loading

Logout succeed

Logout succeed. See you again!

ebook img

A cryptic new Potamanaxas (Hesperiidae: Pyrginae: Erynnini) stands out by terminally elongated genitalic valvae PDF

release year2015
file size6.2 MB
languageEnglish

Preview A cryptic new Potamanaxas (Hesperiidae: Pyrginae: Erynnini) stands out by terminally elongated genitalic valvae

The Journal Volume 48: 13-20 of Research on the Lepidoptera ISSN 0022-4324 (i‘rint) I HE LEPIDOPTERA RESEARCH FOUNDATION, 2 May2015 ISSN 2I5(k^>457 (onuni:) A cryptic new Potamanaxas (Hesperiidae: Pyrginae: Erynnini) stands out by terminally elongated genitalic valvae Nick V. Grishin', Daniel H. Janzen’ and Winnie Hallwachs'^ ‘Howard Hughes Medical Institute and Departments of Biophysics and Biochemistiy, University of Texas Southwestern Medical Center, 5323 Harry Hines Blvd, Dallas, TX, USA 75390-9050 -Department of Biology, University of Pennsylvania, Philadelphia, PA 19104 [email protected], [email protected], [email protected] Abstract. Polamanaxas louLsghilliGrishin, sp. nov. is described from Area de Consei-vacion Guanacaste (ACG) in northwestern Costa Rica. Superficially, this species resembles several other Potamanaxas taxa with entire pale discal bands on the wings, but is distingtiished from them by a row of faint postdiscal forewing spots (not streaks), terminally elongated genitalic valvae, and distinctive GOI DNA barcodes. Found feeding on rain forest epiphytic Cavendishia axillaris and Psammisia ramijlora, the new species is likely to be host-specific to rain forest epiphytic Ericaceae, which are the food plants of all other known species of ACG Potamanaxas as well. Key words: cryptic species, biodiversity, caterpillars, skipper butterflies, genitalia. Area de Conservacion Guanacaste, Costa Rica. Introduction useful for flushing out rarely collected species. Because most of the specimens have been reared from wild-caught caterpillars, knowledge of their Potamanaxas]Jind?>ey, 1925 (Hesperiidae: Pyrginae: traits, food plants, ecology, etc., greatly augments the Erynnini) is “a compact genus” (Evans, 1953) consisting usual data from adult morphology. Moreover, short of phylogenetically close relatives, characterized by pale sequences (ca. 658 bp) of mitochondrial DNA coding discal bands on both wings, frequently disjointed into for the G-terminal segment of cytochrome c oxidase spots, and genitalic tufts of hair-like scales at the bases of subunit 1 (GOI), and dubbed “DNA barcodes”, are the male valvae (Grishin, 2013c). After recent taxonomic routinely obtained for many specimens (Janzen et changes and description of several new species (Grishin, ai, 2011), adding molecular characters to those of 2013a-f), Potamanaxas currently includes 28 species morphology and biology. These DNA barcodes have (Warren et ai, 2014) and this number is likely to change been remarkable flags, both indicating possible new upon further research. Some Potamanaxas species are species, and identifying recognized species (Hebert quite rare in collections, resulting in small series of et ai, 2004; Burns 8c Janzen, 2005;Janzen et ai, 2009; many taxa (e.g.. Bell, 1956). 2011; 2012; Burns et al, 2008; 2010; 2013; Grishin et The species-rich specimens from a long-term ai, 2013a, b; 2014a, b). comprehensive inventory of the non-leaf-miner species Eour or five Potamanaxas have been found of Lepidoptera of Area de Conservacion Guanacaste during these efforts (Janzen et al., 2011; Janzen & (ACG) in northwestern Costa Rica (Janzen et ai, Hallwachs, 2014). What was called Potamanaxas 2009;Janzen & Hallwachs, 2011) are extraordinarily unifasciata (C. Felder & R. Felder, 1867) in earlier inventory publications is now known to be Eburuncus unifasciata, and is not considered here. Each ACG Received: 20 December 2014 Potamanaxas brings a small puzzle to the table and Accepted: 22January 2013 requires a dedicated research project to name. One of these species, known from a series of four Copyright: This work is licensed under the Creative Commons reared specimens, is the easiest to approach. While Attribution-NonCommercial-NoDerivs 3.0 Unported License. To cryptic in wing patterns that resemble those of view a copy of this license, vi.sit http://creativecommons.org/ several other species, it differs prominently from all licenses/by-nc-nd/3.0/ or send a letter to Creative Commons, named taxa with entire (not separated into spots) 171 Second Street, Suite 300, San Francisco, California, 94105, USA. pale bands on the forewing by having terminally 14 J. Res.Lepid. elongated genitalic valvae. Here, we formally genitalia were taken by the author with Nikon D200 describe this species, illustrate specimens, and discuss and Nikon D800 cameras through a 105 mm f/2.8G the differences from other Potamanaxas taxa, both in AF-S VR Micro - Nikkor lens; dissected genitalia were facies and in genitalia. photographed in glycerol with the Nikon D200 camera without the lens and through microscopes at 2x, and Material and methods 5x magnifications. Images were assembled and edited in Photoshop GS5.L Genitalia photographs were Adult specimens used in this study were from the taken in several focus slices and stacked in Photoshop following collections: National Museum of Natural to increase depth of field. DNA sequences were History, Smithsonian Institution, Washington, DC, downloaded from GenBank (http://genbank.gov/) USA (USNM); McGuire Center for Lepidoptera and or BOLD (http://www.boldsystems.org/). They were Biodiversity, Gainesville, FL, USA (MGGL); Natural aligned by hand (since they matched throughout their History Museum, London, UK (BMNH); Museum length without insertions or deletions), and analyzed fi'ir Naturkunde, Berlin, Germany (ZMHB); and using the Phylogeny.fr server (http://www.phylogeny. American Museum of Natural History, New York, fr/) with default parameters (Dereeper et al, 2008). NY, USA (AMNH). All specimens reared from Many of these sequences have been reported in Janzen wild-caught caterpillars by the ACG inventory are so et al. (2011) and photos of specimens are available indicated by having a specimen voucher code in the from the Area de Gonservacion Guanacaste (ACG) format yy-SRNP-x..., where “yy” are the two last digits on-line database (Janzen & Hallwachs, 2014) and of a year and “x..is the serial number of a specimen BOLD database (Ratnasingham & Hebert, 2007) to recorded in that year, from 1 to 6 digits, such as 5289 confirm or suggest identifications. or 22467. This SRNP code can be searched for on the inventory web site (Janzen & Hallwachs, 2014) Results and discussion and soon, in general internet search engines. Being reared, they are different from the net-caught wild Mass rearing of ACG caterpillars of Hesperiidae adults that usually populate museums, in that they are produced several species of Potamanaxas (Janzen on average slightly smaller, owing to the food offered et al., 2011), one of which clearly stands out by being of lesser quality than the food the caterpillar the morphology of its male genitalia. Terminally chooses on its own in the wild. elongated genitalic valvae set it apart from all named Standard entomological techniques were used for Potamanaxas species with pale entire discal bands dissection (Robbins, 1991), i.e., the distal part of the on their wings, and resemble only the genitalia of abdomen was broken off, soaked for 40 minutes (or P. paralus (Godman & Salvin, 1895) and P. hermieri until cleared) in 10% KOH at 60°C (or overnight at Grishin, 2013. However, these two species differ in room temperature), dissected, and subsequently stored having a less robust, longer tegumen relative to the in a small glycerol-filled vial on the pin under the uncus arms, narrower and more elongated saccus, specimen. Genitalia and wing venation terminology the process of the sacculus positioned farther from follows Steiiihauser (1981). Length measurements are the base (Fig. 24b, c), and the forewing pale band in metric units and were made from photographs of more strongly fragmented into spots (Figs. 19-22). specimens taken next to a scale and magnified on a COI DNA barcodes suggest that this ACG species computer screen. Photographs of specimens and dry might be closely related to P. paphos Evans, 1953 Figures 1-22 (Opposite page). Type specimens of Potamanaxas. 1-6. P. louisghilli n. sp. from Costa Rica, ACG; holotype d (1-2); paratype S, voucher91-SRNP-132 (3-4); paratype $, voucher 11-SRNP-31012 (5-6), data in text, specimens in USNM. 7-8. P. paphos [holojtype S Ecuador: Paramba, dry season, Apr-1897, 3500’, leg. Rosenberg, Rothschild Bequest B.M. 1939-1, specimen No. BMNH(E) #1054150 [BMNH]. 9-10. P. melicertes holotype Panama: “Chiriqui” [Chiriqui Prov., Chiriqui village on the highway. Pacific slope, about 12 km east of David, approx. 8° 23’ N, 82° 20’ W, per Selander & Vaurie (1962)], leg. Trbtsch, Staudinger collection [ZMHB]. 11-12. P. thoria syntype S Ecuador, Hewitson collection 79-69, type H 767, specimen BMNH(E) #1054002 [BMNH]. 13-14. P. pammenes (junior subjective synonym of P. thoria) syntype $ Nicaragua: “Chontales” [Chontales or Rio San Juan Departments, per Selander & Vaurie (1962)], leg. T. Belt, type specimen figured, Godman-Salvin collection 1912-23, type H 766, specimen BMNH(E) #1054001 [BMNH]. Dorsal and ventral surfaces are shown on odd- and even-numbered figures, respectively. Labels are shown for the P. louisghilli holotype and are reduced about 2.5 times compared to specimens: the smaller scale bar below one of the labels refers to labels, and the larger scale bar refers to specimens. “F" indicates mirror image (left-right inverted). Images of BMNH specimens are copyright of Trustees of the Natural History Museum, London; used with permission. 48: 13-20. 2015 15 1 1 cm 16 J. Res.Lepid. Figures 1-22 (continued). R otoog/y holotype S Peru: Cusco Region, Quispicanchi Province, Marcapata, genitalia slide G967 [AMNH]. 17-18. P. tschotky holotype S Colombia: Valle del Cauca, Rio Anchicaya, elevation 1150 m, 18-Jan-1975, No. CH-473, leg. S. R. & L. M. Steinhauser, A. C. Allyn Acc. 1975-17 [MGCL]. 19-20. P. paralus lectotype S Peru: Cosnipata Valley, leg. H. Whitely, Godman-Salvin Collection 1912-23, type H 772, specimen No. BMNH{E) #1054005 [BMNH]. 21-22. P. /lerm/er/holotype S Ecuador: Esmeraldas, km. 12.5, Lita-San Lorenzo rd., Rio Chuchuvi, 0° 53.01’ N, 78° 30.90’ W, 850 m, Jul-2002, leg. i. & R. Aidas, genitalia NVG120922-46 [USNM]. and P. melicertes (Godman & Salvin, 1895), which it in CUA2-I+2A cell, where rectangular slate-colored area absorbs postdiscal pale spots; band sometimes reaching costa, or separated cryptically resembles in wing pattern, but differs in from cream-colored costal area by very narrow line of pale brown prominently longer valvae and subtly in having spots scales; postdiscal row of pale spots (not streaks), more prominent vs. streaks in the forewing postdiscal pattern. This than above, faint in some specimens, reduced and offset distad species is therefore new, and is described here. by discal cell (between veins Mj and M^) and a doublet of pale spots distad of discal cell (near the bases of cells Mj-M^ and M^- Mj), sometimes fused with postdiscal band; row of submarginal Potamanaxas louisghilli Grishin, new species pale-brown spots, varying from roundish to triangular, one in (Figs. 1-6, 23, 24a, 25) each cell. Hindwing nearly triangular, slightly longer than wide, Description: Male (n=3, Figs. 1-4) - right forewing length rounded at apex and tornus, somewhat concave around and = 16.2 mm in holotype. Forewing twice as long as wide, rounded CiiAj veins and convex between these veins. Dorsal hindwing at apex and tornus, costa convex at the base and apex, straighter dark, chocolate-brown; a mostly white discal band a quarter to a mediad, outer margin convex. Dorsal forewing dark, chocolate- third of the wing width runs from costa to vein 2A, constricted brown; conspicuously pale cream-yellow (as opposed to the white and narrower at 1A vein, not bending towards tornus; band entire, on hindwing) discal band from near costa to inner wing margin, not separated into spots by veins, margins of the band somewhat separated from costa by a narrow belt of chocolate-brown scales, irregular, distal margin more diffuse with brown scales invading narrowing towards costa; band entire, not separated into spots the band along the veins; white overscaling around the band near by veins; basal band margin typically rounded towards both wing its posterior end; wing overscaled with hair-like slate-violet scales margins; distal band margin more irregular, indented at veins; along the band towards tornus; very faint or absent submarginal band mostly uniform in color, slightly yellower along veins; some paler spots in every cell. Ventral hindwing similar to dorsal, but cream scales on the costa anteriad of the band; a faint row of the white band is broader distad, the wing mostly slate basad of postdiscal pale spots (not streaks) with two spots between veins the discal band and posteriad to anal margin, the band fused with Mj and offset distad, and a doublet of pale spots just distad of slate area in cell 2A-3A; a row of submarginal pale-brown spots, discal cell. Ventral forewing similar to dorsal in color and pattern, one in each cell. Fringes brown, the same color as wing margins but overscaled with slate-colored scales at the base, discal band above and beneath everywhere, except where the pale band barely wider (mostly distad) in most cells and significantly wider reaches the inner margin of forewing and costa of hindwing, and 48: 13-20. 201.') 17 along anal margin ventrad fringes cream-white and slate. Head Memos, 10.98171° -85.42785°, 740 m, collected on 29-Mar-2007 in and palpi chocolate-brown with small white spots above, between antepenultimate instar feeding on Cavendishia axillaris (Ericaceae) and behind the eyes and dispersed slate scales on palpi and by Lucia Rios, eclosed 2-May-2007, voucher code 07-SRNP-31875, collar, slate with brown scales beneath, cheeks cream, antennae genitalia NVG120922-46, Genbank acces.sion of barcode .sequence brown with some slate scales at joints anteriad, a very prominent JF762690. Paratypes: Costa Rica: Area de Conservacion Guanacaste, cream spot anteriad at the base of the club, spot more than half Guanacaste Province, Sector Pitilla: 1 S (Figs. 3,4,23d-j) site Estacion of the club length; nudum brown, of 17 segments. Thorax and Pitilla, 10.98931° -85.42581°, 675 m, collected on 12-Mar-1991 in abdomen chocolate-brown above, slate beneath; legs with brown, ultimate instar feeding on Cavendishia axillaris (Ericaceae), eclosed slate and cream-yellow scales, largely brown dorsally, mostly cream 7-Apr-]991, voucher code 91-SRNP-132, genitalia No. X-6125J. M. ventrally, forelegs with the distal half of tibia mostly white and Burns 2005, Genbank accession of barcode seqttence DQ293099; 1 S, with a prominent white ring near the distal end of tarsus (3rd site Orosilito, 10.98332° -84.43623°, 900 m, collected on 12-Apr-2014 and 4th tarsomeres). Male genitalia (n=2, Figs. 23, 24a) - tufts of in penttltimate instar feeding on Psammisia ramiflora (Ericaceae) by scales near the bases ofvalvae orange-brown, uniformly colored; Manel Rios, eclosed 25-Apr-2014, voticher code 14-SRNP-30.571; 1 tegumen as long as wide, less than twice the length of uncus arms, 9 (Figs. 5, 6, 24) site Sendero Memos, 10.98171° -85.42785°, 740 m, with a small bulge centrally by the uncus; uncus divided, arms on collected on 16-Apr-2011 in penultimate instar feeding on Cavendishia the sides of tegumen, widely separated from each other, about axillaris (Ericaceae) by Freddy Quesada, eclosed 13-May-2011, voucher twice as long as wide at the base; gnathos upturned and Joint code ll-SRNP-31012, genitalia NVG131102-92, Genbank acce.s.sion of ventrad in the caudal half, spicuiose on its surfaces caudad, widely barcode sequence JQ526704. separated from uncus: distance from gnathos ventral side to the Deposition of types: The holotype and the three paratypes base of uncus dorsally exceeds the length of uncus arms; saccus are in the National Mttsetim of Natural History, Smithsonian as long as wide, broadly triangular and broadly rounded anteriad; Institution, Washington, DC, USA (USNM). valva with convex costa angled in the middle, cucullus irregularly Type locality: COSTA RICA: Area de Conservacion dentate along the dorsal edge, extending caudad for about the Guanacaste, Guanacaste Province, Sector Pitilla, site Sendero same length as costa, cucullus caudal end narrow, rounded and Memos, GPS: 10.98171° -85.42785°, elevation 740 m. directed posterodorsad, at the base of dorsal margin cucullus Etymology: This species is named in memory of Louis G. Hill, with a triangular tooth-like projection directed anterodorsad, a deeply principled Pennsylvania State Senator and Philadelphia dorsolateral dimension of the valva (“height”) is about the Judge and lover of wilderness, whose children are supporters cucullus length; sacculus with style-like projection from its very of ACG and the dissemination of ACG insect knowledge, and base, projection about twice as long as wide, not widening dorsad; particularly the taxonomy of the subfamily Campopleginae in penis slightly shorter than valva length, no cornuti. the parasitoid wasp family Ichneumonidae, many of which are Female (n=l. Figs. 3,4) - right forewing length = 17.4 mm, similar parasitoids of skipper butterfly (Hesperiidae) caterpillars. to male but slightly larger, nudum of 17 segments. Female genitalia Distribution and phenology: Currently, this species is known only (Fig. 25) - lamella postvaginalis with two approximately triangular from about 10 km^ of ACG mid-elevation Caribbean rain forest (but sclerotized areas along the distal margin with a non-sclerotized geopoliticallyin Guanacaste Province, which islargely dry forest), but break between them in the middle; lamella anievaginalis weakly it is expected to have a wider distribution throughout Costa Rica and sclerotized, expanded anteriad with several stronger sclerotized Panama. Specimens with similar genitalia have been recorded from latitudinal ridges; antrum poorly sclerotized, not prominent, South America as well, and the research on their taxonomic status is narrow: ductus bursae narrow, slightly longer than sierigma; corpus on-going. The caterpillars were fotind in March-April and the adults bursae longer that the rest of genitalia, as wide as sterigma. eclosed in April-May (^Janzen & Hallwachs, 2014). Barcode sequence of the holotype: Genbank Accession Diagnosis; This species belongs to Potamanaxas becatise it jF762690, voucher 07-SRNP-31875, 658 base pairs: has all the traits of the genus as given in the Evans identification key (1953: 6-15, 137). In particular, males have two tufts of AACTTTATATTTTATCTTTGGAATTTGAGCAGGAATAGTAGGAACT hair-like scales near the bases of valvae (Eig. 23e, f), a suggested TCCCTAAGTTTATTAATTCGAACTGAATTAGGTAATCCAGGATCAT synapoinorphy of Potamanaxas (Grishin, 2013a; 2013b; 2013d). TAATTGGGGATGATCAAATTTATAATACTATTGTTACAGCTCAT By the COI barcodes, it nests within other Potamanaxas species GCTTTTATTATAATTTTTTTTATAGTTATACCAATTATAATTGAG (Ratnasingham & Hebert, 2007;Janzen etal., 2011). As suggested GATTTGGTAATTGATTAGTGCCATTAATACTAGGAGCCCCAGA by COI barcodes and wing patterns, the new species is most similar TATAGCATTTCCTCGAATAAATAATATAAGATTTTGACTTTTAC to P. paphos Evans, 1953 and P. melkertes (Godman & Salvin, CCCCCTCTTTAATATTATTAATTTCTAGAAGAATCGTAGAAAATG 1895) (Figs. 7-10), but is confidently distinguished from them by GAGCAGGAACAGGTTGAACTGTTTACCCCCCCTTATCTGCCAAT terminally elongated valvae (Figs. 23, 24). P. louisghillicowid also ATTGCTCACCAAGGTTCCTCAGTAGATTTAGCTATTTTCTCCCT be confused with other Potamanaxas species characterized by pale TCATTTAGCAGGTATTTCTTCTATTCTTGGGGCTATTAATTTAT discal bands on wings, stich as P. thoria (Hewitson, 1870) (Figs. CACAACAATTATTAATATACGAATTAGAAATTTATCTTTTGAT 11-14, 24d), P. o/troog/y Grishin, 2013 (Figs. 15, 16, 24e), P. tschotky CAAATACCTTTATTTATTTGAGCTGTAGGAATTACTGCTTTACTAT Grishin, 2013 (Figs. 17, 18, 24g), P. paralus (Godman & Salvin, TACTACTTTCATTACCTGTATTAGCAGGTGCTATTACTATATTAT 1895) (Figs. 19, 20, 24b), and P. /icrwtVn Grishin, 2013 (Figs. 21, TAACAGATCGAAATTTAAATACATCCTTTTTTGACCCAGCAGGAG 22, 24c), but can be distinguished from these species either by GAGGAGAT CCAAT T T TATATCAACAT T TATT T wing patterns or male genitalia (Figs. 23, 24). A combination of the following characters is diagnostic of Sequences of paratypes show differences in 2 positions. P. louisghilli'. (1) The yellowish cream—not strong yellow as in Types: Holotype S (Figs. 1, 2, 23a-c) has the following four P. flavofasciata (Hewitson, 1870) and P. xantholeuce (Mabille, rectangular labels: white printed & hand-printed - II Voucher: 1888)—discal band on dorsal forewing is entire and not separated D.H.Janzen & W.Hallwachs I DB: http://janzen.sas.upenn.edu I into spots by veins as in most Potamanaxas species (see Warren et Area de Conservacion Guanacaste, I COSTA RICA. I 07-SRNP- al. 2014 for illustrations); its margins could be somewhat irregular 31875 II; yellow printed - II LEGS AWAY I FOR DNA II; white printed (e.g.,Fig. 1), but not as irregular as in P. paralus{Yig. 19),P. hermieri - II NVG120922-46 II; red printed - II HOLOTYPE S I Potamanaxas I (Fig. 21), and P. xantholeuce. (2) The pale-cream-white discal band louisghilliGrishin II. Holotype data: Costa Rica: Area de Conservacion on dorsal hindwing spans from the costa to the 2A vein and has Guanacaste, Guanacaste Province, Sector Pitilla, site Sendero irregular margins, not sharply defined as in P. okroogly (Pig. 15) and 18 J. Res.Lepid. Figure 23. Male genitalia of Potamanaxas louisghilli n. sp. Genital capsule of the holotype (a-c, voucher 07-SRNP-31875, genitalia NVG120922-46, Figs. 1-2) and a paratype (d-j, voucher 91-SRNP-132, genitalia No. X-6125 J. M. Burns 2005, Figs. 3^) in different views: a, e. lateral; b, 1 left ventrolateral; c, d. dorsal; g. ventral; h. right dorsolateral; i. posterior; j. anterior. Specimens are in USNM. P. hermieri HT P. louisghilli n sp HT P. thoria P. paphos HT P. tschotky PT Figure 24. Male genitalia of Potamanaxas. a. P/ou/'sgh/'///holotype, data in text (Figs. 1-2); b. P para/us, Peru: Huanuco Region, Jingo Maria, 23-Jun-1982, 800 m, genitalia #H747 by S. S. Nicolay [USNM]; c. P herm/en holotype, Ecuador: Esmeraldas, km. 12.5, Lita-San Lorenzo rd., Rio Chuchuvi, 0° 53.01’ N, 78° 30.90’ W, 850 m, Jui-2002, leg. I. & R. Aldas, genitalia NVG120922-46 [USNM] (Figs. 21-22); d. P. thoria, Ecuador: Imbabura Prov., Ruminahui, 37 km N. Pedro Vicente Maldonado, 0° 16.73’N 78° 59.9’W, 500 m, 9-Mar-2001, leg. D. H. Ahrenholz, genitalia NVG120922-44 [USNM], lateral view; e. P o/croog/y holotype, Peru: Cusco Region, Quispicanchi Province, Marcapata, genitalia slide G967 [AMNH], left valva, interior view (Figs. 15-16); f. P paphos [holo]type, Ecuador: Paramba, dry season, Apr-1897, 3500’, leg. Rosenberg, Rothschild Bequest B.M. 1939-1, specimen No. BMNH{E) #1054150 [BMNH], lateral view of the abdomen caudal end (Figs. 7-8); g. P tschotky paratype, Ecuador, coll. Saunders, Godman-Salvin collection 1912-23, specimen No. BMNH(E) #1054120 [BMNH], left valva, interior view. “F” indicates mirror image (left-right inverted). Images of BMNH specimens are copyright of Trustees of the Natural History Museum, London; used with permission. Figure 25. Female genitalia of Potamanaxas louisghilli n. sp. a. complete genitalia in ventral view with a scale bar on the left; b-d magnified sterigma, ovipositor lobes, and last tergum in posteroventral (b), ventral (c) and right lateroventral (d) views, scale bar on the right. Voucher 11-SRNP-31012, genitalia NVG131102-92, Figs. 5-6, the specimen is in USNM. P. tschotky (Fig. 17); the band does not end posterior to discal cell Immatures and foodplants: Caterpillars that produced all near CuA,, vein as in P. hirta (Weeks, 1901), P. okroogly (Fig. 15), P. specimens in the type series were found feeding on Cavendishia tschotky (Fig. 17), and P. effusa (Drandt, 1922), and does not bend axillaris and Psammisia ramiflora, both in Ericaceae. It is likely to towards the tornns as in P. thoria (Fig. 11); the posterior end of the be host-specific to rain forest epiphytic Ericaceae, as are the other band is partly separated from the rest of the band by a constriction species of ACG Potamanaxas (Janzen et al., 2011). along the lA vein (Figs. 1, 3, 5) and the inner margin of the band is indented at the lA vein, not smooth as in P. thoria (Fig. 11). (3) A row of faint postdiscal forewing spots, not streaks as in P. paphos Acknowledgements and P. melicertes (Figs. 7-10), is complemented with a dotiblet of spots distad of discal cell; the spots can be seen above (Figs. 1, 3, 5), btit We are indebted to the ACG parataxonomists for finding and are more prominent beneath (Figs. 2, 4, 6); the spots are typically rearing the caterpillars; to ACG for taking care of them and their more expressed and elongated than those in P. thoria (Figs. 11-14); caterpillars; to the Biodiversity Institute of Ontario at the University of two spots of the row, those between cells Mj and M.,, are offset distad, Gtielph, Canada, as well as BOLD of iBOL (http://www.bold.systems. making room for an additional spot donbletjust distad of discal cell org/) for sequencing and analyzing the DNA barcodes. We are (at the bases of cells Mj-M., and M.,-M,,), this doublet is usually made of grateful to Robert K. Robbins, John M. Burns and Brian Harris the best-developed spots (Fig. 6). (4) Males have a white streak at the (National Museum of Natural History, Smithsonian Institution, front of antennal cltib and a white ring on foreleg tarsi, as in P. tschotky Washington DC), David Lees and Blanca Huertas (Natural History (Grishin 2013d); those are normally absent in other related species, Museum, London, UK), Andrew D. Warren and Andrei Sotirakov except for the antennal streak in P. thoria and P. okroogly. (5) Male (McGuire Center for Lepidoptera and Biodiversity, Gainesville, FL), genitalic valvae are characterized by an elongated and curved dorsad Wolfram Mey (Museum furNaturktinde, Berlin, Germany), Andrew cuculltis with a tooth at its base directed anterodorsad (Fig. 23a, e, Johnston, David A. Grimaldi and Suzanne Rab Green (American most similar to P. paralus a.nd P. hennieri, but different in most other Museum of Natural History, New York, NY) for facilitating access Potamanaxas species), and the process on the sacculus stemming to the collections under their care and stimulating discussions; to from its very base (positioned further posteriad in P. paralusYig. 24b Don Harvey (National Museum of Natural History, Smithsonian and P. liermieriYig. 24c); the saccus is rather broad, almost triangular with a broadly rounded apex (narrower in P. paralus3.nd P. hennieri); Institution, Washington DC) for preparations of genitalia from the and the tegumen is more robust and relatively shorter compared to John Burns X-series; to Bernard Hermier for many enlightening uncus arms than in P. paralus and P. hennieri. discussions, and numerous suggestions; and anonymous reviewers Characters (1) to (3) are usually sufficient to identify P. louisghilli for helpful comments. The study has been stipported (DHJ and WH) from specimens, live individuals, and their photographs, making by U.S. National Science Foundation grants BSR 9024770 and DEB dissection unnecessary. However, the structure of male genitalia and 9306296, 9400829, 9705072, 0072730, 0515699, and grants from its differences from other Potamanaxas species are instrumental in the Wege Foundation, International Conservation Fund of Canada, substantiating P. louisghilli as a species-level taxon and its distinctness Jessie B. Cox Charitable Trust, Blue Moon Fund, Guanacaste Dry from cryptically similar P. paphos and P. melicertes. Additionally, P. Forest Conservation Fund, Area de Conservacion Guanacaste, louisghilli is clearly different by its DNA barcode from the other Permian Global, JRS Biodiversity Foundation, USNM/Smithsonian recorded species of ACG Potamanaxas. and the University of Pennsylvania. 20 J. Res.Lepid. Editor’s note Grishin, N. V., D. H. Janzen & W. Hallwachs. 2013b. Hiding behind gaudy looks, a new Central American species of Phareas (Hesperiidae: Eudaminae). Journal of the Lepidopterists’ The electronic edition of this article has been registered Society 67(3): 161-174. in ZooBank to comply with the requirements of the amended Grishin, N. "V., D. H. Janzen & W. Hallwachs. 2014a. A new species International Code of Zoological Nomenclature (ICZN). This of Eracon (Hesperiidae: Pyrginae) substantiated by a number of registration makes this work available from its electronic edition. traits, including female genitalia. Journal of the Lepidopterists’ ZooBank is the official registry of Zoological Nomenclature Society 68(3): 149-161. according to the ICZN and works with Life Science Identifiers Grishin, N. V., J. M. Bur.ns, E. Brockmann, W. Rallwachs & D. H. (LSIDs). The LSID for this article is: urn:lsid:zoobank. J.ANZEN. 2014b. A crvptic new/cmarfm (Hesperiidae: P)Tginae: org:pub:82159950-B38C-42F4-BACE-8694ClAEA4C7. Pyrrhopygini) from Costa Rica and Panama with a subtly Registration date: May 2nd, 2015. This record can be viewed using distinctive combination of blue rays and white bands. Journal any standard web browser by clicking on the LSID above. of the Lepidopterists’ Society 68(4): 232-247. Hebert, P.D. N., E. H. Penton, J. M. Burns, D. H. Janzen & W. Literature cited Hallwachs. 2004. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the national Academy of Sciences of Bell, E. L. 1956. Descriptions of some new species of Neotropical the USA 101(41): 14812-14817. Hesperiidae (Lepidoptera, Rhopalocera). American Museum Janzen, D. H. & W. Hallwachs. 2011. Joining inventory by parataxonomists Nowtates 1778: 1-13. witli DNA barcoding of a large complex tropical conserved wildland Bur.ns,J. M. & D. H. J.4NZEN. 2005. Pan-Neotropical genus IFwarfs in noithwestem Costa Rica. PLoS ONE 6(8): el8123. (Hesperiidae: P)Tginae) is not monorvpic: Four new species occur on one volcano in the Area de Conservacion Guanacaste, Costa Janzen, D. H. & W. Hallwachs. 2014. Dynamic database for an inventory of the macrocaterpillar fauna, and its food plants Rica. Journal of the Lepidopterists’ Society 59(1): 19-34. and parasitoids, of Area de Conservacion Guanacaste (ACG), Biirns, J.M., D.H. Janzen, M. H.a.iib.ab.aei, W. H.\llwachs & P.D.N. northwestern Costa Rica, <http://janzen.sas.upenn.edu/>. Hebert. 2008. DNA barcodes and elliptic species of skipper butterflies in the genus Perichares in Area de Conservacion Janzen, D. H., W. Hallwachs, P. Blandin, J. M. Burns, J.-M. Cadiou, I. Guanacaste, Costa Rica. Proceedings of the National Academy A Chacon, T. D.apkev’, A. R. Deans, M. E. Epstein, B. Espinoza, J. G. of Sciences 105(17): 6350-6355. Franclemont, W. a. Haber, M. Haiib.ab.aei, J. P. W. Hall, P. D. N. Burns, J. M., D. H. Janzen & W. H.allwaohs. 2010. Of many similar Hebert, 1. D. Gaiild, D. J. Harvev, A. Hausmann, I. Kitching, J. D. species in the Neotropical genus Porphyrogenes (Lepidoptera: Lafontaine, J.-F. Landrv, C. Lemaire, J. Y Miller, J. S. Miller, L. D. Hesperiidae), a new one, repeatedly reared in Costa Rica, is Miller, S. E. Miller, J.J. Montero, E. G. Munroe, S. Rab Green, S. relatively distinct. Proceedings of the entomological Society Ratnasingram,J. E. Rawlins, R K Robbins,J.J. Rodriglez, R Roigerie, of Washington 112(1): 32-42. M.J. Sharkev, M. a Smith, M. A Sous,J. B. Sliuja'an, P. Thiaucoukt, D. Biir.ns,J. M., D. H. Janzen, W. H.AU.w.'tcHS & M. Ha|ib.ab.ael 2013. DNA B. W'.AHL, S. J. Weller, J. B. Whotield, K R Willmott, D. M. WtooD, N. barcodes reveal yet another new species of Venada (Lepidoptera: E. Woodlev&J.J. W'lLSON. 2009. Integration ofDNA barcoding into Hesperiidae) in northwestern Costa Rica. Proceedings of the an ongoing inventory of complex tropical biodiversity. Molecular Entomological Society of Washington 115(1): 37-47. Ecology Resources 9 (Supplement 1): 1-26. Ev.ans, W. H. 1953. A catalogue of the American Hesperiidae Janzen D. H., W'. Hallwachs, J. M. Burns, M. Raiib.ab.aei, C. Bertrand indicating the classification and nomenclature adopted in & P. D. N. Hebert. 2011. Reading the complex skipper butterfly the British Museum (Natural History). Part III (Groups E, F, fauna of one tropical place. PLoS ONE 6(8): el9874. G) Pyrginae. Section 2. London, British Museum (Natural J.ANZEN, D. H., W1 Hallwachs, D. J. Haraev, K. D.arroav, R. Rougerie, M. Histoi7). V + 246 pp., pis. 26-53. Ha|ib.ab.aei, M. a. Smith, C. Bertrand, I. C. Gamboa, B. Espinoza, J. GRisttiN, N. V. 2013a. Uncus shaped akin to elephant tusks defines B. Sullia'an, T. Decaens, D. Herein, L. F. Chaaarria, R. Franco, H. a new genus for two ver)' different-in-appearance Neotropical Cambrontro, S. Rios, Fr. Qiie&ada, G. Pereira,J. Vargas, A. Guadamuz, skippers (Hesperiidae: Pyrginae). Journal of Research on the R. Espinoza, J. Hern.andez, L. Rios, Elieth Gantillano, Roster Lepidoptera 45: 101-112. Moraga, Cauxto Moraga, Petrona Rios, IVLanuel Rios, Ricardo Grishin, N. V. 2013b. On die identity of Potanmruixm andraemon and its Galero, D. Martinez, D. Briceno, M. Garmona, E. Apu, K. Aragon, relatives, with the description of a new .species from Peru (Hesperiidae: C. Unlana, J. Perez, A. Gordoba, P. Umana, G. Sihezar, O. Espinoza, Ptrginae: Ennnini). Tropical l^epidoptera Reseaich 23(1): 1-13. C. Gano, E. Arava, D. G.arcla, H. Ramirez, M. Pereira, J. Gortez, M. Grlshin,N.V. 2013c. Adding to die rich faimaoftlieCltoco region in Ecuador, Pereira, W. Medina & P. D. N. Hebert. 2012. What happens to tire a new species oiPoUnnanaxas (Hesperiidae: P)Tginae: Er)Tinini). Tropical Uaditional taxonomy when a well-known tropical satumiid modi Lepidoptera Reseaich 23(2) (Suppl. 1): 1-5, pis 1-3. fauna is DNA barcoded? Invertebrate Systematics 26:478-505. Grishin, N. V. 2013d. A new Potamanaxas (Hesperiidae: Pyrginae: Ratnasingham, S. & P. D. N. HEBtrrr. 2007. BOLD: The Barcode of Life Data Erynnini), patterned like P. bana, but with sickle-armed System (www.barcodinglife.org). Molecular Ecology Notes 7,355-364. genitalia, not chicken claws. Tropical Lepidoptera Research Robbins, R. K. 1991. Evolution, comparatb'e morphology, and 23(2) (Suppl. l):6-9, pis 4-6. identification of the Eumaeine butterfly genus Rekoa Kaye Grishin, N.V. 2013e. Ai enigmatic new Poto/wwnx® (Hesperiidae: P)Tginae: (Lycaenidae: Theclinae). Smithsonian Contributions to Ei^iinini) is a \isual mosaic of characters from distantly related species. Zoolog)' 498:1-64 pp. Tropical Lepidoptera Research 23(2) (Suppl. 1): 10-12, pis 8-10. Selander, R. B. & P. Vaurie. 1962. A gazetteer to accompany Grishin, N. V. 2013f Two new species of Potamanaxas (Hesperiidae: the “Insecta” volumes of the “Biologia Centrali-Americana”. Pyrginae: Erynnini)—one of them, P. melicertes of Evans, was American Museum Novitates 2099: 1-70. mentioned but not named by Godman and Sabin. Tropical Steinhauser, S. R. 1981. A rerision of the group of the genus Lepidoptera Research 23(2)(Suppl. 1): 13-17, pis 11-14. Urbamis Hubner. Lepidoptera: Hesperiidae. Bulletin of the Grishin, N.V.,J. M. Biirns, D. H.Janzen, W. Hallwachs & M. H.a|ib,ab,aei. Allyn Museum 62: 1-41. 2013a. Oxynetra: facies and DNA barcodes point to a new species W.ARREN, A. D., K. J. D.avis, E. M. Stangeland, j. P. Pelham & N. V. from Costa Rica (Hesperiidae: PtTginae: Fberhopygini). Journal Grishin. 2014. Illustrated lists of American butterflies. [28-IX- of the Lepidopterists’ Society 67(1): 1-14. 2014] <http://AVAvw.butterfliesofamerica.com>.

See more

The list of books you might like