Logout succeed
Logout succeed. See you again!

A Novel Kinesin-Like Protein with a Calmodulin-Binding Domain PDF
Preview A Novel Kinesin-Like Protein with a Calmodulin-Binding Domain
NASA-CR-204645 ? Plant Molecular Biology 31: 87-100, 1996. © 1996 Kluwer Academic Publishers. Printed ill Belgium. / 87 - (' 3 A novel kinesin-like protein with a calmodulin-binding domain W. Wang 1, D. Takezawa 1, S. B. Narasimhulu 2, A. S. N. Reddy 2 and B. W. Poovaiah 1,, 1Laboratory of Plant Molecular Biology and Physiology, Department of Horticulture, Wash#Tgton State University, Pulhnan, WA 99164-6414, USA (*author for correspondence); ZDepartment of Biology and Program in Cell and Molecular Biology, Colorado State University, Fort Collins, CO 80523, USA Received 27 November 1995; accepted in revised form 12 February 1996 Key words: calcium, calmodulin, calmodulin-binding protein, kinesin, motor protein, microtubule Abstract Calcium regulates diverse developmental processes in plants through the action of calmodulin. A cDNA expression library from developing anthers of tobacco was screened with 35S-labeled calmodulin to isolate cDNAs encoding calmodulin-binding proteins. Among several clones isolated, a kinesin-like gene (TCK1) that encodes a calmodulin-binding kinesin-like protein was obtained. The TCK1 cDNA encodes a protein with 1265 amino acid residues. Its structural features are very similar to those of known kinesin heavy chains and kinesin-like proteins from plants and animals, with one distinct exception. Unlike other known kinesin-like proteins, TCK1 contains a calmodulin-binding domain which distinguishes it from all other known kinesin genes. Escherichia coli-expressed TCK1 binds calmodulin in a Ca 2+-dependent manner. In addition to the presence of a calmodulin-binding domain at the carboxyl terminal, it also has a leucine zipper motif in the stalk region. The amino acid sequence at the carboxyl terminal of TCK1 has striking homology with the mechanochemical motor domain of kinesins. The motor domain has ATPase activity that is stimulated by microtubules. Southern blot analysis revealed that TCKI is coded by a single gene. Expression studies indicated that TCKI is expressed in all of the tissues tested. Its expression is highest in the stigma and anther, especially during the early stages of anther development. Our results suggest that Ca 2+/calmodulin may play an important role in the function of this microtubule- associated motor protein and may be involved in the regulation of microtubule-based intracellular transport. Introduction or subcellular processes through CaM-binding proteins. A number of CaM-binding proteins have Calmodulin (CAM), a Ca2+-binding multifunc- been identified and characterized in animals, in- tional regulatory protein, is known to be a pri- cluding metabolic enzymes, protein kinases, mary transducer of the intracellular Ca 2+ signal membrane transporters, and structural proteins [35, 39, 47]. Calmodulin regulates many cellular [11 ]. Although CaM-binding proteins are widely The nucleotide sequence data reported will appear in the EMBL, GenBank and DDBJ Nucleotide Sequence Databases under the accession number U52078. 88 distributed in plants [19, 30] and are believed to in the pollen tubes of tobacco by using a mono- be involved in the diverse functions in plants [35, clonal antibody to the heavy chain of the calf 39], little is known about the identities and func- brain kinesin molecule [44]. A gene family en- tions of these CaM-binding proteins. In recent coding kinesin-like proteins has also been cloned years, several genes encoding CaM-binding pro- from Arabidopsis thaliana [25, 26]. Matthies et al. teins have been cloned and identified, for example, [23] reported that kinesin light chains from bo- glutamate decarboxylase [1, 20], Ca2+/CaM- vine brain bind calmodulin in a calcium-depen- dependent protein kinase [33 ],and some proteins dent manner. However, all of the known kinesin with unknown identities [21, 38]. Further identi- heavy chains and kinesin-like proteins character- fication and characterization of CaM-binding ized from plants and animals do not bind calm- proteins should broaden our knowledge of Ca 2+ odulin. We cloned a kinesin-like gene (TCKI) by mediated signal transduction mechanisms in screening a cDNA expression library using 35S- plants. labeled calmodulin. Sequence analysis and bio- Using recombinant 35S-labeled potato calm- chemical studies revealed that TCK1 has all the odulin as a ligand probe, a cDNA expression li- common characteristics of kinesin-like proteins. brary from developing anthers of tobacco was In addition, TCK1 binds to calmodulin in the screened to obtain CaM-binding clones. Several presence of Ca 2+. The presence of a CaM- positive clones were isolated and characterized binding domain in TCK1 makes it a unique ad- [54]. The sequence comparison revealed that one dition to the kinesin superfamily. Since calmodu- of the clones had homology with kinesin heavy lin is a multifunctional regulatory protein, it is chain and kinesin-like genes. likely that itplays a unique regulatory role in con- Kinesin, a large superfamily of the microtubule- trolling the function of TCK1. based motor proteins, consists of kinesin heavy chains (i.e., conventional kinesins) and kinesin- 7like proteins (KLPs) [34]. Since kinesin was Materials and methods first identified from squid [48], a number of ki- nesin heavy chains and kinesin-like genes have Plant materials been cloned and characterized from various eu- karyotic organisms [10, 34]. The common feature Nicotiana tabacum cv. Petit Havana SR-1 was of both conventional kinesin heavy chains and grown under greenhouse conditions. Anthers of kinesin-like proteins is that they contain a motor different stages and various organs were dissected domain, which contains a microtubule-activated from the tobacco plants, immediately frozen in ATPase activity that converts the chemical en- liquid N2, and stored at -70 °C until use. The ergy stored in ATP into mechanical forces to stages of flowers were determined by measuring move them along the surface ofmicrotubules [62]. the distance from the base of the pedicel to the tip In addition to the mechanochemical motor do- of the sepal or corolla depending on which was main, most kinesins contain an e-helical coiled- longer. coil stalk and a globular tail domain. However, except for the conventional kinesin heavy chain, the sequences of kinesin-like proteins in the stalk Screening of tobacco anther cDNA library with 35S- and tail domains do not share obvious homology. calmodulin Kinesin appears to be a major intracellular mo- tility molecule, which plays essential roles in Total RNA was extracted from developing an- membrane-bound organelle transport [29, 31,48 ], thers of tobacco flowers 0.5 to 1.0 cm in length mitotic and/or meiotic spindle organization [9, [51], and poly(A) + RNA was isolated using 50] and chromosome positioning [50]. In plants, oligo-(dT) cellulose column chromatography an immunoreactive kinesin homolog was detected [40]. A tobacco anther cDNA library was con- 89 structedinthe2ZAPIIvector(Strategeneu)sing loading onto the calmodulin-Sepharose column. a cDNA synthesiskit fromPharmaciaP. otato The column was washed thoroughly with a buffer calmodulinPCM6cDNA[43]wasclonedinto containing 50 mM Tris-C1 pH 7.5, 1 M NaC1, NdeI/BamHI sites of the pET3b expression vec- 0.1_o (w/v) Triton X-100, 1 mM DTT and tor (Novagen) and 35S-labeled calmodulin was 1 mM CaC12, and fusion proteins were eluted prepared according to Fromm and Chua [7]. with 50 mM Tris-C1 pH 7.5, 200 mM NaC1, About 6 x 105 plaques were screened essentially 1 mM DTT, 0.1_o (w/v) Titon X-100 and as described [38]. The positive plaques obtained 2.5 mM EGTA. Fusion proteins containing in the first round of screening were purified by two amino acid residues 824-1265 and 1214-1265 of additional rounds of screening. TCK1 were used to perform ATPase assays and calmodulin-binding assays, respectively. DNA sequence analysis Biotinylated calmodulin overlay assay The pBluescript SK(-) plasmid containing the cDNA clone was invivo excised from the 2ZAPII E. coli-expressed recombinant fusion proteins vector according to the protocol described by were separated on the SDS-polyacrylamide gel Strategene. The DNA sequences were determined [16] and electrophoretically transferred onto a by the dideoxynucleotide chain termination nitrocellulose filter [46]. The filter was blocked in method using the Sequenase 2.0 kit (US Bio- TBS containing 3_ (w/v) non-fat dry milk at chemical Corp.) and the PCRfnwl sequencing kit room temperature for 2 h. The filter was then (Promega). Sequence data analyses were per- incubated with 100 ng/ml biotinylated calmodulin formed using the Wisconsin Genetics Computer (BRL) in binding buffer (TB Scontaining 1_ w/v Group (GCG package, version 8.0) software. BSA, and 1mM CaC12) at room temperature for 2 h. After washing in TBS containing 1 mM CaC12, the filter was incubated with avidin- Expression offusion proteins of TCK1 in E. coli conjugated alkaline phosphatase in the binding buffer for 2h. The bound biotinylated-calmodulin The fragments of the TCK1 cDNA encoding was detected by NBT/BCIP reagent (Amresco). amino acids 824-1265 and 1214-1265 were fused in frame to glutathione S-transferase (GST) in a pGEX-3X vector. E. coli strain BL21 (DE3) con- Southern blot analysis taining the expression plasmids was grown at 30 °C in M9 minimal medium supplemented with Tobacco genomic DNA (10 _tg)was digested with 2 g/t NZ amine and 100 mg/1 ampicillin. Proteins different restriction enzymes, run in 0.8 _oagarose were induced by adding 0.1 mM IPTG when gel, and transferred onto a nylon membrane. The OD6oo reached 0.6 unit. Three hours after induc- membrane was incubated with random-primed tion, E. coli cells were collected by centrifugation 32p-labeled probe using a PstI/XbaI fragment (nt at 3000 x g and sonicated in PBS to prepare bac- 2827-3946, Fig. 1) as a template [40]. The hy- terial lysates. Insoluble materials were removed bridization was performedat 42 °C in a solution by centrifugation at 15000 x g and the fusion pro- containing 50_o formamide, 6 x SSC, 5x Den- teins were purified using glutathione-Sepharose hardt's solution, 0.1_o w/v SDS and 100/_g/ml column (Pharmacia) according to the manufac- herring sperm DNA. The membrane was washed turer's instructions. Alternatively, the fusion pro- at 60 °C in 0.5 x SSC and 0.1_o w/v SDS, then teins were purified by calmodulin-Sepharose col- exposed to Kodak XAR-5 film. umn chromatography. CaC12 (1 mM)was added to the soluble fractions of E. coli lysate before 90 Northern blot analysis and 20/zM taxol, and incubated at 34 °C. The process of polymerization was monitored con- Poly(A) + RNA from various organs and devel- tinuously following the change in absorbance at oping anthers of different stages were isolated as 350 nm. described above. Five/_g of poly(A) + RNA was denatured by glyoxal and DMSO [40], electro- phoresed in 1_ agarose gel, and then transferred A TPase assay of kinesin protein onto a nylon membrane. Hybridization was per- formed at 42 °C in a solution containing 50_o ATPase activity of the kinesin protein was mea- formamide, 5 x SSPE, 5x Denhardt's solution, sured according to the protocol of Chandra and 0.1% w/v SDS and 100 /_g/ml herring sperm Endow [3]. The reaction mixture contained DNA. Random-primed 32p-labeled cDNA 20 #g/ml purified protein, 4 mM Mg ATP, probes were applied using a HindIII/PstI frag- 15 mM imidazole pH 6.9, 1mM EGTA, 1 mM ment (nt 1098-1940, Fig. 1) as a template. After DTT, 1.5 #Ci of 32p-ATP and with or without hybridization, the membrane was washed with 1 mg/ml taxol-stabilized microtubules of sheep 0.1x SSC and 0.1_o w/v SDS at 65°C and brain in a reaction volume of 150 #1.The reaction exposed to Kodak XAR-5 film. The same mem- was allowed to proceed for 15min at 24 °C. Ali- brane was hybridized with a tobacco c_-tubulin quots of 40/_1 were withdrawn into a microcen- probe under similar conditions. trifuge tube containing 760 #1 of 5_o activated charcoal suspended in 50 mM NaH2PO4. After 15min incubation on ice, tubes were centrifuged Isolation, purification, and polymerization of sheep for 5 min at 14000 rpm. The supernatants were brain tubulin collected and recentrifuged to remove charcoal particles. A 10#I fraction of the supernatant was Tubulin was purified from the gray matter offresh measured for inorganic 32p in a scintillation sheep brain according to the protocol of Williams counter. Control assays without kinesin and mi- and Lee [57]. The tissue was homogenized in a crotubules alone were performed to determine the buffer containing 100 mM Pipes-NaOH pH 6.9, background counts. The ATPase activity is ex- 2 mM EGTA, 1 mM MgSO4, 4 M glycerol, and pressed in nmol of inorganic phosphate released 2 mM DTT. The supernatant obtained after spin- per min per mg protein. ning at 96000 x g at 4 °C for 75min was used for the assembly of the tubulin polymer at 34 °C in the presence of 1 mM GTP and disassembly Results through cold treatment. Twice-cycled tubulin protein was further purified from microtubule- Isolation of a cDNA encoding a CaM-binding pro- associated proteins by passing through a phos- rein with homology to kinesin phocellulose column. The void containing the pure tubulin was adjusted to a concentration of A tobacco anther cDNA expression library was 1.3 mg/ml, frozen in liquid N2 and stored at screened with 3sS-labeled calmodulin. After three - 80 °C in small aliquots. For preparing micro- rounds of screening, several positive clones were tubules, the frozen tubulin was thawed, equili- identified. Among these clones, one partial cDNA brated with buffer, supplemented with 1mM GTP clone was sequenced (3510 bp, nt 692-4201, Fig. I. Nucleotide and deduced amino acid sequences of the TCKI gene. The nucleotides are numbered on the left, and the cor- responding amino acids are numbered on the right. The predicted a-helical coiled-coil region are underlined with solid lines. Amino acids indicated by arrow heads show the leucine zipper motif. The ATP-binding consensus sequence is marked with dashed lines. The putative CaM-binding domain is boxed. 9] 1 TCCAAAGCTTCT_CATCA 2124 AGC TT_%_AGATAACTT GAGATCAGAC_%AGC/_TTTAGC.A_ TGCTGCTTATGATTGT 24 TTT_ACT_G GTAAC TGAG CL_AGCTATTGAAGATTAAGG GTCAC_TATTGCTTA S L K D N L R S E K _ N L A A A A Y D C 680 84 ATTGAGA_GTTGGATG GTCTTT CTAATAGTTGTATAGAGTTGAGAC TATAATTTT 0GAaC 144 ATGAC TTCT GATATG CCACCAGTTAGCATGAGa TCAAQCAGGT CTTC TTTTGG CTCAAGT 2184 G_TTTAGATCTC TAT GC_T_GATGC.AQAGC TT C_G C_2TGCACTRAC Q_AG M T 6 D M P P V S M R S 6 R 6 6 • G 6 6 20 E K • R S L C N E K D A E L _ A A L T E 700 204 AAC GGATATGA_AGAC CTTCACACTATTC TTTTGCmACCTCAAATGGG GATGATTATC._T 2244 _AGCAG_ACTTG_TG CGAC TTTCA_T T_AQTTC TAAAGGTTTGGA(L_TATT N G Y E R P 6 H Y S • A T 0 N G D D Y D 40 K _ N L E M R L S K L B 6 K G L E K N I 720 264 AGTGATGGTTCCA_TTTTGCTCCACCCACCCCAACTACTCTCTCATCAGTTCTGTCACCC 2304 AG_GGAG_GGTT G_C_TR_C CAGGTCTTA_AG_GAT CCAGG_.AGAGTTGAGA 6 D G S N • A P _ T P T T L S 6 V L 6 • 68 R K E L V Z A N N _ v L _ K % _ E R L R 740 324 GAACTTG CTGG_GCGATAC CATATATTGACAGATTC CAGG TTGAQUUTTTTTT C_AG_CT 2364 GCTCGTACTATG GATGT GCG CGC TC_GAAGAAAC_GAGG_G CTTTT GAGTG_GA E L A G A • P Y Z D R • Q V Z G • L K A 80 A R T M D V R A A E E T K R K L L 6 E R 760 384 ATGCAA_G CAGC TT CAATCT GCTGGAAAACGTGGG TTCTTTTTAAAAAAATC CGTTGG G 2424 ACATC_C TTGAG_TCATAG GG CTAG_GAA(L_TCAAGT GAGATG Gh_C M Q K 0 L Q B A G K R G F • L K K 6 V G i00 T S L E E K I I Q L E K K K 6 6 E M E N 700 444 CCACAAGTTCGGGAA_AGTT CACATTT GAG GATATGTTGTGTT TCCAAAGGGAACCCATT 2484 CTTCAGAAAGATTT TGAA_GAATG CAAG GCGC TGAG GCT CCAAGT CTC TGAACTTCAA P Q V R E K F T • E D M L C F Q R E P I 120 L _ K D F Z K Z C K A L R L Q V 6 E L _ 800 504 CCAACAT _AT TCT GAAAATAAATG OCGAT CTCGTTG _.AG GACAGTTAAGTTATTT CAG 2544 AG_AACTG(_AGAG GCC_CATGATTTGGTT GT CGCAC GGTCAGGGCTTGAAG CT_,AA P T S Z L K I N G D L V G R T V K L • Q 140 R K L E E A K H D L V V A R 6 G L E A K 828 $64 TCCATTCT GA_GTATATGGGTATTGATT CCTATGATAGAGCAG CTCCAATCAGCTTGGAT 2684 _C._G _CTA_TG CTACA_AT_TT TA_GI_.GCT C_II _IAGCT_I_TG B I L K Y M G I D S Y D R A A P I B L D 160 _ _ z _ z M L _ _ _ AL K E L E E L R E M 840 624 GAGCGAATC_AGCTT_TTGGCAAQCTATTTAAGCAG_GTTGAAQCGGTCTGAGCTTCGT 2664 AAAGAGGACATTGATC_TGAACAAACT GC CAC CATCTTGAAAAT_CAA_G_ CT E R • E L V G K L • E Q A L K R S E L R 180 K E D Z D R K N E Q T A T Z L K M _ • A 060 684 GATCL_ATGTTTGCCCAAATTTCAAAG CAAACAAG CIAATAATCC GGAGAG GCATTC TTTG 2724 CAATTAGCTG GAATG G_AGCG CTTTACC GAGAGGAACAAGTTCT£_G_GTAC TTC D E M • A Q I S K Q T R N N P E R H S L 2O0 5 A G M Z A L Y R E E _ V L R K X Y • 860 744 ATTA_AGCATG GGAG _TAATGTACTTGTGTG _ATC TTGCATG CCTCCGAG CAAGGAAATT 2704 AACA_._ATA_GATAT_G GC/%AGAT C.AGAGT _TAC TGCA_TT_A_AC CT CTTTGT Z K A W E L M Y L C A _ C M P P 6 K E I 220 N T • E D M K G K I R V Y C R L R P L C 980 884 GGTGGATAC TT GTCAGAATATATTCATACT GTTG CACATUGAATTAATACT GATT CTGAG 2844 _G GA_ATTATAGC GAAG _AAG_TGT_AT QA_GT GTTGATGAGTTTACTATT G G Y L 6 E Y Z H T V A H G Z N T D S E 248 E K E Z I A K E R N V M R 6 V D E • T I 920 064 GT TCAAGT TTAT GCAATA_ATACTCTAAATGCGTTGAAAC GTT CTATTAAG GC TGGACC T 2904 GAACATATATGG_GAT_ATAAAGC_C_ACACATGTATGATCGTGT C_'TTGAC G_A V Q V Y A • N T L N A L K R S I K A G P 26O E H Z W K D D K A X Q H M Y D R V • D G 940 924 AG _CACAC GATAC CTG GTCGTGAG GAGAT TGAAG CTCTCTTAACTGGTAAAAAGC TTACT 2964 AATTCCACT C_GATGATGT GTT CGAAGACACTAAGTATTTG _TG CAGTCAGCT GCTGAT R H T Z P G R E E Z E A L L T _ K K L T 280 N 6 T Q D D V F E D T K Y L V Q S A A D 960 904 AC_ATA_T_TTTTT CTTGGATOAAAC_TTCGAAGAA_TTACATATGACATG GCCACAAC G 3024 GGATAT_ATGTTTG CATATTTG CATAT GGAC_CTG GAT CT GGCAAGACAT T_ACAATC T I V F • L D E T F E E _ T Y D M A T T 300 _ s .v...c..__....._..._..9.._.2..._..s.._...._._..._..._._.8.o_ 1044 GTAGCT GAT_ CTATTGAGGAG GTT _CAGG _ATAATCAAAT TGTCTGC TCATQCAAGCTTC 3084 TATGGAGCG GATAGT_,ATC CAGGAC TGACAC CAAGAG CTATATCTGAACTCTTTAG_AT T V A D A Z E E V A G Z Z _ L 6 A H A 6 • 328 Y.G..A..D 6 N P G L T P R A Z S E L • R I I000 1104 AGTCTGTTCGAGTGCCGTAAG_TTGTTACTGGGTCTA_ATCTCCAGATCCTGGAAAT_AG 3144 ATG_G CGAG_TAOTAATAAGTTT TC TTTCTCTTTAAAGG CATACATG GTAGAG TTGTAT S L • _ C R K V V T G S K S _ D P G N E 34O M K R D 6 N K • 6 F 6 L K A Y M V E L Y 1020 1164 GAGTACATTTGT TTGGATGAA£ATAAGTATAT TGGAGATCT_TTG _U_GGACTTTAAG GCA 3204 CAGGATACATTG 8TGGACCT CTTAT TGC C_L_AT GC_q._G CGCTT_GATT GGATATA Y I C L D E N K Y X G D L L E D • K A 360 D T L V D L L L P K N A K R L R L D • 1040 1224 CTAA_AGAC CGAAGTA_AG GGGAGAT TTTG CATT GTAAAC TAAGTTT _G_AGTTG 3264 _TTC-A_GG mCATGG TTT CTGT GG_TGT GACAGTGGTGTCTATTTC_CG L K D R S K _ E • L H C K L 6 F K K K L 880 E K D 6 K G M V 6 V E N v T V V 6 Z S T 1060 1204 TTTC GGGAGT CAGAT GAAGCT GTTACAGAAC CAATGTTC GTGCAATTGTCATATGTTC£A 3324 TATGAG C_ACTT_AGACAAT_ATC CAAAGAG GAT CTG_C_CGTCATAC GAC TG G_qACC F _ E S D E A V T E _ M ¥ V Q L 6 Y V Q 4O0 Y E E L K T Z Z _ R G 6 E O R H T T G T 1080 1344 TTACAACATGATTACATA_TG_ GCAATTATCCT GTT CUCAAG _ATGAT_ CAGCACAGAT Q 3384 TTGATGAAT GAG CAGAGTTCAA_ATCT CAT CTTATAGTTTCAGTTATTATTGAGAGTAC C L Q H D Y • M G N Y P V G K D D A A Q M 42O L M N E _ S 6 R S H L Z V 6 V T _ E S T ii08 1404 TCTGCTCTTCAGATACTGGTTGACATTGGATATGTTGATG_CCCTG_ATCTTGCACTGAC 3444 AATCTTCA_CGCAGGC_ATTGCCAGAGGC_GCTAAGTTTTGT_GATCTTGCTG_CTCA 6 A L _ • L V D Z G Y V D G P E S C T D 44O N L _ T Q A Z A R G K L S F V D L A G S 1120 1464 TGGACAT CAC TG CTGGAG CGTTTTCTACC CAGACAAATTG CAATGACACG GGCAAAGAG_ 3504 GAAAGAGTTAAGAAAT CT GGCTCAGCT GG CAATC_TTAAAAGAAG CTCAAAGCATTAAC W T S L L E R • L P R Q I A M T _ A K _ 460 E I% V K K 6 G S A _ N Q L K E A Q S I N 1140 IS24 C_AT G_GAATT GGATATACTTT CTC GTTACAAATT GATG GAAAATCTGACAA_AGATGAT 3564 AAGTCACTGTCAG CAC TTGGTGAT _TGATAAGT GCATTATCTTCAG G_T CAACACA_T E W E L D I L S R Y E L M E N L T K D D 480 K B L S A L G D V I 6 A L 6 6 G N Q H I 1160 1504 GCCAAACAACAATTT TTGC GGATTCT GAGGACACTT CCTTAT GGAAATTCAG TTTTC TTT 3624 CCTTAT CGGAATCACRAG CTAACCATGT TGATGAG CGAC TCGTTAGGTG GA_TGC TAAA A K Q Q • L R I L _ T L P Y G N 6 V F F 5O0 P Y I% N H K L T M L M S D 6 L G G N A K 1180 1644 GCTGTTCGAAA_ATTGAT GATCCTATTG _AC TT TTG _CTG GUAA_ATCATATTG GGCATT 3884 AC TCTTAT 8TTTGT_ACATC TC TCCAG CAGAAT C_C TTU_IATGAGAC TCAC_CT CC A V R K _ D D P I G L L P 0 X I _ L G I 620 T L M F V N I B P A E 6 N L D E T H N S 1200 1704 AATAAACGTGGGGTTCATTTTTTCCGTCCAGTTCCAAAG _AGTATTTGCACTCA_TGAO 3_44 TTGACGTATGCAT CAAGAGTCCGTTC CAT TGTA_,AT GATCCCAGC_TGTTTCATCT N K R G V H • F R P V P K E Y L H S A E 540 L T Y A B R V R R Z V N D P 6 K N _ 1220 17_4 TTC.AGG CACATAAT GCAATTT GGTA_CAGCAACAC TGCTGT _TTCTT TAAGATGAGAGTT 3004 AAG G_G TCG CTC G_T TAAAGAAGCTAGTG GGATATTGG_G G_AC_.AGC TGGTAG_AAA L _ D _ M Q F G S 6 N T A V F F K H R V 560 KEVARLKKLVGYWKEOAGRK_I2A0 182_ _CTGGTGTCTTG_ATATCTTTCAGTTCAGAACAAAACAGGGAGAG_AAATTTGT_TTGCT 3064 GGGGATGAT GAGGATTTAGAGG_T CC_,AGATC_C GGCC_CT_GAGAAGAC TC_AT A G V L _ i F Q • _ T K Q G E E I C V A 680 G D D E D L E E I _ D E R P T K E K T D 1260 1004 CTACAGACACATATTAkTGATGTGATGTTACGCC_CTACTCA_AAGCCCGTTCTGCAGCT 3924 GGTCGT CATTCGAT GTR_CAT CTA_AAT TG_TG CGTAGAACGAGT _T C_GTTGA L Q T H I N D V M L I_ R Y S K A R S A A 80O G R H 6 M * 1265 1944 AATG QTTG CGTTAATG CAGAT GTTC CAAATAATCT CAAAACTG CAAACAC TGACATTAAT 8804 GCAT CTTGTT TAGTTG CCTCC_TATGAG QAGG_TG GTG_CATTTG_CTG CTTG T N G C V N A D V P N N L K T A N T D I N 620 4044 TCAG CTGGTT TGTACTGCAGC T_/%ATG mTT _A_AT TTTC CTTC CCACL%AT TTTT _TT_T C 4104 ATATAGGGAG GCTTAAAGTATT TAG CTTAG GGAGTCCTAATC CTCAT GTT GTATAGAG CT 2O04 _GAC GCAT TCAG _ATTTG TCTCG CGCCCTTGAhGAAT CTCAGAAG_AAGTCAATGAT 416& ATATGT GTATATTGTACTTTAC_ATCAAT CAATG TTTA n R I _ D L 6 _ A L _ E S _ _ K V N D 640 2064 TTAC TUG_AGAT TTACAT UAAAGG CA_AGAGAAGAAT CGAAGAT GCAAGAAGAATT GGAT L L Z D L H E _ q _ E _ 6 _ M _ Z _ L D 080 92 Fig. 1) and the sequence comparison using the the corresponding region of AKCBP, a CaM- GenBank database revealed that it encodes a binding kinesin-like gene that was recently iso- protein containing a stretch of amino acids at the lated from Arabidopsis [36, 37]. It also has ap- carboxyl terminal end (amino acids 888-1265, preciable sequence similarity to the motor domain Fig. 1) with high homology to the motor domains of the kinesin-like protein (40.5G identity) and of kinesin heavy chains and kinesin-like proteins. kinesin heavy chain (36.570 identity) of Droso- In order to clone the 5' region, the cDNA li- phila melanogaster. Although KatA is another brary was rescreened with 32P-labeled random- kinesin-like gene isolated from Arabidopsis" primed DNA probes using an 843 bp HindIII/ thaliana [25], the motor domain of TCK1 shows PstI fragment (nt 1098-1940, Fig. 1) of the much lower sequence homology (39.8 _ identity) original clone as a template. After three rounds of with that of KATA than AKCBP. This result plaque purification, one positive clone was ob- indicates that TCK1 and AKCBP belong to a tained which contained the complete 5' region. new subfamily of kinesin-like proteins in eukary- The complete nucleotide sequence and the de- otes. duced amino acid sequence of TCKI are shown Like other kinesin-like proteins, TCK1 protein in Fig. 1.The translation initiation codon ATG at also contains an ATP-binding consensus se- position 144 is in the 3795 bp long open reading quence. The amino acid residues 964-984 have frame. In this reading frame, there are two trans- high similarity to the presumptive ATP-binding lation stop codons at positions 60 and 132 in the consensus sequences of kinesin heavy chain and 5'-untranslated region, indicating that TCKI kinesin-like proteins (Fig. 2). This stretch of the cDNA contains the complete coding region. The amino acid sequence has similarity to the ATP- full-length TCK1 codes for a 1265 amino acid binding consensus sequence previously proposed long protein with a predicted molecular mass of [53]. There is another region (amino acids 188- 144 kDa. 320, see Fig. 2)in the motor domain of TCK1 which shows significantly higher homology with the corresponding region of other motor domains. The deduced TCK1 protein conta#Ts a motor do- This region has been implicated in microtubule- main of kinesin binding activity [26, 61]. Members of the kinesin superfamily have a dis- tinct motor domain, a sequence of conserved 340 Secondary structure prediction of TCK 1protein amino acids, which specifies force generation, and motility [10]. This motor domain can be located In addition to the motor domain, most members in the N-terminal [28, 31, 61],the C-terminal [24, of th kinesin superfamily share two other con- 50] or the central region [29] of the molecule. A served structural features: a tail which forms a search of the GenBank protein sequence data- globular domain and a stalk-like region consist- base revealed that the C-terminal region (aa 888- ing of a heptad repeat sequence of amino acids 1265) of TCK 1has extensive sequence homology capable of forming a-helical coiled-coil structures with motor domains of kinesin heavy chains and [50, 61]. However, homology of the amino acid kinesin-like proteins. The secondary structure sequences is very poor outside the motor domain prediction is consistent with this result (see among different kinesin-like proteins [10]. When below). The amino acid sequence was aligned we first obtained the sequence of a segment with presumptive motor domains of a kinesin (amino acids 751-833, Fig. 1) in the stalk region heavy chain and several kinesin-like proteins as of TCK1, a sequence search for homologues in shown in Fig. 2. the GenBank database was performed by using The predicted motor domain of TCK1 shares TFASTA program in GCG. It was found to share highest sequence homology (78.3 _oidentity) with homology (around 30_ identity) with a number 93 AKCBP -- _mZ'._i_ -- -'--'---i '_' r'_ _ -_,_- K Q MF_T T VhIM F_H P W KI2JD_R_H I .... 46 OKAMTANCO Izm_:,li:i'"m_,i_|Vl_Q'*"-llL "'P_._PSDImD.. GEG_NIH_MCCEA_TVW_YHIrAaY_sPTS_ LQQGNJRmGVADLQV_SAGNmKHSKr_GQQI P 4489 DMKHC Ds_[K]_v_F]_N_DSF_EK_G SKF_VKF PNNVEENC I_ ] AG_ ........ V 42 AKCBP i 93 DMK.HC N_ E K_Y N_IA A_ S I_T D V_IA_G r • • S H 92 AKCBP ._T_m_A TK_._ I_._Ri_sKR,_S,_S,,m_YMV_LmQ_Vm n9 KATA Q Klti_rill_l S L E Q I_Q A S Q S L G A Q G_W K Y.K M Q V S MI'_N_-_-_ I RI'_I 147 TDCMKNICD __D . .._[I'__TV__AT[]D i S_RL_._S_R i M K RG Y R N NL GK_B SE[i]Y SE_I'__T_F_N!_yEV-M--_Vymr_ LE_ Q_V_-_ 113495 DMKHC V K QI_IiB_II_N DIIr_HIL_Y A M_E V N .[_!Er_H I_Vs Y_M_'_K I Rr_ 141 TCK 1 177 AKCBP 177 KATA 197 DMNCD 182 •ovs _v_siT_ _ ............ N_v _T_ __ __-_s _m_v DMKHC 176 mmm mu mamu | m nmum ummumm Immmomu mmImmmmmm mm mmnnlmumm m nmu | m mmnmm m nm nmlml mmmm TCKI K T_I_R_S E Q_T T G_'_L_L[! V S_I_E S T_Q_A I A R['6_'_ S,_F_] 227 AKCBP R M_._R[._ S E R_S G_N_L_ S_V_E S I D_Q_S A A R_SF 227 KATA s s_ ___ s_]_ K_O_F_ _ _S_V_[_ s_[_ Qv_VmN_ 247 DMNCD R H T A K M N_'_A T_S_A_A_T K L E L Ir_R H A_'_K_E I S V_S I NL_ 232 DMKHC 226 .... s.,ss-.-...27, mmnmmmmm|_m_mmm|m||m|||mnmmn|m|mmmmmmmm_|m_m||_l AKKACTBAP _-_Ii____K_C L S_A TIeD QR_T_A_S_F_A• ,_ , t, G_S Sml _ 229766 DMNCD _ .... _PKTSTR,M_T_TKNMI_R_EPlTN_'_IL_LQKQD .I[IHIq_ 277 DMKHC _K_S_'_Tr_A Er_T V_D_K N_NE_I_S_IA D_K T_'_ 276 KATA _ y___ Q p C L_.._ D S__2_ I ._ D p T S A GL_ S L C_ R_'-_ A_ ..... N 341 DMNCD _I_ESI_-_HL'_-_M P_ S_ I_V_ F Q D C F Q_ S V K_ R_A S_ ..... N 322 DMKHC D_RI_Q_:__IY_C_S F_IE S_'_K ST_D_-GR_KT[_K_V 326 AKCBP HISS E MV[,RI]_II_ILK_A Y W K EI_IDIIIV D I EDI;_TRK_EADS . . 374 KDA_rNACD_sl_.p_nzM_aa,xa.__m_ _.S.m.A.r._.S.S._mS'__NSS__KS_Fr_.<,=S_.SY_ ..................... ii[ii[ 3__,_ DMKHC V_V NEELTAEEI01KRRYEKEKEKN_RL_'_KVP_K_EIELARWRAGr_TVKAEE 376 TCKI S M378 AKCBP . .374 KATA . .364 DMNCD . .354 DMKHC Q I378 Fig. 2. Comparison of the predicted motor domain of TCKI to those of the kinesin heavy chain and kinesin-like proteins. The ATP-binding consensus sequences are indicated by asolid line. The putative tubulin-binding regions are marked by adashed line. The predicted CaM-binding domain is indicated by a double line. AKCBP, an Arabidopsis kinesin-like protein [37]; KATA, an Arabidopsis kinesin-like protein [35]; DMNCD, aDrosophila kinesin-like protein [24]; DMKHC, aDrosophila kinesin heavy chain [6]]. of myosin heavy chains [54]. The secondary there is a disruption of a short segment (amino structure of TCK 1was predicted with the PEP- acids 716-728) which is unable to adopt an COIL program in GCG [22]. Two stretches of e-helical coiled-coil conformation based on the amino acid residues 614-715 and 729-887 have prediction. The disruption (bend) also exists in a high tendency to form _-helical coiled-coil the presumptive stalk regions of kinesin heavy structures (Fig. 3). Between these two regions, chains and other kinesin-like proteins [24, 62]. A 94 1.0 I,..- m 0.5 Ix , --. 600 1200 i!iiilfiiii !iiiliiil ENI o B'NOI'NO LEUCINE CaM-BINDING ZIPPER DOMAIN MOTIF Fig. 3. Structural features of TCK1. A. c_-helical coiled-coil structure was predicted using PEPCOIL in GCG for a window of 28 amino acid residues [22]. The numbers on the Y-axis indicate the probability of forming coiled-coil structure. B. A schematic representation of the structure of the TCK1 protein. schematic diagram illustrating the structural fea- The deduced TCK1 protein contains a calmodulin- tures of TCK1 is shown in Fig. 3B. As shown in binding domain the figure, TCK1 has three distinct domains: a tail, stalk, and a motor domain. The fact that TCKI gene was isolated by screen- Examination of the TCK1 sequence revealed ing a cDNA expression library using 35S-labeled the presence of a leucine zipper motif in the stalk calmodulin as a probe strongly suggests that region (Fig. 1). Five leucine residues occur in the TCKI encodes a calmodulin-binding protein. In heptad repeat from the amino acid residue 803 to a recently characterized kinesin-like protein, a 837. One of the known functions of the leucine calmodulin-binding domain was mapped to a zipper motif is to participate in the formation of stretch of 52 amino acids in the C-terminal region dimers in some proteins [52]. The presence of a [36, 37]. To determine if the calmodulin-binding leucine zipper motif strongly indicates that the domain is located in the C-terminal domain of the stalk region may be involved in dimerization. TCK1 gene product, a fusion protein of glu- tathione-S-transferase and amino acids 1214 to 1265 was prepared using a pGEX-3X fusion pro- tein expression vector. The E. coli expressed fu- J 95 sion protein was affinity-purified using a gluta- alone did not show calmodulin binding (Fig. 4B). thione-Sepharose column. SDS-PAGE revealed The GST(1214-1265) also bound to calmodulin- that the molecular weight of purified protein Sepharose column in the presence of Ca2+. After GST(1214-1265) was 33 kDa (Fig. 4A). The washing the column with a buffer containing GST alone was expressed, purified, and used as 0.5 M NaC1, the protein was still bound to the a negative control in our binding experiments. column. The fusion protein was etuted from the These proteins were electrophoretically trans- colunm by adding 2 mM EGTA, indicating that ferred from the polyacrylamide gel onto a nitro- the fusion protein binds to calmodulin in a Ca 2+ cellulose filter, and used for a biotinylated calm- dependent manner (Fig. 4C). These results fur- odulin overlay assay. The purified GST(1214- ther confirm that the C-terminal region of the 1265) bound to Ca z+ rcalmodulin while GST TCK1 gene product contains a calmodulin- C B 3 4 5 6 7 8 9 10 205- iii_ili_iiill 116- ! 97- I 205- i_: .:_. 116' 97- 66 ~ i:!:!:i:!:i 29- ::;::::::::::::: !:i:i:i:i:i:i:!:i iiiii!!iiiiiiiii !iiiiiiiiiiii!i!! 45- iiiii!i!i!iiiiiil ::::::::::::::::::::::: 29- i D Fig. 4. Calmodulin-binding activity of fusion protein contain- ing the C-terminal domain of TCK1. A. SDS-PAGE of af- finity -purified GST and GST(1214-1265) proteins. Gel was stained with Coomassie Brilliant Blue. Positions of molecular [] weight markers are indicated in kDa on the left. B. Biotiny- lated calmodulin overlay assay of the same proteins used in A. C. Ca 2+ -dependent binding of the GST(1214-1265) protein [] to calmodulin-Sepharose column. The purified GST(1214- 1265) protein (20/_g) was loaded twice on the column con- taining 0.2 ml calmodulin-Sepharose beads in the presence of 1mM CaCI,, and eluted with buffer containing 2.5 mM EGTA. Column effluent and EGTA-eluted fractions (0.1 ml each) were analyzed by SDS-PAGE and the protein bands were visualized by Coomassie Brilliant Blue. Lane 1, the protein before loading; lane 2-9, EGTA-eluted fractions; lane 10, effluent of the loaded protein• D. Helical wheel plot of amino acid residues 1218-1240 of TCK1 showing that it forms a basic amphiphilic a-helix. The hydrophobic amino acid resi- dues are boxed. 96 bindingdomain.Furthermoret,hehelical-wheel presence of microtubules, indicating that like plotoftheaminoacids1218-124o0fTCK1forms other kinesin heavy chains, TCK1 has microtu- abasicamphiphilica-helix(Fig.4D),commonly bule-stimulated ATPase activity. foundin thecalmodulin-bindinsgitesofmany proteins[32]. TCK1 is a single-copy gene and expressed in all organs A TPase activity isassociated with the motor domain To determine the approximate copy number of It has been shown that the motor domain of ki- TCK1, Southern blot analysis of tobacco genomic nesin heavy chain contains ATPase activity that DNA was carried out (Fig. 6). Both EcoRI- and is stimulated by microtubules [3]. To test if the HindIII-digested DNAs have one hybridizing motor domain of TCK1 has microtubule-stimu- band, indicating that TCKI was coded by a lated ATPase activity, the E. coli expressed motor single-copy gene. However, EcoRV-digested domain (824-1265) was purified (Fig. 5A) as- DNA showed two hybridizing bands. This ismost sayed for ATPase activity in the presence and likely due to the presence of an intron containing absence of microtubules. As shown in Fig. 5B, EcoRV sites in the genomic DNA corresponding the motor domain has basal ATPase activity to the cDNA probe or a minor polymorphism in which was stimulated by about three-fold in the two sets of tobacco genomes. To study the expression of TCKI, northern blot analysis was carried out using poly(A) + RNA. A B The length of the TCKI transcript is ca. 4.5 kb and matches the length of the cDNA. The tran- 150 116- iiiiiii;iiiiil)i 1 2 3 88-i 100 E - 23.1 N _///_ ,'_tf_'/.4/ _: - 9.4 O E e, -6.6 29-i!i iiii:i!i: -4.4 :::::::5• 1 -2.3 -2.0 Fig. 5. ATPase activity of the motor domain of TCK1. A. SDS-PAGE of the afffinity-purified GST(824-1265) protein which was used for ATPase assays. The gel was stained with Coomassie Brilliant Blue. B. ATPase activity of motor domain in the presence and absence of microtubules. Assays were performed in triplicate. Control assays whithout motor do- main and microtubules alone were performed to determine background counts and were subtracted prior to calculating -0.6 the ATPase activity of motor domain alone (I) and motor domain plus microtbules (2). The background counts for with- out motor domain and microtubules alone were 514 + 10 and Fig. 6. Genomic Southern blot analysis of TCK1. The size of 918 _+28 cpm, respectively. SD of triplicate assays are pre- standard markers is shown in kb on the right. Lane 1,EcoRI; sented. lane 2, EcoRV; lane 3, HindIII.