rights reserved. Contents 1. Introduction.......................................................................................................................................... 5 2. Laboratorypreparedness............................................................................................................................ 5 3. Comparativeprofilesofcoronavirusdetectioninrespiratoryandothertypeofspecimens....................................................... 5 3.1. Respiratoryshedding,otherhCoV’s.......................................................................................................... 5 3.2. Respiratoryshedding,MERS-CoV............................................................................................................ 6 3.3. Gastro-intestinalshedding,otherhCoV’s.................................................................................................... 6 3.4. Gastro-intestinalshedding,MERS-CoV...................................................................................................... 6 3.5. OtherspecimensusedtodetectMERS-CoV.................................................................................................. 6 4. Factorsinfluencingviralsheddingkineticsandviralloads......................................................................................... 8 4.1. Hostfactorsandbiasforseverityinearlycases............................................................................................. 8 4.2. Mildandasymptomaticcases................................................................................................................ 8 5. Kineticsofantibodyresponse........................................................................................................................ 8 5.1. SARS-CoV..................................................................................................................................... 8 5.2. MERS-CoV.................................................................................................................................... 9 6. CurrentWHOrecommendationsforMERSlaboratorytesting...................................................................................... 9 6.1. Whototest?.................................................................................................................................. 9 6.2. Whattestisrequiredtoconfirmthecase?.................................................................................................. 9 ∗ Correspondingauthorat:CentreforInfectiousDiseaseResearch,DiagnosticsandScreening,NationalInstituteforPublicHealthandtheEnvironment,Antonievan Leeuwenhoeklaan9,3720BABilthoven,TheNetherlands.Tel.:+31652098601;fax:+31302744449. E-mailaddress:[email protected](M.Koopmans). 1 Twitte r:@Mari onKoopmans. 1386-6532/$–seefrontmatter© 2013 Elsevier B.V. All rights reserved. http://dx.doi.org/10.1016/j.jcv.2013.10.030 R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 5 6.3. Whichspecimenstotest?.................................................................................................................... 10 6.4. Whotonotifythecase?...................................................................................................................... 10 7. Conclusions.......................................................................................................................................... 10 Funding.............................................................................................................................................. 10 Competinginterests................................................................................................................................. 10 Ethicalapproval...................................................................................................................................... 10 Acknowledgements.................................................................................................................................. 10 References........................................................................................................................................... 10 1. Introduction sampling,profileofviraemiaandshedding,linkedtodiverseclin- icalmanifestations)severelyhamperstheuseofthesetechniques OnSeptember20,2012,thefirstconfirmedcaseofanewsevere inthecurrentoutbreak.Here,wereviewthecurrentknowledgeon respiratorysyndromecausedbyanovelcoronaviruswasreported MERS-CoVandotherhumancoronavirusesagainstdatarequired [1,2].Thepatientwasapreviouslyhealthymale,60yearsold,who foroptimallaboratoryresponsefortheMERS-CoV. livedinSaudiArabiaanddiedofacuterespiratoryillnessandrenal failure[1].Retrospectiveanalysisofstoredsamplesrevealedthat the novel coronavirus was also the cause of a severe respiratory diseaseclusterinvolvingpatientsandhealthcareprofessionalsin 3. Comparativeprofilesofcoronavirusdetectionin Jordanearlierthatyear[3].Theisolationofthenewvirusfromthe respiratoryandothertypeofspecimens Saudipatient’sspecimen,andsubsequentsequencinganddetailed phylogenetic analysis of the virus genome has revealed its close Inanearlyphaseofemergingviraldiseaseoutbreaks,typically relationshipwithbatbeta-coronavirusespreviouslyfoundinAsia, aninitialcomparisonwithclinicalmanifestationsofotherviruses Europe and Africa [1,4–7]. Whether this emerging hCoV jumped fromthesametaxonomicgroupisusedtodevelopasamplingstrat- from bats directly to humans or through other animals as inter- egy.Crucialfirstquestionsforchoiceofsamplingandsubsequent mediate hosts is still unknown, although the latter scenario is interpretationoflaboratorydiagnosticsare: consideredtobemostlikely[2].ThepresenceofMERS-CoVneu- tralising antibodies has been detected in dromedary camels in Spain,OmanandEgyptindicatingapastinfectionwithMERS-CoV • Whicharethekineticsofviralsheddinginpersonswithdifferent or a h ighly r elate d viru s in these c ame lids [8,9]. The evolution- disease sta tes (asympt om atic, mild,mo de rate,sev ere)? ary h istoryo fcoron avirus es shows evidence ofrec entin terspecies • What is the c oncentration of virus (viral load ) in various body jum ps [10, 11 ]. One of the first de scribed h um an co ronaviruses, comp art men ts,fluidsands ec retad uring thepr og ressiono fthe OC43,s haresac omm on rece ntan cestralhis torywit hbovinecoron- disease? aviruses,suggestingthesevirusesmayhaveemergedfromanimals • Howareinfectionkineticsandloadsinfluencedbyhostfactors aswell[1 0].In2003 ,Seve reAcu teRe spira torySynd rome (SARS) (e.g.i mm unosuppr ession,c o-m orbidi ties)? em erge d and w as th e first k nown major outb reak cause d by a • Wha tisthelimitofdetect ionofthediagnosticmethodsusedfor coronavir us[1 2].N ow, thee mergen ceofM ERS-CoV ,andits hig h thedi ffe ren tspec im ens? fatalityrate hast rigger edn ewconcern sa boutthepo tent ial fora widespread,possiblyglobaloutbreak.Challengesforpublichealth aretodevelopstrategiestocontrolthisemergingdisease,which 3.1. Respiratoryshedding,otherhCoV’s includeearlydetectionofcasesforwithlaboratorydiagnosisisof crucialimportance. Nasopharyngealaspirates(NPA)arethemostcommonrespira- toryspecimensdescribedintheliteratureformoleculardiagnosis 2. Laboratorypreparedness ofnon-SARSandSARScoronaviruses[17–19].Comparisonofdata betweenstudiesisdifficultbecausespecimensamplingisnotstan- Inoutbreaksituations,especiallywithanovelorganismcaus- dardised, with descriptions varying from naso-pharyngeal swab, ing severe human disease, it is important to understand the full naso-pharyngeal secretion, throat swab, nasal swab, oro-nasal spectrum of disease, as well as how this relates to infectivity, swab,allreflecting“upperrespiratorytract”sampling.Literature the ability to transmit the microorganism (e.g. virus), and out- reviewshowsthathCoVviralloadspeakatdifferenttimepoints comes of laboratory tests. Laboratory response during the early during the progression of disease: for non-SARS CoV (e.g. hCoV- stages of an outbreak therefore focuses on development of viro- NL63),peakviralloadsaredetectedaroundday1–2afteronsetof logical/microbiological and immunological methods for patient disease,withapparentclearanceofinfection,overthecourseof3 diagnosis, for contact tracing, and for epidemiological studies weeks in 50% of healthy children [17,20,21]. For SARS-CoV, viral intosources,modesoftransmission,identificationofriskgroups, loadsgraduallyincreaseuntilday10(60–95%ofpatients)afterthe screeningofpotentialanimalreservoirs,etc.However,optimaluse onsetofsymptoms,andthenprogressivelydecreaseafterday13 ofthiscorelaboratorycapacityrequiresembeddingofdataneeds (42–90%ofpatients)[22–24](Fig.1).Thiscomparisonillustrates forlaboratoryscientistswithintheoutbreakinvestigations,inorder thatevenforvirusesbelongingtothesamefamily,usingasensi- toobtaininformationneededforassayvalidationandcorrectinter- tive test (like RT-PCR), the interpretation of a test outcome may pretationoftestoutcomes. be very different: a negative reverse-transcriptase (RT)-PCR in a Following the discovery of MERS-CoV, molecular detection patientspecimencollectedearlyafterillnessonsetforhCoV-NL63 methods and antibody detection assays were developed by sev- maybeusedasevidenceforrulingoutinfection.Thesameassay eralgroups,anddeployedinternationallythroughaninternational appliedinanearlyspecimenfromapatientorcontactwithrecent collaborativelaboratoryresponse[13–16].However,inspiteofthe illnessonsetafterSARS-CoVinfectionwouldmostlikelybefalse- cutting-edgetechnologicalcapacity(e.g.deepsequencing,microar- negative,asviralloadsareexpectedtobelowduringthisphaseof ray technology), the lack of essential information (e.g. time of illness. 6 R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 Fig.1. Top:SchematicrepresentationofcomparativeprofilesofSARSshedding(peakviralload)andantibodieskinetics,basedondatadescribedby[24,44–46].Atthetopleft ofthefigure,peakviralloadinformationforHCoV-NL63isgiven,basedon[20].Bottom:schematicrepresentationofrelationshipbetweensensitivityofmoleculardetection andserologyinrelationtotimeofsamplingandkineticsofinfection. 3.2. Respiratoryshedding,MERS-CoV 3.3. Gastro-intestinalshedding,otherhCoV’s For MERS-CoV, data on respiratory shedding has only been In SARS, diarrhoea was one of the most common extra- reportedanecdotally,sofar.AlltheMERS-CoVcasesreportedlyhave pulmonarymanifestationsinpatients,andaprogressiveviralload developedarespiratorydisease,rangingfrommildtoseverepneu- peaking around day 10 was found in 70–100% of patients in monia,oftenaccompaniedbyacuterespiratorydistresssyndrome stoolspecimensregardlessrespiratorysymptoms(Fig.1)[22,24]. (ARDS)and/orrenalfailureand/orpericarditisand/ordisseminated Observations in children hospitalized for other hCoV suggests intravascularcoagulation(DIC).Clinicalmanifestationsandsever- that gastro-intestinal shedding is limited, compared with SARS, ityofMERSseemtobemoresimilartoSARSthanothercoronavirus althoughallfourhCoVsspecieshavebeendetectedinpatientstools infections.However,onlyonepublishedreporthasprovideddata [32].However,comparedtoSARSthereislessinformationabout needed for laboratory preparedness, i.e. on sequential sampling, kineticsofsheddingandviralloadsinstoolsandrespiratorysam- Ctvalues,andpositiveANDnegativetestresults[25].Therefore, ples. atpresent,viralsheddingkineticscanonlyindirectlybederived (Fig.2AandB).Weplottedatimelineofavailabledataonsampling 3.4. Gastro-intestinalshedding,MERS-CoV and test outcome by day of onset symptoms for the MERS-CoV patientsdiagnosedinUK,Germany,andFrance,aswellassome AlthoughthemajorclinicalmanifestationspresentedbyMERS casesfromSaudiArabia.Thedatasuggeststhatsheddingkinetics patientsareassociatedwiththerespiratorytract,gastrointestinal maybemoresimilartowhathasbeenobservedforSARSthanfor symptoms including diarrhoea during the course of illness were otherhumancoronaviruses,althoughverylimitedinformationis alsoobservedquitefrequently(35%)[25–27,33].Thistriggersques- availableforthelatter(Figs.1and2B).Thereviewalsosuggests tions regarding the use of stools to diagnose MERS-CoV. Again, that the use of upper respiratory specimens for MERS-CoV (e.g. availabilityofdataistoolimitedforacomparativeanalysiswith naso-pharyngealswabs)diagnosismaynotbeassensitiveasthe othercoronaviruses.IntheUAEpatientwhowasfirsttreatedinan useoflowerrespiratorytractspecimens(Fig.2AandB).Inagree- AbuDhabihospitalonMarch19,andlaterhospitalizedinGermany, mentwiththis,viralloadswerehigherinsamplesobtainedfrom stoolsamplestestedborderlinepositiveatdays12and16afterthe thelowerrespiratorytractcomparedwithupperrespiratorytract onsetofsymptoms(Fig.2A,patientB).Laterstoolsamplesfrom insomeMERS-CoVcases[25,26]. patients F from KSA and G, a patient transferred from Qatar to Thedifficultyininterpretationofdiagnostictestresultsisillus- theUK,werenegativebyRT-PCR[25,28,31].Whilstdiarrhoeahas tratedbytwosecondarycasesinFranceandintheUK,respectively beenlistedintheclinicalpictureforothercases,includingintwo (Fig. 2A; patients C2 and D2). Both patients were sampled early separateclustersinSaudiArabianotestinghasbeenundertaken afteronsetofsymptoms.TheNPSspecimenswerepositiveinthe [27,34]. UKcaseandnegativeintheFrenchcase,butsputumofthelatter waspositive.ForSARS,althoughmostofthesamplestestedwere 3.5. OtherspecimensusedtodetectMERS-CoV NPA ,lowerre spir atory tractspec imens w ere moreoft enPCR posi- tive(76%)thanNPA(45%)orotherupperrespiratorytractsamples OtherMERSpatient’sspecimenssuchasurine,sera/plasmasam- (24% )[24] . ples, and blood were ve ry rarely t ested , n ot all owing consi stent R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 7 Fig.2. (A)Summaryofcasereportswithdiagnosticinformationrelevantforlaboratorypreparedness.(naso-pharyngealswaboraspirate(NP);throatswab(TS);nasalswab (NS) ;o ro-n asalswab (O RS); trachea laspi rates(TA); Sputum(SP) ;broncho alv eolarlavag e(BAL);Stool( ST);Urine(U);seru mor pla sma(S/P );pos itive(+ );neg ative (−);u pper respiratorytract(URT);lowerrespiratorytract(LRT);*notpresentinfigure;notavailabledata(na).(B)SummaryofdatafrompublishedliteratureandreportsonMERS-CoV RT-PCRpositiverespiratoryspecimensbysampletype,andtimingofsamplingsinceonsetofsymptoms(seeRef.[29]). 8 R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 Table1 Primers/probessequencesforscreeningandconfirmatoryRT-PCRassaysforMERS-CoV. Typeofmolecular Targetregion Genomelocation PrimersandprobesSequence(5(cid:3)>3(cid:3)) Ref. assay Screeningassays UpstreamofEnvelope 27,458–27,550a upE-ForwardGCAACGCGCGATTCAGTT [13] ByrealRT-PCR gene(upE) upE-ReverseGCCTCTACACGGGACCCATA upE-ProbeCTCTTCACATAATCGCCCCGAGCTCG Nucleopcapsidgene 29,424–29,477a N2-Forwar dGGCACTGAGGACCCACGTT [57] (N2) N2-ReverseTTGCACATACCATAAAAGCA N2-ProbeCCCCAAATTGCTGAGCTTGCTCCTACA Confirmatoryassays Openreadingfrane 11,197–11,280a ORF1A-ForwardCCACTACTCCATTTCGTCAG [14] ByrealRT-PCR (ORF)1Agene ORF1A-ReverseCAGTATGTGTAGTGCGCATATAAGCA ORF1A-ProbeTTGCAAATTGGCTTGCCCCACT Openreadingfrane 18,266–18,347a ORF1b-Forwa rdTTCGATGTTGAGGGTGCTCAT [13] (ORF)1bgene ORF1b-ReverseTCACACCAGTTGAAAATCCTAATTG ORF1b-Probe:CCCGTAATGCATGTGGCACCAATGT Nucleopcapsidgene 28,748–28,795a N3-ForwardG GGTGTACCTCTTAATGCCAATTC [57] (N3) N3-ReverseTCTGTCCTGTCTCCGCCAAT N3-ProbeACCCCTGCGCAAAATGCTGGG Confirmatoryassays RNA-dependentRNA 15,049–15,290a RdRpSeq-ForwardTGCTATWAGTGCTAAGAATAGRGC [14] Bysequencing polymerase(RdRp) RdRpSeq-ReverseGCATWGCNCWGTCACACTTAGG RT -PCR RdRpSeq-Rnested CACTTAGGRTARTCCCAWCCCAb Nucleocapsid(N) 29,549–29,860a SeqN-ForwardCCT TCGGTACAGTGGAGCCA [14] proteingene SeqN-ReverseGATGGGGTTGCCAAACACAAAC SeqN-Fnested TGA CCCA AA GAA TCCC AA CTAC c a Nucleotidenumberingbasedonhumanbetacoronvirus2cEMC/2012strain. b RdRpSeq-R nested–inc asesw he renoam plificationpro duc tswereob tainasecond-roundreactionPCRissetupusingthesameforwardprimerasinfirstround,andthis reverseprimer. c Seq N-Fnested–incaseswherenoamplificationproductswereobtainasecond-roundreactionPCRissetupusingthisforwardprimerandthesamereverseprimeras infirstround. conclusions(Table1).Theurinespecimenstestedwereonlyfrom group is notoriously difficult, as it requires targeted studies and thepatienttransferredtoGermanywereRT-PCRwaspositiveon willingness of healthy persons to have samples taken. Without days12and13,butnotonday14afterrenalfailure.Sera/plasma properstudies,itisunclearifforinstanceasymptomaticpersons samplescollectedfromthreepatients(lateondiseaseprogression; cancontributetotransmission.Thereareconsiderablydifferences 16–20days)wereallnegative(patientsF,C1,B).RT-PCRdoneon amongrespiratoryvirusesintheratiobetweensymptomaticand bloodofoneFrenchpatientwaspositive(15day). asymptomaticinfections.Forinstanceamongchildren,infections causedbyrespiratorysyncytialvirus(RSV)andhumanmetapneu- 4. Factorsinfluencingviralsheddingkineticsandviral movirus,usuallyareassociatedwithclinicalillness,incontrastwith lo ads non SARS CoVs, rhi novirus an d hu man bo cavirus t hat are c om- monlyfoundinasymptomaticchildrenaswell[42]. 4.1. Hostfactorsandbiasforseverityinearlycases 5. Kineticsofantibodyresponse Establishing relevant cut-off values in tests should also take intoconsiderationthatpatientgroupsdifferwithrespecttoage, 5.1. SARS-CoV co-m orbidities,etc .Dur ingthe earlyst ageso fano utbreak in ves- tigation,observationscanbebiasedforseverediseaseinspecific The literature on kinetics of antibodies in patients with groups o f patients (e. g. ol der patien ts a nd wit h co-m orb idities). SARS-C oV shows som e conflict ing results reg ard ing the ti me of Sofar, t he majority of re porte d MERS c ases have had underlying appearanc e of an tibodi es. Accordin g to so me report s, SA RS-C oV diseas e an d/or imm u nosuppre ssion that c ould be a n explana- antibodies( IgG andIgM)a reusually not detec tedwith inthefirst tionfor thehig hercasefatalityrate (60%) [27,34 ,35] .In addition, 7 days of illnes s, bu t inc reas e dram atica lly in th e secon d w eek, dela yed clea rance of vir al infec tion in suc h risk grou ps could be re achin gp eakIgG lev elswithin 30days(Fig .1) [43 ,44].Sim ilarly, an alter native exp lan ation for the p ro longe d sh edding observ ed IgM antib ody leve ls incr eased u p to 1 m ont h a nd then declined in the patient s described ( Fig. 2B) . Patients w ith co-m orbidities grad ually.Thi sprofil ehasbeen ob ser ve dwith two differ entsero- m ore often ha ve non-SA RS C oV in fections (hCo V-229E, hCoV- logicalass ays,a ssuring tha tthe detection levels ofa ntibodies were OC43 ,hCoV- NL63 ;hCoV-HKU 1)co mparedwi thotherwiseh ealthy notaff ectedby sensitiv ityo fth etest.Oth erstu die sfoundsp ecific patien ts,andmays hedvirusforp rolongedp erio dsoftime[ 36–39]. anti bodies ( IgG , IgM and IgA ) as ear ly as 4 days a fter th e onset InSARS, the clinic alco urse am ongpatien tslesst ha n12 yearsof ofdisease [45,46 ].Ig Gan dneu tra lising an tib odies may per sistin ag ewasm ild erandle ssaggr essivew hencom pare dwit had ultsa nd so mepatie ntsupt o36 mon ths,although titresshow eds ignifica nt teen age rs[40,4 1].K inet icsofvirall oadsa ndthepatt erno fshedd ing declin eafterfo ur m ont hs[47].S uchdata isimp ortantw henplan- candiffer inthese groups of patie ntsan din flu enceint er pretation ningser osurv eys thatmay take seve ralm on thstoorga nised ueto ofd iagnos tic resul ts. proto coldesign,e thica lcle aranc e,andp lanning of studylog istic s. ThepresenceofantibodiesagainstSARS-CoVinindividualswith 4.2. Mildandasymptomaticcases no or mild symptoms has been described in healthcare workers [48].Antibodylevelsmeasuredinthisstudywerehighestforper- While clinical surveillance captures the most severe patients, sonswithsevereillness,indicatingthatdifferenttestcut-offsmay outbreakcontainmentrequiresafullunderstandingofthediver- be needed for the use of laboratory tests during public health sityinclinicalpresentations,includingmildorasymptomaticcases. investigations that aim to identify mild cases as well. Based on Assessing shedding kinetics and immunological response in this epidemiologicalinvestigations,includingserologicalassessmentof R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 9 Table2 SerologicalassaysforMERS-CoV. SerologicalAssays Antigenused Technicaldetails Ref. Indirect Wholevirus MERS-CoVinfectedanduninfectedVeroB4cells [13,30] Immunofluorescence FordetectionofspecificIgGandIgMinpatientserum Assay(IFA) Recombinantspikeand TransfectedVeroB4cellsexpressingrecombinantspikeornucleocapsidproteinof [14,30] nucleocapsidproteins MERS-CoV FordetectionofspecificIgGandIgMinpatientserum (a)ControlsofotherhumanpathogenicCoVfordifferentialrIFAshouldbeincluded. (b)Confirmationbyvirusplaquereductionneutralisationtest(PRNT) WesternBlot Recombinantspikeand TransfectedHEK-293Tcellsexpressingrecombinantspikeornucleocapsidproteinof [14] nucleocapsidproteins MERS-CoV (a)Confirmationbyvirusplaquereductionneutralisationtest(PRNT) Proteinmicroarray SolubleS1subunitofspike Amino-terminalreceptorbindingspikedomainS1,expressedinHEK-293Tcells. [16] protein FordetectionofspecificIgGandIgMinpatientserum (a)ControlsofotherhumanpathogenicCoVshouldbeincludedonmicroarrayanalysis fordifferentialdiagnosis. (b)Confirmationbyvirusneutralisationtest Neutralisationtest PlaqueReduction ForserumneutralisationtestsVeroB4cellswereusedin24-wellplates. [16,25,30] Neutralisationtest(PRNT) UsedfortestingforMERS-CoVneutralisingimmunoglobulinsinpatientserum Wholevirus RequireBSL3 MicroNeutralisationTest(MN) ForMNtestVerocellsmonolayerswereusedin96-wellmicrotiterplates. [8,9] Wholevirus UsedfortestingforMERS-CoVneutralisingimmunoglobulinsinpatientserum RequireBSL3 Pseudoparticlevirus(ppNT) FortheppNTassay,HIV/MERSpseudoparticlescontainingHIVp24viralproteinwere [9] usedtoinfectVeroE6cellsinasinglewell(96-wellplate).eudoparticlevirus(ppNT) UsedfortestingforMERS-CoVneutralisingimmunoglobulinsinpatientserum RequireBSL2 the extent of transmission, the conclusion was that only symp- orresidencein,theArabianPeninsulainthe14daysbeforeillness tomaticpatientswereefficientspreadersofSARSvirus[49]. onset;orcontactwithknownconfirmedorprobableMERScasesin the14daysbeforeillnessonset[54].AdditionallytheWHOrecom- mendstestingfornovelcoronavirusofpersons,includinghealth 5.2. MERS-CoV careworkers,inclustersofacuterespiratoryinfectionofunknown For MERS-CoV, some asymptomatic infections have recently aetiology,requiringhospitalisation,orwheretherespiratoryinfec- beenid entifiedinh ealth workersandch ildren(n=8 )but whether tionisune xpectedly severe. thesepersonscanefficientlytransmitinfectionremainsunknown [50,51].Antibodydetectionassayshavebeendeveloped,buttheir usehasbeenlimited.Aretrospectivestudyhasreportedserolog- 6.2. Whattestisrequiredtoconfirmthecase? icaltestingbyimmunofluorescenceassayof2400serumsamples frompersonsseekingmedicalcareatFakeehHospitalinJeddah, AccordingtotheMERScasedefinition(WHO,revisedon3July SaudiArabia(wherethefirstcaseofMERSwasdiagnosed)inthe 2013)aconfirmedcaserequireslaboratoryconfirmationbymolec- twopreviousyears[1].AllthesepatientstestednegativeforMERS- ularmethodsincludingapositivereal-timereverse-transcription CoV,whereasapatientwithconfirmedMERS-CoVinfectionhada polymerase chain reaction (rRT-PCR) on at least two specific clearantibodyresponseforIgG[1].Someauthorshaveexplained genomictargets(Table1)orasinglepositivetargetwithsequencing theirlackofuseofserologybythefactthatassaysarenotyetval- onasecondtarget[54,55].AsinglepositiverRT-PCRwithoutcon- idated [34]. This argument seems flawed, as the same could be firmationwillbeconsideredasinconclusiveMERS-CoVlaboratory arguedforPCRassaysthatareuseduniversally,withthelimita- test,andsuchcasesareclassifiedasprobable.Severalmolecular tions described above. Serological testing confirmed infection in assays are now in widespread use and a two-step approach of twoMERS-CoVpatients(fromAbuDhabiandQatar),hospitalized screeningandconfirmation(Table1)algorithmshavebeenrecom- inGermany.BothhadhightitresofantibodiesbyIFA,thatwere mendedbyWHOandCDC[55–57].Inbothalgorithmsascreening alsoconfirmedbyneutralisationtestsandbymicro-arraytesting PCRtargetingaregionupstreamoftheEgeneisproposed,some- [16,25,30].InterpretationofMERS-CoVserologycanbehampered timescombinedwithnucleocapsid(N)genebasedPCR,toenhance by the widespread circulation of the four common hCoVs, espe- sensitivity for specimen screening [55–57]. For confirmation, a cially by hCoV-OC43 and hCoV-HKU1 which belong to the same secondassaywithadifferentsetofprimersandprobesisrecom- genusofthebetacoronaviruses.Cross-reactiveantibodieshavebeen mended(Table1). shownbetweenSARS-CoVandothercoronavirus,dependingalso SerologicalassaysfortestingantibodiesagainstMERScoronavi- onspecificityoftheassay[52,53]. rusweredevelopedbydifferentlaboratoryexpertsandcanbeused forhumandiagnosticsaswell(Table2).However,noofficialrec- ommendationsarecurrentlyavailableregardingserologicaltests, 6. CurrentWHOrecommendationsforMERSlaboratory andvalidationhasbeendifficultbecauseoflimitedavailabilityof testing humanconvalescentsera.AccordingtotheWHOcasedefinition,a 6.1. Whototest? personwithanacutefebrilerespiratoryillnessofanyseveritywith positive sero log icalt est,itw illbecateg orised as pro bableca seof According to the WHO guidance for health professionals, MERS-CoV infection [54]. Whenever possible a paired acute and patientsshouldbeevaluateforMERS-CoVinfectioniftheydevelop convalescentserashouldbetested,ideallycombinedwithmolec- pneumoniaorpneumonitisandfeverwithahistoryoftravelto, ulartestingofrespiratorysamples. 10 R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 6.3. Whichspecimenstotest? [2] DeGrootRJ,BakerSC,BaricRS,BrownCS,DrostenC,EnjuanesL,etal.Mid- dle EastR esp iratory Syn drom eCo ronavi rus (MERS-C oV ):announ cem e nto fthe Cor onav irusStudyG roup.JVir ol2013;87:7 790–2. speAcism deenscsriabreedc aoblloevcete, idt iws shternonpgolys saidbvleis,eind tahdadt iltoiownert orenspasiroapthoray- [3] NHoijvaewli cBo,r oAnb advailrluast Min,f eScatyio any sdeinh JAo,r Adalqna,sArapwriil S2,0 H12a:ddeapdidine mAi, oJlaoagriocualr fiNn, deitn agls. ryngeal an d or opharyng eal sw ab specim en s should be collected. from a retrospect ive investi gat ion. Ea st Me diterr Health J 2013;1 9(Suppl. 1):S1 2– 8. TheWHOalsoemphasisesrepeattestingasinitialresultsmaybe [4] WooPC,LauSK,LiKS,PoonRW,WongBH,TsoiHW,etal.Moleculardiversity negative.Specimensshouldbesendtoareferencelaboratoryfor ofco rona viru ses in bat s.Vir ology 2006 ;351 :180 –7. confirmat ion. [5] Re uskenCB,Lina P H,Pie laatA,d eVriesA,Dam-DeiszC,AdemaJ,etal.Cir- culation ofg roup 2co ronavir us esi naba ts peciescom mo ntourb a na rea sin Western Eu rope.V e ctorBorneZoo no ti cDi s2010;1 0:785–91 . 6.4. Whotonotifythecase? [6] VanBohe emenS ,deGra afM,L auberC, Bes tebroerTM,RajVS,ZakiAM,etal. Gen omiccharac te riz ation ofa newly di scoveredco rona viru sa ssoci ated w ith Each probable or confirmed case of MERS should be immediately [7] aItchuettee reNsL p,irSattoofrfyb derisgtreSs,sC s oyrn md raonmVe Min , hCuomttaonnst.a Mi lBVioM 2,01R2ic;h3a( 6rd):se0L0R4,73Sc. hoe- communicated to the national health authorities. Additionally, manM C,e tal.Close re lativeof hum anMiddle East respirator ysy ndrome WHO requests th at co nfirmed and pr obable cases be reported coron avir us in bat, S outh A fric a. Emer g Infec t Dis 2013;19(1 0):1697–9, within 24hofb eingc lassifiedas such ,throught hereg iona lContact http://dx.do i.or g/10. 3201/ei d1910. Point fo r I nt er nation al Health Re gulat ions at th e a ppropria te WHO [8] MReiudsdkleenE CasBt, Hreasapgimraatonrsy BsLy, nMdürollmere McAo,r oGnuatvieirruresz nCe, uGtoradleiskien gGJs, eMruemyera nBt, iebto adl-. RegionalOffice. iesind rome darycamel s:acompa rativeserolo gicalstudy.L ancetI nfectDis 201 3; 13(10):859– 66. 7. Conclusions [9] dPeermerioal Rog, WyfaonrgM PE, RGSocmoraoan Mav, iErlu-Sshuessinhgenmyi cRr,o Knaenudteralll iAsa, Btiaognaaton dOp, eset uadl. oSpearorteipclie- virusneutr alis ation assaysrevea lahig hprevalenceofanti body indromedary Advancesinlaboratorytechniquesoverthepastdecadeshave came lsinEgypt,Jun e2013 .EuroS u rveil l2013;18(3 6). led to a cont inu ous impro vement of l abora tory pre parednes s for [10] EVvijogleunt i oLn, aKreyyhaeisr ttosr yE, oLfetmhee yc lPo,s eMlyaerse lPa t, eVdangr oRuepeth2 cKo, rNonaauvwiryunsceks :Hp, oertc inale. emerging infectious diseases. However, the lack of sufficiently hemagglutina ting en cep halo myeliti s virus, bovine c oronavirus, and human detailed d ata accom panying patient no tifica tions a nd publica- coronavirusOC43. JVirol2006;80:72 70–4. tions is an im portant constr aint for developing ev iden ce-based [11] WooPC,Lau SK,Hu a ngY, YuenKY.C oronavirusdiversity,phylogenyandinter- speci esj ump ing .ExpB iol Med 200 9;234:1117– 27. udinadgenrosstatincd sinugppoofrtt hteo coluintbicraelaks iginnvifiecstaingcaetioannsd. Teop idgaeimn ioal obgeytteorf [12] cPaeuirsies JoS f, sLeavi eSrTe, Pao counte L rLe, sGp uiraant oY r, yYasymn dLYro, mLime. LWan, ecte atl2. 0C0o3ro;3n6a1vi:r1u3s1 a9s– a2 5p.ossible MERS-CoV, it i s im per ative to collect detai led d ata on sampli ng, [13] Corma n VM,Ec kerle I,BleickerT ,ZakiA,La ndtO, Eschbach-BludauM,etal. Detectio nof anovel h umanco ro navir us byre al- timereverse-tran scri pti on dlaebmorioatloogryic aalndaalytase,isn aonrdd erretsouilmts,p croomvebtihneedq uwaliitthy oclfinthicealla banorda teopriy- [14] pCoolrymmaenraVs ,eM c hual lienr rMea, cCtoiosnta. bEeu lroU ,SuTirmvemill J2, 0B1in2 g;1e7r:T2,0M28e5y .erB,etal.Assaysfor supportdurin gout br eaks.U n tilfullva lida tionofl ab orat oryassays laborato ry confirm ati onofnov el human c oronav iru s(hCo V- EM C) infectio ns. EuroSurve ill2012;17:20 28 5[Err atum,Eu roSurveill2 012;17:2028 8.]. has been done, the combined use of molecular and serological [15] Palm D,Perey aslovD,VazJ,B robergE,Z eller H,Gross D,etal.Laboratorycapa- approachesishighlyrecommended.Acuteandconvalescentserum bility fo rmolecular de tect io nandco nfi rmati on ofnov el co ron avirusinEu rope, samples sh ou ld be collected from each pat ient to help define Novem be r2012.Eu roSurveil l201 2;17:20335. kinetics of seroc onv ersion th at wil l help to confi rm or r ule out [16] cRiefiucsskeerno lCo, gMyofour H e,m Geor dgeinkeg GhuJ, mVaann dcoerr oHnoaevkir Lu,s Mesebyyerp Bro, Mteuinllemr iMcrAoa, rerta ayl.. ESupreo- infection in future patients, avoid misdiagnosis (false negative Surv eill2013; 18: 20441. test resu lts) due lo w sensiti vity in an early pha se of infection [17] ChiuSS, ChanKH,ChuKW,KwanSW,GuanY,PoonLL,etal.Humancoronavirus whe n antibo dy l evels are low, a nd to contr ol for no n-specific aNcLu6t3e irne fsepcitriaot no rayn ddi soet ahseer icn oHroonnag vKiroun sg i,nCfehc intia o.nCsl iinn Icnhf eilcd trDe nis h2o0s0p5i ;t4a0li:z1e7d2 w1–it9h. reactivity. [18] Woo PC, Lau SK , Tsoi HW , Hu ang Y, Poo n R W, Ch u C M, et al. Clini- cala ndm olec ular epide miolo gicalfe atu resof coron aviru sHKU 1- asso ciated Funding [19] cCohme nmguV n,itLya-uacSq,uWir eodo pPn,eYuumenonKi.a.S Je Ivnefreecta Dcuis t e20 re0s5p;1ir9a2to:1ry89s8 y–n9d0r7o.mecorona- virusa sa nag en tofe m erging a ndreem ergin ginfection. ClinMicro biolRev RSwasfundedbytheEuropeanPublicHealthTrainingProgram 2007 ;20 :66 0–94. (Euph em), ECDC,S to ckho lm. [20] VanderHoekL,SureK,IhorstG,StangA,PyrcK,JebbinkMF,etal.Croupis asso ciate dwit ht heno ve lcoron av irusN L63 .PLo SM ed200 5;2:e 24 0. laboRrIVatMor yisn peatwrtonrekr EinN ItVhDe (EECuDroCp espanonNsoetrwedo rokuftobrreDaika gansossistticasncoef [21] aKsasiosecria Lte, dR ewgaitmh eloyw N e, rRroeish pai rHa,t oDreyffterranc etzs yCm, F prteoym U s. iHnue maralyn lciofer.oPneadviiarutrs INnfLe6c3t ‘Imported’ ViralDise ases)C ontractRef .No.ECDC /20 13/012. DisJ2005; 24:10 15–7. [22] Peir i sJS,ChuCM,ChengVC,ChanKS,HungIF,PoonLL,etal.Clinicalprogres- siona nd vira lloa dinac om munit yo utbrea ko fcor ona vir us -associa tedSARS Competinginterests pneu mon ia:a prosp ec ti vestudy.Lan cet2003 ;36 1:1767–72. [23] TsangOT,Ch au TN,ChoiKW ,TsoE Y,LimW ,ChiuMC ,etal.Coronavirus-positive nasop hary ngea las pirat eas pre dict orf ors ever eac ut er espiratorysyndrome None. mortality.Emerg InfectD is2 003;9:13 81– 7. [24] ChengPK, WongD A,Ton gL K,IpSM,LoAC,LauCS,etal.Viralsheddingpatterns Ethicalapproval ofcoro nav irusin pa tients wi th pro bab le seve re acu te resp iratorysy ndrome. La ncet2004;36 3: 1699–70 0. [25] Droste n C, Seilmaier M, Corman VM, Hartmann W, Scheible G, Sack Notrequired. S, et al . C linical feat ures and vir ologic al analysis of a case o f M iddle Ea st resp iratory syndrome coro navirus inf ection. L anc et Infect D is 2013, http ://dx.doi.org /10.1016/S1 473-3099(13 )70154-3. Acknowledgements [26] GueryB,PoissyJ,MansoufL,SéjournéC,EttaharN,LemaireX,etal.Clinical feature s andvir al diagnosis o ftwocase so finfect ion withMi dd le Eas tRespi- We thank professor Aftab Jasir, ECDC Stockholm, Dr. Henk ratoryS yndr ome coronavir us: ar eport of nosocom ialtr ansmiss ion. Lancet Bijlmer ,RIVM ,forcritica lrevie wofth eman uscript. 2013;3 81:2265–7 2. [27] MemishZA,ZumlaAI,Al-HakeemRF,Al-RabeeahAA,StephensGM.Family clustero fM iddleE ast respiratory synd romecoron avir usinfectio ns.N EnglJ References Med20 13 ;368:24 87–9 4. [28] Albrr akA,StephensG,HewsonR,MemishZ.Recoveryfromseverenovelcoro- [1] MoZaf ekadi n A2oM0v1,e 2vl ;ac3no6 rB7oo:n1ha8ev1ei4mru–es2n 0f rS.o, mBe sat embarno ewr TitMh ,p Onsetuemrhoanuisa A iDn , SFaouudcih Aierra RbAia.. INso lEantigol nJ [29] EnHvaeivadilretuhns c Peinr o foetecf tcitpoionenr. sS oAa nug-edt nio cM-pye e(drHs JoP 2n A0 )1 tU2ra;K3n 3sN(m1oi2vs e)s:li1 oC2no6 r5ow–n9iat.hviinr u sa In fvaemstiliyg a tcioluns tT eera mof. R.deSousaetal./JournalofClinicalVirology59 (2014) 4–11 11 novelcoronavirusinfections,UnitedKingdom,February2013.EuroSurveill [44] MoH,ZengG,RenX,LiH,KeC,TanY,etal.Longitudinalprofileofantibod- 2013; 18:20427. ies aga instS AR S-co ro na vir usi n SARS p ati ent sandtheirc linicals ign ificance. [30] BuchholzU,MüllerMA,NitscheA,NitscheA,SanewskiA,WeveringN,etal. Res pirology 2006;11:49–53. Contactin ve stigatio nofa caseof hu mannov el coronaviru si nfectiontr eat ed in [45] HsuehPR,H uangLM,ChenPJ,KaoCL,YangPC.Chronologicalevolutionof aGerma nhospital,Oc to b er–N ov ember2 012.E uroSurveill 2013;18: 20406. IgM,Ig A,Ig Gandn eutra lisati ona ntib odie safte rinf ectionwithSAR S-associat ed [31] B ermingh amA,Cha ndMA,BrownCS,Aa ronsE ,Ton gC,Lang rishC,etal.Severe coro navi rus. Clin MicrobiolInfe ct2004;10 :106 2–6. respiratoryill ne sscaus edb yanov elco ronavi ru s,ina pa tienttran sf er red tothe [46] He Z, Dong Q, Zhuang H , Son g S, Peng G, Luo G, et al. Kinetics of UnitedKing domfr omthe Mi d dleEas t,September 2 01 2.Euro Surveill201 2; 17: sev ere acute res piratory syn drom e (S ARS) cor onavi rus -spe cifi c antibod ies 20290. in271 labora tory-confirm edcaseso fSARS. ClinDiagnLabImm unol2004; [32] PuzelliS,AzziA,SantiniM,DiMartinoA,FacchiniM,CastrucciMR,etal. 11 :792 –4. Investi gat iono fan impor ted cas eofMidd le EastResp irat orySyndr ome Co ro- [47] Cao WC, Liu W, Zhang PH, Zhang F, Richardus JH. Disappearance of anti- navirus(MER S-C oV )infection inFl ore nce,Ita ly,M aytoJune20 13.EuroSu rveill bod ies to SA RS-a ssociat ed c oronav iru s after rec ove ry. N Engl J Me d 2007; 2013;18 (34),pii:205 64. 357:11 62– 3. [33] OmraniAS,M ati nMA,HaddadQ,Al-NakhiliD,MemishZA,AlbarrakAM.A [48] Wilder-SmithA,TelemanMD,HengBH,EarnestA,LingAE,LeoYS.Asymp- familyc lust erofM idd leEastR es piratorySy nd romeCo rona virusinfe ction s tomatic SARS co ronavirus infe ction amo ng heal th care wor kers , Sin gapore. related toalik el yunreco gniz edasymptom aticormi ldcase.IntJ InfectDis EmergIn fectD is2005;11:1 142–5. 2013;17 (9 ): e668–7 2,http://dx.do i.org/10.1016/ j.iji d.201 3.07.0 01. [49] Nishiya maA ,W akasugiN,KirikaeT,QuyT,HaleD,BanW,etal.Riskfac- [34] AssiriA,McGeerA,P erlTM,PriceCS,AlRabeeahAA,CummingsDA,etal. torsforSA RS infection wi thinhos pi talsi n Han oi. Vi etna mJ pn JI nfect Dis Hospi tal outbreak o fMid dle Eastr esp irat orysynd rom ecoronaviru s.N E ngl 2008 ;61 :388– 90. JMed20 13;19:1–1 0. [50] WHO. Global Alert and Response (GAR). MERS-CoV summary and litera- [35] E urop ean Centre for Disease Prevention and Control. Update rapid risk ture u pdate – as o f 09 July 2013 ; 2013 http://ww w.who.int/ csr/d isease/ assessmen t: sev ere respirato ry disease ass ociated with M iddle East coro navirus inf ect ion s/up date 20130 709/en / respiratory syndrom e coronav irus (ME RS-CoV). S tockho lm, Sw eden: [51] MemishZA, ZumlaAI,AssiriA. MiddleEastrespiratorysyndromecoronavirus European C entre for D isease Preven tion and Cont rol; 2013. A vailable at infection sin health ca rewor ke rs.NEn glJM ed2013;36 9(9):884– 6. http://ww w.ecdc. euro pa.eu/en /publication s/pub lications/ risk-as sessment- [52] MaacheM ,K omuri an-P radelF,R aj ohar is onA ,PerretM,BerlandJL,Pouzol middle-east-respiratory-syndrome-coronavirus-mers-cov-24-sept-2013.pdf S, et al . Fa lse-positive resul ts in a recomb in ant sev ere acute r esp iratory [36] Cabec¸aTK,GranatoC,BelleiN.Epidemiologicalandclinicalfeaturesofhuman sy ndr om e-associated c oronavir us (S ARS-CoV) nu cleocaps id-bas ed western coron av iru sinfectio n samo ng differentsubset sof patient s.Influen za Other blotassaywererectifi edbytheus eoftwosub units(S1andS2)of spikefor RespirVirus es2013;5:1 –8. dete ctiono fanti bodytoS AR S-Co V.C lin Vac cineImm unol 200 6;13 :4 09–14 . [37] PeneF ,Merlat A,VabretA,RozenbergF,BuzynA,DreyfusF,etal.Coronavi- [53] ChanKH, Ch anJF,Tse H, ChenH,La uCC ,CaiJP,e tal.Cross -reactiveantibodies rus2 29 E-relate dp neumo ni ainimmun oc ompro mi sedpatie nt s.C lin InfectDis incon vale scent SA RSp at ients’ se raag ain stth ee m erg ingnovelhum ancorona- 200 3;37:929–32. vir usEMC(2012 )byb othimm unofl uoresc ent andneutra lizing antibod ytests. [38] PyrcK,BerkhoutB,vanderHoekL.ThenovelhumancoronavirusesNL63and JInfe ct201 3;67:1 30 –40. HKU 1. JVirol200 7; 81:3 051 –7. [54] W HO. Revised interim case definition for reporting to WHO – Mid- [39] Domin g uez S R, Robinson CC, Holmes KV. Detection of four human coron- dle E ast respi ratory s yndro me corona viru s (MERS-C oV) . Inter im case avirusesin resp iratoryinf ecti onsinch ildr en:aone-y ea rstu dyinCo lorado. defi nition as of 3 J uly 2013; 2013. Availab le at: http:/ /www.wh o.int/ JMedVi rol 2009;81:15 97–604. csr/diseas e/co ron avi rusin fection s/case definition/e n/ [40] C hiuW K,C heungPC,NgKL,IPPL,SuqunanVK,LukDC,etal.Severeacute [55] WHO. Laboratory test ing for Middle East respiratory syndrome coro- respi rator ysyndro me in child re n:e xperience in areg ion alh os pitalin Hong naviru s. Interim recomm enda tions, 1 6 Sep tember; 20 13. Availab le at: Kong.Pedia trCritCare M ed2003;( July)4:279– 83 . http://w ww.who. int/csr/disease/coron avir usinfections /MERS Labrecos1 6 [41] HonK L,Leun gCW ,Ch eng WT,ChanP K,ChuWC,KwanYW,etal.Clinical Sept2013.pdf pres enta tionsa ndou tcome ofse verea cut eres pirato rysyn drom e inc hildren. [56] Cent ers for Disease Control and Prevention. Novel coronavirus Lancet2003;3 61:1 701–3. 2012 r eal-ti me RT-P CR assay . 3 June 2013; 2013. Available at: [42] Jansen RR,WieringaJ,KoekkoekSM,VisserCE,PajkrtD,MolenkampR,etal. http:/ /www.fda.g ov/down loads/Me dic alDevic es/Safet y/Emer gencySituat ions/ Freque ntd etectiono fr espiratory viru seswi thou tsymp to ms:towardd efi ni ng UCM355572.pdf clinically relevantc ut offvalues.J ClinMic robiol2 011;49:2631 –6. [57] LuX,WhitakerB,SakthivelS,KamiliS,RoseLE,LoweL,etal.Real-timeReverse [43] ChenW,X uZ,Mu J,Yang L,Gan H ,Mu F,etal.An tibodyresponseandviraemia Tra ns criptionP ol ymeraseC ha inRea ct ionA ssay Pane lf or Mi ddleEastR espira- durin g t he co urse of sev e re ac ut e re sp ir ato ry syndro me (SAR S)-a ssociated torySyndrom eCoronaviru s.JCl inMicrob iol201 3[Ep uba heado fprin t]. corona virus infecti on. JMedM icrob iol2004;53: 435–8.

See more

The list of books you might like