loading

Logout succeed

Logout succeed. See you again!

ebook img

41. Sequence, evolution and transcriptional regulation of avian-mammalian P1 type protamines PDF

pages12 Pages
release year1995
file size2.8 MB
languageEnglish

Preview 41. Sequence, evolution and transcriptional regulation of avian-mammalian P1 type protamines

Sequence, Evolution and Transcriptional Regulation of Avian-Mammalian PI Type Protamines Rafael OLIVA Human Genome and Molecular Genetics Research Group, Faculty of Medicine, University of Barcelona, Diagonal 643, 08028 Barcelona, Spain ABSTRACT Methodological approaches to protamine PI sequence determination have evolved from the initial protein sequencing methods to the robust cloning and PCR-based techniques. Twenty-seven different mammalian-avian PI type protamine genes and 32 different PI amino-acid sequences are now available and allow detailed phylogenetic analysis and the study of transcriptional control mechanisms. All mammalian-avian PI type protamines contain a well conserved N-terminus with the consensus "ARYR" followed by alternating "S/T-S-S” phosphorylatable residues. Eutherian mammalian Pis contain cysteine residues, whereas birds, prototherian and metatherian protamines lack cysteine. Thus cysteine appeared after the divergence of marsupials, monotremes and placental lineages. Overall detailed phylogenetic analysis of the gene sequences indicates that the evolution of PI genes is in agreement with the expected species evolution supporting that these genes have evolved vertically. RESUME Sequence, evolution et regulation transcriptionnelle des protamines de type PI des Oiseaux et Mammiferes Les approches methodologiques dc determination de sequence des protamines PI ont evolue depuis les premieres methodes de s^quen^age de proteines jusqu’aux techniques fiables basees sur le clonage et la reaction d'amplification en chaTne. Vingt-sept genes differents de protamines dc type PI des Oiseaux et Mammiferes et trente-deux sequences differentes d’acides amines sont maintenant disponibles et permettent une analyse phylogenique et une etude des mecanisme de controle de la transcription. Toutes les protamines dc type PI des Oiseaux et Mammiferes contiennent une extremity N-terminale bien conservee avec la sequence consensus “ARYR” suivie par la s6quence alternee de residus phosphorylables “S/T-S-S". Les protamines PI des Mammiferes Eutheriens contiennent des residus de cysteine, alors que les Oiseaux, les Protheriens et les M6thath6riens n’en ont pas. La cysteine est done apparue apres la divergence des lignees des Marsupiaux, des Monotremes et des Placentaires. Une analyse phylogenique generale et detaillee des sequences de genes indique que Involution des genes des PI est cn accord avec Revolution attendue des especes, ce qui indique que ces genes ont 6volue verticalement. Protamines are small (30-60 amino acids) and very positively charged proteins (40-70% arginine) which appear at the late stages of spermatogenesis in many but not all animal, and some plant, species [6, 11, 16, 21-23, 25, 43, 50, 52, 60, 69-73]. In those species in which they occur, such as in all mammals [6, 52], birds [13, 52, 53,], some teleost fish [11, 16], some reptiles [25, 70] and amphibians [25] they replace most of the histones during spermiogenesis and Oliva, R., 1995. — Sequence, evolution and transcriptional regulation of avian-mammalian PI type protamines. In: Jamieson, B. G. M.. Ausio, J., & Justine, J.-L. (eds). Advances in Spermatozoal Phylogeny and Taxonomy. Mem. Mus. natn. Hist, nat., 166 : 537-548. Paris ISBN : 2-85653-225-X. 538 R. OLIVA : AVIAN-MAMMALIAN PI TYPE PROTAMINES become the major sperm nuclear protein [47, 48, 52, 54], There are two basic groups of protamines in mammals; the PI protamines which have been found in all mammalian species that have been analyzed and the P2 protamines which have been found in humans [5, 8, 42, 79, 80] and a limited number of other mammals such as mouse, guinea pig and stallion [10, 59, 66], However, pro-P2 protamine genes have been sequenced from eight species of primates [66]. Both types of protamines contain cysteine which can form disulphide bonds and contribute to the stability of the condensed sperm nucleus. Bird protamines lack cysteine [13, 45, 49, 52] although they are clearly related to mammalian PI protamines as several identical amino acid sequence motifs are present in both cases. Because of the high variability of protamines and protamine genes it is very difficult at present to explain the evolution of these proteins within an entire phylum. In many cases the limited number of sequences available precludes their connection into a coherent evolutive pathway. Thus the focus in this review has been placed in the avian mammalian-mammalian PI type protamine for which a considerable amount of information is now available. Other papers and reviews cover other vertebrate or invertebrate groups ([4, 12, 13, 16, 25, 43, 49, 52, 60, 70, 71, 73], see also CHIVA, SAPERAS, CaCERES & AUSIO, this volume, and PRATS & CORNUDELLA, this volume). Protamine genes are a clear example of highly tissue-specific genes. However the mechanisms that direct their specific expression in the testis are not fully understood [18, 22, 50, 52, 80]. Thus the last section of this review covers the progress made in the understanding of the transcriptional control of the PI genes. RESULTS AND DISCUSSION Methodological approaches to protamine PI sequence determination: The methods initially available to sequence protamines were based on end group analysis, proteolytic digestion, isolation, sequencing, and overlapping of the protamine peptides. The presence of several arginine tracts in each protamine with very similar sequences made this approach technically difficult. The first reported avian-mammalian PI type complete sequences using these methods corresponded to bull [15; Table 1], Gallus domesticus [45] and boar [76]. Some discrepancies in the initial reported sequences were found when the corresponding protamines were re-examined by automated micro-sequencing or by cloning of the protamine cDNAs and genes [37, 49, 40]. Subsequently the use of automated protein micro-sequencing led to the determination of the sequences of human PI [41], stallion PI [2, 9], ram [71] and rabbit, goat and rat [3], Partial sequences corresponding to a few N-terminal residues have also been reported for many mammalian protamines [6] (Table 1). Simultaneously to the onset of the use of automated micro-sequencing, the methods of the cDNA synthesis, donning and sequencing were also developed and applied to protamine genes (Table 1). The first mammalian protamine cDNA sequence corresponded to mouse PI [29]. Since no probes were initially available to screen the cDNA library, this initial sequence was obtained by characterization of selected clones preferentially expressed in spermatids [28]. Subsequently, the use of the mouse PI cDNA clone as a probe led to the determination of the sequence of bovine protamine PI cDNA [35], Simultaneously, the bovine protamine PI cDNA sequence was also independently obtained using oligonucleotides designed from the previously known amino acid sequence [31], The mouse PI cDNA also led to the isolation of the boar protamine 1 cDNA [37] and rat PI cDNA [30], The bovine probe led to the isolation and sequencing of the human protamine PI cDNA [36]. However the mammalian probes would not recognize the avian protamine genes because of marked divergence in the nucleotide sequences between these species. Thus the cDNA sequence corresponding to rooster protamine was obtained by random sequencing of 210 clones from a rooster testis cDNA library until the sequence of one clone predicted an amino acid sequence similar to the previously reported at the protein level for galline [55]. The availability of a cDNA probe from galline led to the rapid isolation and sequencing of Source: ADVANCES IN SPERMATOZOAL PHYLOGENY AND TAXONOMY 539 1. — Chronological list of reports on protamine PI sequences with indication of the species and methods used for sequencing. Year Protamine scquence/s reported Method Reference 1972 Bull (Bos taurus) Protein sequencing [15] 1976 Galline (Gallus domesiicus) Protein sequencing [45] 1976 Rat -partial-(Rattus norvegicus) Protein sequencing [27] 1983 Boar (Swj scrofa) Protein sequencing [761 1984 Ram (Ovis dries) Protein sequencing [71| 1985 Human (Homo sapiens) Protein sequencing [41] 1985 Mouse (Mus musculus) cDNA [29] 1986 Bull (Bos taurus) (corrected) Protein sequencing [311 1987 Bull (Bos taurus) cDNA [31] 1987 Bull (Bos taurus) cDNA [35] 1987 Stallion (Equus caballus) Protein sequencing [9] 1987 Stallion (Equus caballus) Protein sequencing [2] 1987 Human (Homo sapiens) cDNA [36] 1988 Galline (Gallus domesticus) cDNA [55] 1988 Bull (Bos taurus) Genomic phage library 132] 1988 Mouse (Mus musculus) Genomic phage library [24] 1988 Mouse (Mus musculus) Protein sequencing [101 1988 Rabbit (Oryctolagus cuniculus) Protein sequencing [3] 1988 Goat (Capra hi reus) Protein sequencing [3] 1988 Rat (Rattus norvegicus) Protein sequencing [3] 1988 Boar (Sus scrofa) cDNA [37] 1989 Chicken (Gallus domesticus) Genomic cosmid library' [491 1989 Quail (Coturnix japonica) cDNA [53] 1989 Rat (Rattus norvegicus) cDNA [30] 1989 Wallaby (Cricetulus migratorius) Protein sequencing [7] 1989 Dwarf Hamster (Phodopus sungorus) Protein sequencing [6] 1989 Rhesus monkey -partial-(A/oazai mulatto) Protein sequencing [6] 1990 Human (Homo sapiens) Genomic cosmid library [18] 1991 Marmoset (Saguinus imperator) PCR with genomic DNA [63] 1992 Boar (Sus scrofa) Genomic phage library [26] 1993 Whale (Ore in us orca) PCR [I] 1993 Human (Mediterranean, Sudanese, Korean, American Indian) PCR [62] 1993 Rat -5'region-(Rattus norvegicus) PCR [64] 1993 Guinea pig -5Tegion-(G?v/a porcellus) PCR [64] 1993 Gorilla -5'region-(Gorilla gorilla) PCR [64] 1993 Orangutan -5'region-(Pongo pygmaeus) PCR [64J 1993 Anubis baboon -5 region-(Papio doguera) PCR [64] 1993 Red monkey -5'region- (Cercopithecus patas) PCR [64] 1993 Opossum (Didelphis marsupialis) PCR [78] 1993 Common chimpanzee (Pan troglodites) PCR [68] 1993 Pygmy chimpanzee (Pan paniscus) PCR [68] 1993 Gorilla (Gorilla gorilla) PCR [68] 1993 Orangutan (Pongo pvgmaeus) PCR [68] 1993 Gibbon (Hvlobates lar) PCR [68] 1993 Red monkey (Cercopithecus patas) PCR [68] 1993 Marmoset (Saguinus imperator) PCR [68] 1993 Red howler (Alouatta seniculus) PCR [68] 1993 Platypus (Ornithorincus anatinus) PCR [67] 1993 Echidna (Tachvglossus aculeatus) PCR [67] 1994 Rat (Rattus nowegicus) PCR [61] 1994 Guinea pig (Cavia porcellus) PCR [61] 1994 Cat (Felis cat us) PCR [61] 1994 Bear (Ursus americanus) PCR [61] 1994 Elephant (Elephas) PCR [61] 1994 Horse (Equus caballus) PCR [61] 1994 Camel (Camelus dromedarius) PCR [61] 1994 Deer (Odocoideus virginianus) PCR [61] 1994 Elk (Cervus elaplius) PCR [61] 1994 Moose (Alces alces) PCR [61] 1994 Gazelle (Gazella dorca) PCR [61] 540 R. OLIVA : AVIAN-MAMMALIAN PI TYPE PROTAMINES another avian protamine, the quail (Coturnix japonica) [53], as well as to the isolation and sequencing of the chicken genomic clones [49]. The same approach using cDNA as probes to screen genomic libraries was also followed to obtain the genomic sequences corresponding to bull PI [32], mouse PI [24], human PI [18] and boar PI [26] (Table 1). The availability of probes for all these genes also led to the determination of their copy number which proved to be one copy per haploid genome for PI protamines in mammals, two identical genes (coding region) per haploid genome in Gallus domesticus, and one copy of P2 per haploid genome in mammals. This indicated that the numerous basic protamine type molecules present in the sperm nucleus [PI, P2, P3, P4 and others] of mammals corresponded only to two types of protamines [PI and P2]. The PI genes are located adjacent to other spermatid-specific genes in the mammalian genome [19, 34, 46], As some mammalian protamine genes were sequenced by independent laboratories, some minor discrepancies in the reported sequences also emerged, such as in the bull genes [31, 35] and between the human PI sequence initially reported [18] with that subsequently redetermined in several independent individuals [62], The availability of the PI genomic sequences from human, bull, mouse and boar allowed their comparison in a search for conserved flanking sequences from which to design consensus oligonucleotides. This approach proved to be extremely efficient leading to the isolation and sequencing of the Saguinus imperator PI protamine [63], Orcinus orca PI [1], and subsequently several primates (common chimpanzee, pygmy chimpanzee, gorilla, orangutan, gibbon, Cercopithecus patas, Alouatta seniculus) [68], several human individuals (Mediterranean, Korean, Sudanese, American Indian) [62], additional eutherian mammals (rat, guinea pig, cat bear, elephant, horse, camel, deer, elk moose, gazelle) [61] and the monotremes, platypus and echidna [67]. The determination of a Wallaby partial amino acid sequence [7] by protein micro¬ sequencing led to the sequencing of the opossum protamine PI [77, 78]. A similar PCR-based approach was followed to amplify and sequence the promoter region of the rat, guinea pig, gorilla, orangutan, anubis baboon and red monkey [64]. Although PCR from genomic DNA is a very valuable tool in the amplification and sequencing of new protamine genes it does not provide information on whether the sequenced genes are expressed or not (for instance, if a sequenced gene is a pseudogene). In the case of PI genes, the fact that all mammalian species where the sperm nuclear protein content has been analyzed contain protamine PI together with the single copy number of the PI genes in mammals, suggests that most (if not all) of the mammalian species whose PI sequence has been determined by PCR also express the sequenced gene. However this could be a limitation in the prediction of functional properties based on the derived amino acid sequence in the case of those proteins (such as P2 protamine) which are not ubiquitously expressed in mammals [66]. The availability, at present, of a large number of PI sequences should allow design of new primers with which to amplify and sequence the PI genes corresponding to species which have remained so far elusive. In the case of the P1 genes the PCR approach has been successful in the amplification of sequences corresponding to members of the class from which the oligos were predicted (e.g. mammals), but failed in the amplification of the PI genes corresponding to other classes (e.g. reptiles or amphibians). Thus determination of the sequences of protamine genes in other vertebrate classes (or in other phyla) will probably require laborious groundwork based on either protein micro-sequencing (followed by oligonucleotide design and PCR) or cDNA based approaches [29, 55]. However once one or a few nucleotide sequences became available in the additional phyla and classes [4, see PRATS & CORNUDELLA, this volume], the same PCR-based approach successlully used in mammalian-avian Pis should also work in the determination of protamine sequences corresponding to most of the members of other classes. Source: ADVANCES IN SPERMATOZOAL PHYLOGENY AND TAXONOMY 541 10 20 40 40 50 60 Bull ARYRCCLTH- -SGSRCRRRRRRRCRRRRRR-FG-RRRRRR-VCCRR-YTVIRCTRQ Goat ARYRCCLTH- -SRSRCRRRRRRRCRRRRRR-FG-RRRRRR-VCCRR-YTWRCTRQ Ram ARYRCCLTH- - SRSRCRRRRRRRCRRRRRR-FG-RRRRRR-VCCRR-YTWRCTRQ Orca ARNRC-RSP—SQSRCRRPRRR-CRR-RIR-CC-RRQ-RR-VCCRR-YTTTRCARQ Boar ARYRCCRSH-- SRSRCRPRRRR-CRRRRRR-CC-PRR-RRA- - VCCRR-YTVIRCRRC Horse ARYRCCRSQ—SQSRCRRRRRRRCRRRRRR-SV-R-Q-RR- - -VSCRR- - - YTVLRCRRRR Mouse ARYRCCRSK- -SRSRCRRRRR-RCRRRRRR-CC-R-RRRR-RCCRRRRSYT- IRCKKY Rat ARYRCCRSK—SRSRCRRRRR-RCRRRRRR-CC-R-RRRR—-RCCRRRRSYT-FRCKRY Rabbit VRYRCCRSQ--SRSRCRRRRR-RCRRRRRR-CC-QRRRVR-KCCRR—TYT-LRCRRY Pygmy chimp ARYRCCRSQ—SRSRCYRQRR—SRRRKRQ- SC-QTQRRAM- - RCCRRR— SR- LRRRRH Common chimp ARYRCCRSQ—SRSRCYRQRQ-RSRRRKRQ-SC-QTQRRAM--RCCRRR--SR-MRRRRH Gorilla ARYRCCRSQ—SRSRCYRQRQ-TSRRRRRR-SC-QTQRRAM--RCCRRR—NR-LRRRKH Human ARYRCCRSQ—SRSRYYRQRQ-RSRRRRRR-SC-QTRRRAM— RCCRPR—YR- PRCRRH Orangutan ARYRCCRSQ—SQSRCCRRRQ-RCHRRRRR-CC-QTRRRAM—RCCRRR—YR-LRCRRH Red monkey ARYRCCRSQ—SRSRCCRQRR-RCRRRRRR-RC-RARRRAM—KCCRRR—YR-LRCRRY Gibbon ARYRCCRSQ - - SRSRCYRRGQ - RSRRRRRR- SC-QTRRRAM--RCCRPR--YR-LRRRRH Red howler ARYRCCRSRSLSRSRCYRQRP- RCRRRRRR- SC-RRP-RAS--RCCRRR—YR-LRRRRY Marmoset ARYRCCRSQ - - SRSRCYRQRR-RGRRRRRR-TC-RRR-RAS--RCCRRR--YK-LTCRRY Opossum ARYRR- RSRSRSRSRYGRRRRR- SRSRRRR- SRRRRRRRG-RRG- - RGYHRRS PHRRRRRRRR Echidna ARFRPSRSR—SRSLYRRRRR— SRRQRSRRGGRQTGPRKITRRGRGRGKSRRRRGRRSMRSSRRRRRRRRN Platypus ARFRRSRSR—SRSLYRRRRR—SRR-GGRQTRSRKLSR- SRRRGRSRRRKGRRSRRSSRRS—RRRN Chicken ARYRRSRTR- - SRS PRSRRRRRRSGRRR-SPRRRRRYGSARRSRRSVGGRRRR-YGSRRRRRRRY Quail ARYRRTRTR—SRSR-RRRRSRRRR-SSRR-RRYGRSRRSYRSVGRRRRR-YGRRRRRRRRY Fig. 1. — Alignment of the reported avian-mammalian PI amino acid sequences (see Table 1). Implications for protamine PI gene evolution The coincidence of the four C-terminal amino acids between mammalian Pis and galline (the protamine from Gallus domesticus) has been known for nearly two decades [45]. However, because of the lack of cysteine residues in bird protamines and the presence of these amino acids in mammalian protamines, both types of protamines had been classically classified as belonging to different types. According to Bloch’s classification, galline was type 1 (or a true protamine) whereas mammalian protamines were type 2 (stable or keratinous protamines). The similarity between mammalian and rooster protamine became stronger when the sequence predicted from the genome (and in accordance with the re-sequence obtained for the N-terminus of the protein) [49]; (Fig. 1) was used instead of the initial sequence reported [45]. For instance, the single threonine residue present in galline occupies exactly the same position as that present in ram and bull [52] (Fig. 1). The determination of the quail protamine sequence [53] also revealed the presence of the N-terminal ARYR motif and a size (56 residues) closer to mammalian Pis (50 residues) than those with galline (61 residues; Fig. 1). An alternating triple phosphorylatable site (T/S-S-S) is also found at positions 9-15 in all avian-mammalian PI protamines (Figs 1, 2) [6, 20, 52, 57, 58]. The size among bird protamines appears consistently similar to that of mammals (Fig. 1) [13, 14]. Altogether the data strongly suggest the existence of an avian-mammalian protamine gene line during evolution (Fig. 2). A new insight has come form the recent determination of the sequence corresponding to the prototherian (the monotremes platypus and echidna) [67] and the metatherian protamines (the marsupials) [7, 69, 77, 78]. All these sequences lack cysteine and the corresponding genes contain one intron. Thus these species are closer to birds according to their lack of cysteine but closer to eutherian mammals according to the presence of the single intron. Detailed phylogenetic analysis indicates that these sequences are half way between eutherian mammals and birds [7, 49, 67, 77, 78]. Based on the limited (but significant) similarity in the introns between prototherian 542 R. OLIVA : AVIAN-MAMMALIAN PI TYPE PROTAMINES N-TERMINUS ARYR ARYR ARFR ARYR T/S - S - S (9-15) YES YES YES YES INTRON YES YES YES NO CYSTEINES YES NO NO NO Fig. 2. — Possible pathway of mammalian-avian protamine PI gene evolution. and eutherian mammals it was concluded that the introns in the protamine PI genes of monotremes, marsupials and eutherian mammals were derived from a single intron that was probably inserted into the ancestral gene prior to the divergence of the theria and prototheria 150 to 170 million years ago [67] ( Fig. 2). The comparison of all protein and DNA sequences further strengthens the idea that protamines are amongst the most rapidly diverging proteins studied [68]. This variation may allow discrimination of closely related species or even individuals in some cases. For instance, a sequence polymorphism has been found in the human PI gene [62], Molecular analysis of the PI genes from nine primates revealed that within primates the rate of evolutionary change is much higher than that within other mammalian orders [68]. Interestingly, the primate PI data confirm that human-gorilla-chimpanzee PI protamines are indeed very similar but, unlike the slightly closer association between chimpanzee and human derived from analysis of other genes [66], the human-gorilla relationship is slightly favoured in the case of the PI genes [68], Overall phylogenetic analysis of all PI sequences (Table 1) indicates that the molecular evolution of PI genes is in agreement with the expected species evolution supporting that these genes have evolved vertically [61, 83] (Fig. 2). Source. MNHN. Pans ADVANCES IN SPERMATOZOAL PHYLOGENY AND TAXONOMY 543 -150 *140 -130 -110 -100 CCCTCCCT-- --CACCAAGCACCTCCCACATGC XAIATATGG ICATGATTTGGGCAG-CTCTGACCCT C•CTCCCT-CACAAGGC-CCTCCCACAIGC ICATATAIGG iCACGAIGCAGGCCGACT C T GGCCCT TACACTCGGGGGC-CTGCCCGCCTCTCAAATGC XATATATGG tCATGATGCAGGCC- AC -CTGGC- AT TACACTCGGGGGC-CTGCCCTCCCCTCACATGC XAIATATGG ICATGATGTAGGCC- AC-CTGGC- AT TACACTCAGGGGC-CTGCCCACCCCTCACATGC XATATATGG ICA T GA T GCAGGCC•AC-CT GGC-AT TACACTCGGGGGC-CTACCCACCCCTCACATGC XATAIATGG ICATGATGCAGGCC- AC -CTGGCCAT TACTICTAGGGGC-CTTCCCGCCCCTCACAIGC ICATAIAIGG tCATGATGCAGGCC•AC -CTGGC- AT GA-CAAAG-CCCTGCCCACCCCTCTCATGC XATATTTGG tCATGGTACAGGTCCTCACTGGCCAT GA-TGCCAAAG-CCCTGCCCA--CCTCTCATGC XATATTTGQ ICATGGTACAGGTCCTCACTGGACAT AAGTGG.CTCTTGCCAT b ProtIC TATA SR* ProtIC TATA ATG -70 -50 -40 CTGGG-TCTCT GACCTCACAAT iACCAGGACCCTGCCCGGGTC lAGGCCG CTAGG-CCTCT±iG ACCTCACAAT iACCAGGGCCCTCCCCGCGTC AGGCCC CC-AG-CCCCTT r GCCCTCACAAT iACC AACGGCCCCC T GGC A T C AT AGGCCG CC-AG-CCCCT GCCCTCACAATitA, CCAACGGCCTCCTGGCATCT ATAAfci.A ACCTG CC-AG-CCCCTTr GCCCTCACAAT jACCAACGGCCCCCTGGCATCr.A T. AGGCCG CCCAG-CCCCTTT GCCCTCACAATl;A CCAACAGCCTCCTGGCATCT iAGGCTG CCCAG-CCCCT t»gccctcacaat;jA CCAACGGCCCCC T GGCG T CT iAGGCCG CCTGGTCCTCTTT GACTTCATAATT CCTAGGGGCCA-CTAGTAT AGGAAG CCTGGTCCTCTTr GACTTCATAATT CCCAGGGGCCA-CTAGTAT iAGGAAG CCGGG TCACCTCACAAT 13 TCCTGGGMGTCCTGGGTT iAGGCCA ttggtcctggtcacctcacaa -10 *1 *10 *20 *30 *40 GGAAGTCGGC-CCCTG--TCACAGCCCACAAA-TTCCACCTGCTCACAGGTTGGCTGGCTCAACCAAG AGCAGTCAGC--CCCTGGCACACAGCCTCCAAAGTTCCACCTGCTCACAGGTTGGCTGGCTCAACCAAG CAGAGCTGGC--CCCTGACTCACAGCCCACAGAGTTCCACCTGCTCACAGGTTGGCTGGCTCAGCCAAG CAGAGCTGGA-•CCCTGAC T CACAGCCCACAGAGT TCCACC TGCTCACAGG T TGGCTGGCTCAGCCAAG CAGAGCTGG---CCCTGACTCACAGCCCACAGAGTTCCACCTGCTCACAGGTTGGCTGGCTTAGCCAAG CACAGCTGGC-(cid:9632)CCC T GAC TCACAGCCCACAGAGT T CCACCTGC T CACAGGT T GGCTGGCTCAGCCAAG CAGAGCTGG-- CCCTGACTCACAGCCCACAGAGTTCCACCTGCTCACAGGTTGGCTGGCTCAGC-AAG AGGG T GC T GGC T CCCAGGC-CACAGCCCACAAAAT T CCACC TGC T CACAGGTT GGC TGGCT CGACCCAG AGGGTGCTGGCTCTCCAGC-CACAGCCCACAAAATTCCACCTGCTCACAGGTTGGCTGGCTCGACCCAG -AGAGCTCGG-*CCCTGGCTCACAGCCAACAAAGTTCCACCTCCTCACAGGTTGGCTGGCTCAGCTGAA • • • ••**• •••• • •••• •••• (cid:9632) • •60 *70 *80 *90 f GCGGTATCCCCTGCTCTGAGCAT--CC-AGGCCGAATCCACCCAGCACCATGGCCAG BULL GCGGTATCCCCTGCTCTGAGCAT- -CA-AGACTGAGTCCA T CCATCACCATGGCCAG BOAR GTGGTG--CCCTGCTCTGAGCAT- -TC-AG-CCAAGCCCATCCTGCACCATGGCCAG HUHAN GTGGTG--CCCTGCTCTGAGCAT--TC-AG-CCAAGCCCATCCTGCACCATGGCCAG REO HONKET GTGGTG*-CCC TGC TC T GAGCAT-•T C- A G GCCGAGCC CATCC T GCACCA T GGCCAG GORILLA GTGGTG--CCCTGCTCTGAGCAT--TC-AGGCCAAGCCCATCCCGCACCATGGCCAG BA6COW GTGGTG--•TCTGCTCTGAGCAT--TC-AGGCCAAGTC-•ATCTGCACCATGGCCAG ORANGUTAN GTGGTGTCCCCTGCTCTGAGCCA--GC--•TCCCGGCCAAGCCAGCACCATGGCCAG HC«JSE GTGGTGCCCCCTGCTCTGAGCCA--GC---TCCCGGCCAAGCTAGCACCATGGCCAG RAT GTGGTGCTCTCTGTTCTGAGCCAAGTCTAGGCCAAGTTCATCTAGTGCCATGGCCAG GUINEA PIG • •• • • •• •••• ••• • Fig. 3. — a: Alignments of all available mammalian PI gene promoter sequences. An asterisk indicates that a position is conserved in all species. The nt positions are referenced relative to the tsp [+1]. The conserved SRE, “TGTGAGG”, ProtIC and the TATA box are boxed. The arrow over the ProtIC indicates the sequence which is palindromic with the “TGTGAGG” sequence (also arrowed) The start codon (ATG) is indicated by a downward arrow. After [64]. b: Position of the ProtIC, SRE and “TGTGAGG" sequences present in the PI genes and position of ProtlC-like sequences present in other testis-expressed genes. The putative tsp is indicated [+1]. The numbered open boxes indicate the position of sequences identical or similar to ProtIC\ The number in the open box indicates the number of matches to the 12mer ProtIC [thus, 12 indicates a perfect match]. The beginning of the coding region is shown by the unnumbered solid boxes 3’ to the tsp. A broken line indicates that the sequence is not available. The SRE is indicated by the two connected arrows facing each other. The “TGTGAGG” sequence is showed by a shaded box and the position and presence of a TATA box is indicated by the ellipse. After [64]. Transcriptional regulation of protamine PI genes Transcription of the avian-mammalian PI type genes occurs in the post-meiotic, haploid stages of spermatogenesis as determined by Northern blot analysis of RNA from testis at different stages of development or from sorted cells [17, 35, 52, 55], and by in situ hybridization [35, 38, 44, 55]. Run-off assays on isolated mouse nuclei indicate that the mouse PI gene is activated at the round spermatid stage [39], What are the mechanisms leading to this specific activation? The availability of the nucleotide sequences from mouse, human and bull led to the prediction of some potential regulatory elements. For instance a TATA box is present in all of them [18, 24, 32], a 544 R. OLIVA : AVIAN-MAMMALIAN PI TYPE PROTAMINES CRE-like element [50], CAT box, CG boxes and additional sequences [18, 24, 32, 50, 52], A different approach in the prediction of potentially important sequences has been the comparison of homologous or heterologous protamine genes in the search for the conserved regions with the assumption that important regulatory sequences would have been conserved in evolution [50]. Thus the following comparisons were reported: mouse PI and P2 genes [24]; human, bull and mouse PI genes [33]; human PI and P2 genes, mouse PI, bull PI and human PI [18]; porcine genes [26]; and chicken, bull PI, mouse PI and trout protamine [50]. A common problem in all the studies comparing protamine gene PI sequences was that the homology between the different PI genes available for analysis was relatively high so that discrimination between conserved regulatory sites and sites conserved simply because of a close origin in evolution was not possible in many cases. This problem was solved when the promoter region of additional PI genes was sequenced thus increasing the total number of sequences available for comparison [64] (Fig. 3). Four highly conserved sites were detected in the 5'region (-160 to -1) of the protamine genes [64]. The first one (-29 to -35) corresponds to the already previously described TATA box, but with the novelty of being preceded invariably in all species by the di-nucleotide TC (Fig. 3). The second conserved region (-55 to -66) was named Protamine 1 Consensus (ProtlC) which is a CRE-like sequence (but always differently). The relevance of this conserved element in the expression of the P1 genes is strongly supported by the demonstration of a mouse testis trans¬ acting factor ([75], Tet-1) which binds and matches in the mouse the first 11 bp of the corresponding ProtlC sequence. Independent experiments using different oligonucleotides corresponding to the mouse PI 5' region [82] showed that the region -35 to -70 led to the appearance of three different specific bands in gel retardation assays upon incubation with nuclear extracts from different tissues. Only one of those bands was testis-specific. Similar results have been obtained with the rat PI sequence using rat nuclear extracts [65], The third highly conserved region detected in the 5'of all PI genes corresponds to the sequence TGTGAGG (-88 to -82). This sequence is a palindrome of the seven central nt of ProtlC (binding sequence for factor Tetl in the mouse) and is exclusively present in this region in all PI genes whose sequence is available suggesting an important function in the differential expression of the protamine PI genes. This region corresponds to box E in the mouse promoter [24]. The fourth highly conserved region corresponds to MATGCCCATATWTGGRCAYG and has the typical structure of serum response elements (SRE) [64]. This region demonstrates specific interaction with a factor present in rat nuclear extracts from different tissues with a distinctive shifted band appearing in the testis extracts [65]. Also the equivalent region in the mouse PI gene (described as Box O) demonstrates specific binding with a factor present in mouse nuclear extracts. Thus two highly conserved sequences, the ProtlC (also referred as to CRE-like in all PI sequences or Tetl binding site in the mouse), and the SRE appear to bind a testis specific factor or a testis-specific combination of factors [65]. Both of these sequences lie within the minimal region (from bp -150 to bp -37) described to direct spermatid-specific expression with a heterologous promoter from a human growth hormone reporter gene [56, 81, 82]. ACKNOWLEDGEMENTS: This work was supported with grants from the “Fondo de Investigaciones Sanitarias” (FIS93/0670) from Spain, and from the Direccion General de Investigation Cientffica y Tecnica (DGICYT PB92-0810). REFERENCES 1. Adroer, R., Queralt, R., Ballabriga, J. & Oliva, R., 1992. — Nucleotide sequence of the protamine PI gene from the whale Orcinus orca predicts a unique N-terminal amino-acid motif. Nucleic Acids Research, 20: 609. 2. Ammer, H. & Henschen, A., 1987. — The major protamine from stallion sperm. Isolation and amino acid sequence. Biological Chemistry Hoppe Seyler, 368: 1619-1626. 3. Ammer, H. & Henschen, A., 1988. — Primary structure of rabbit sperm protamine, the first protamine of its type with an aberrant N-terminal. FEBS Letters, 242: 111-116 Source: MNHN. Paris ADVANCES IN SPERMATOZOAL PHYLOGENY AND TAXONOMY 545 4. Ariyoshi, N., Hiyoshi, H., Katagiri, C. H. & Ab£, S.I., 1994. — cDNA cloning and expression of Xenopus sperm- specific basic nuclear proteins [SP5] gene. Molecular Reproduction and Developmental: 363-369. 5. Arkhis, A., Martinage, A., Sauti£re, P. & Chevaillier, P., 1991. — Molecular structure of human protamine P4 (HP4), a minor basic protein of human sperm nuclei. European Journal of Biochemistry, 200: 387-392. 6. Balhorn, R., 1989. — Mammalian protamines: structure and molecular interactions. In: K. W. Adolph, Molecular Biology of Chromosome Function. New York, Springer Verlag: 366-395. 7. Balhorn, R., Corzett, M., Mazrimas, J. A., Cummins, J. & Fadem, B., 1989. — Analysis of protamines isolated from two marsupials, the ring-tailed wallaby and gray short-tailed opossum. Journal of Cell Biology, 107: 167a. 8. Balhorn, R., Reed, S. & Tanphaichitr, 1988. — Aberrant protamine 1 / protamine 2 ratios in sperm of infertile human males. Experientia, 44: 52-55. 9. B£laiche, D., Loir, M., Kruggle, W. & Sauti£re, P., 1987. — Isolation and characterization of two protamines Stl and St2 from stallion spermatozoa, and amino-acid sequence of the major protamine Stl. Biochimica et Biophysica Acta, 913: 145-149. 10. Bellv£, A. R., McKay, D. J., Renaux, B. S. & Dixon, G. H., 1988. — Purification and characterization of mouse protamine PI and P2. Amino acid sequence of P2. Biochemistry, 27: 2890-2897. 1 1. BLOCH, D. P., 1969. — A catalog of sperm proteins. Genetics Supplement, 61:93. 12. Caceres, C., Ribes, E., Muller, S., Cornudella, L. & Chiva, M., 1994. — Characterization of chromatin- condensing proteins during spermiogenesis in a neogaslropod mollusc [Murex brandaris]. Molecular Reproduction and Development, 38: 440-452. 13. Chiva, M., Kasinsky, H. E., Mann, M. & Subirana, J. A., 1988. — On the diversity of sperm basic proteins in vertebrates: VI Cytochemical and biochemical analysis in birds. Journal of Experimental Zoology 354: 404- 317. 14. Chiva, M., Kasinsky, H.E. & Subirana, J. A., 1987. — Characterization of the protamines from four avian species. FEBS Letters, 215; 327-240. 15. COELINGH, J. P., MONFOORT, C. H., ROZIJN, T. H., LEUVEN, J. A. G., SCHIPHOF, R., STEYEN-PARVE, E. P.. BRAUNITZER, G., Schrank , B. & Ruhfus, A., 1972. — The complete amino acid sequence of the basic nuclear protein of bull spermatozoa Biochimica et Biophysica Acta, 285: 1-14 16. Dixon, G. H., Aiken, J. M., Jankowsky, J. M., McKenzie, D. I., Moir, R. & States, J. C., 1985. — Organization and evolution of protamine genes of salmonid fishes. In: G. R. Reek, G. H. Goodwin, & P. Puigdomenech, Chromosomal Proteins and Gene Expression. New York, Plenum Press: 287-314. 17. Domenjoud, L., Kremling, H., Burfeid, P., Maier, W. M. & Engel, W. 1991. — On the expression of protamine genes in the testis of man and other mammals. Andrologia, 23: 333-337. 18. Domenjoud, L., Nussbaum, G., Adham, I. M., Greeske, G. & Engel, W., 1990. — Genomic sequences of Human protamines whose genes, PRM1 and PRM2, are clustered. Genomics, 8: 127-133. 19. Engel, W., Keime, S., Kremling, H., Hameister, H. & SchlOter, G., 1992. — The genes for protamine 1 and 2 (PRM1 and PMR2) and transition protein 2 (TNP2) are closclly linked in the mammalian genome. Cytogenetics and Cell Genetics, 61: 158-159. 20. Green, G. R., Balhorn, R., Poccia, D. L. & Hecht, N. B., 1994. — Synthesis and processing of mammalian protamines and transition proteins. Molecular Reproduction and Development. 37: 255-263. 21. Hecht, N. B., 1989. — Molecular biology of structural proteins of the mammalian testis. In: K.W. Adolph, Molecular Biology of Chromosome Function. New York, Springer Verlag: 396-420. 22. Hecht, N. B., 1990. — Regulation of haploid expressed genes in male germ cells. Journal of Reproduction and Fertilization, 88: 679-693. 23. Hecht, N. B., 1993. — Gene expression during male germ cell development. In: C. Desjardins & L. L. Ewing, Cell and Molecular Biology of the Testis. New York, Oxford University Press. 24. Johnson, P. A., Peschon, J. J., Yelick, P. C., Palmiter, R. D. & Hecht, N. B., 1988. — Sequence homologies in the mouse protamine 1 and 2 genes. Biochimica et Biophysica Acta, 950: 45-53. 25. Kasinsky, H. E., 1989. — Specificity and distribution of sperm basic proteins. In: L. S. Hnilica, G. S. Stein & J. L. STEIN, Histones and Other Basic Nuclear Proteins. Boca Raton, Florida, CRC Press: 73-163. 26. Keime, S., Heitland, K., Klum, S., SchlOsser, M., Hroch, N., Holtz, W. & Engel, W. 1992. — Characterization of four genes encoding basic proteins of the porcine spermatid nucleus and close linkage of three of them. Biological Chemistry Hoppe-Seyler, 373: 261-270. 27. Kistler, W. S., Keim, P. S., & Anderson, R. L., 1976. — Partial structural analysis of the basic chromosomal protein of rat spermatozoa. Biochimica et Biophysica Acta, 427: 752-757. Source: MNHN. Paris 546 R. OLIVA : AVIAN-MAMMALIAN PI TYPE PROTAMINES 28. Kleene, K. C„ Distel, R. D. & Hecht, N. B., 1983. — cDNA clones encoding cytoplasmic poly(A)+ RNAs which first appear at detectable levels in haploid phases of spermatogenesis in the mouse. Developmental Biology, 98: 455-464. 29. Kleene, K. C., Distel, R. J. & Hecht. N. B., 1985. — Nucleotide sequences of a cDNA clone encoding mouse protamine 1. Biochemistry, 24: 719-722. 30. Klemm, U., Lee, C.H., Burfeind, P., Hake, S. & Engel, W., 1989. — Nucleotide sequence of a cDNA encoding rat protamine and the haploid expression of the gene during rat spermatogenesis. Biological Chemistry Hoppe- Seyler, 370: 293-401 31. Krawetz, S. A., Connor, W. & Dixon, G. H., 1987. — Cloning of the bovine PI protamine cDNA and the evolution of vertebrate protamines. DNA, 6: 47-57. 32. Krawetz, S. A., Connor, W. & Dixon, G. H.. 1988. — Bovine protamine genes contain a single intron. The structures of the two alleles. Journal of Biological Chemistry, 263: 321-326. 33. Krawetz, S. A & Dixon, G. H., 1988. — Sequence similarities of the protamine genes: implications for regulation and evolution. Journal of Molecular Evolution, 27:291-297. 34. Krawetz, S. A., Herfort, M. H., Hamerton, J. L., Pon, R. T. & Dixon, G. H., 1989. — Chromosomal localization and structure of the human PI protamine gene. Genomics, 5: 639-645. 35. Lee, C. H., Bartels, I. & Engel, W., 1987. — Haploid expression of a protamine gene during bovine spermatogenesis. Biological Chemistry Hoppe-Seyler, 368: 807-811. 36. Lee, C. H., Hoyer-Fender, S. & Engel, W., 1987. — The nucleotide sequence of a human protamine 1 cDNA. Nucleic Acids Research, 15: 7639. 37. Maier, W. M., Adham, I., Klemm, U. & Engel, W., 1988. — The nucleotide sequence of boar protamine 1 cDNA. Nucleic Acids Research, 16: 11826. 38. Mali, P., Sandberg, M., Vuorio, E., Yelick, P. C., Hecht, N. B. & Parvinen, M., 1988. — Localization of protamine PI mRNA in the different stages of the cycle of the rat seminiferous epithelium. Journal of Cell Biology, 107: 407-412. 39. Matsumoto, M., Kurata, S., Fujimoto, H. & Hoshi, M., 1993. — Haploid specific activations of protamine 1 and hsc70t genes in mouse spermatogenesis. Biochimica el Biophysica Acta, 1174: 274-278. 40. Mazrimas, J.A., Corzett, M., Campos, C., & Balhorn, R., 1986. — A corrected primary sequence for bull protamine. Biochimica et Biophysica Acta, 812: 11-15. 41. McKay, D. J., Renaux, B. S. & Dixon, G. H., 1985. — The amino acid sequence of human sperm protamine PI. Bioscience Reports, 5: 383-391. 42. McKay, D. J., Renaux, B. S. & Dixon, G. H., 1986. — Human sperm protamines. Amino acid sequences of two forms of protamine 2. European Journal of Biochemistry, 156: 5-8. 43. Mezquita, C., 1985. — Chromatin proteins and chromatin structure in spermatogenesis. In: G. R. Reek, G. H. Goodwin, & P. Puigdomenech, Chromosomal Proteins and Gene Expression. New York, Plenum Press: 315- 332. 44. Morales, C. R.. Kwon, Y. K. & Hecht, N. B., 1991. — Cytoplasmic localization during storage and translation of the mRNAs of transition protein 1 and protamine 1, two translationally regulated transcripts of the mammalian testis. Journal of Cell Science, 100: 119-131. 45. Nakano, M., Tobita, T., & Ando, T., 1976. — Studies on a protamine (galline) from fowl sperm. 3. The total amino acid sequence of the intact galline molecules. International Journal of Peptide and Protein Research, 8: 565-578. 46. Nelson, J. E. & Krawetz, S. A., 1993. — Linkage of human spermatid-specific basic nuclear protein genes. Definition and evolution of the PI-P2-TP2 locus. Journal of Biological Chemistry, 268: 2932-2936. 47. Oliva, R., Bazett-Jones, D. P., Locklear, L. and Dixon, G. H., 1990. — Histone hyperacetylation can induce unfolding of the nucleosome core particle. Nucleic Acids Research, 188: 2739-2747. 48. Oliva, R., Bazett-Jones, D., Mezquita, C. & Dixon, G. H., 1987. — Factors affecting nucleosome disassembly by protamines in vitro. Histone hyperacetylation, time dependency and the size of the sperm nuclear proteins. Journal of Biological Chemistry', 262: 17016-17035. 49. Oliva, R. & Dixon, G. H., 1989. — Chicken protamine genes are intronless. The complete genomic sequence and organization of the two loci. Journal of Biological Chemistry, 264: 12472-12481. 50. Oliva, R. & Dixon, G. H., 1990. — Vertebrate protamine gene evolution I. Sequence alignments and gene structure. Journal of Molecular Evolution, 40: 333-346. 5 1. Oliva, R. & Dixon, G. H„ 1991. — Expression and processing of the rooster protamine mRNA. Annals of the New York Academy of Sciences, 637: 289-299. Source. MNHN, Paris

See more

The list of books you might like