Logout succeed
Logout succeed. See you again!

A revision of the Portunus pelagicus (Linnaeus, 1758) species complex (Crustacea: Brachyura: Portunidae), with the recognition of four species PDF
Preview A revision of the Portunus pelagicus (Linnaeus, 1758) species complex (Crustacea: Brachyura: Portunidae), with the recognition of four species
THE RAFFLES BULLETIN OF ZOOLOGY 2010 THE RAFFLES BULLETIN OF ZOOLOGY 2010 58(2): 199–237 Date of Publication: 31 Aug.2010 © National University of Singapore A REVISION OF THE PORTUNUS PELAGICUS (LINNAEUS, 1758) SPECIES COMPLEX (CRUSTACEA: BRACHYURA: PORTUNIDAE), WITH THE RECOGNITION OF FOUR SPECIES Joelle C. Y. Lai Department of Biological Sciences, National University of Singapore, 14 Science Drive 4, Singapore 117543, Republic of Singapore Email: [email protected] Peter K. L. Ng Tropical Marine Science Institute and Department of Biological Sciences, National University of Singapore, 18 Kent Ridge Road, Singapore 119227, Republic of Singapore Email: [email protected] Peter J. F. Davie Queensland Museum, PO Box 3300, South Brisbane, Queensland, Australia Email: [email protected] ABSTRACT. – The systematics of the commercially important swimming crab, Portunus pelagicus (Linnaeus, 1758), is revised and four distinct species, P. pelagicus (Linnaeus, 1758), P. segnis (Forskål, 1775), P. reticulatus (Herbst, 1799) and P. armatus (A. Milne-Edwards, 1861), are recognised based on morphological and DNA characters as well as biogeographical considerations. A key to the species is provided. The species can be separated by a combination of characters of the carapace, pereiopods, male abdomen, male fi rst gonopod, and differing colour patterns. Portunus pelagicus sensu stricto is widespread across Southeast and East Asia and is sympatric with P. armatus in the Northern Territory, northern Australia. Portunus armatus is found around most of Australia and east to New Caledonia. Portunus reticulatus occurs in the eastern Indian Ocean and there is evidence that the Bay of Bengal may be a zone of hybridisation for P. pelagicus and P. reticulatus. Portunus segnis appears confi ned to the western Indian Ocean from Pakistan to South Africa, and is a Lessepsian migrant into the Mediterranean from the Red Sea. KEY WORDS. – Portunus pelagicus, Crustacea, Brachyura, Portunidae, species-complex, taxonomy, molecular phylogenetics, spanning networks. INTRODUCTION name Scylla serrata (Forskål, 1755)] in 2001 (FAO, 2007). The fi shery for P. trituberculatus, however, is restricted to Decapod crustaceans form a major component of commercial China, Japan and Korea, and the wider Indo-West Pacifi c fi sheries in the Indo-West Pacifi c region. The market demand distribution of the four Scylla species and P. pelagicus for both the wild caught and aquaculture product is sustained make them more valuable commodities across many more and signifi cant, with over 1.5 million tonnes landed each year countries. In particular, the abundance of P. pelagicus and (Otto et al., 2001). The crab fi shery is dominated by a few increasing demand for this species for the frozen and tinned members of a single family, the Portunidae. They include crabmeat industry throughout the Indo-West Pacifi c makes four species of mud crab (genus Scylla De Haan, 1833), the it a particularly valuable target species. blue swimming crab [Portunus pelagicus (Linnaeus, 1758)] and the gazami crab [P. trituberculatus (Miers, 1876)] (also In recent years, genetic analyses in combination with see Ng, 1998). morphometric and morphological studies have shown that the mud crab Scylla serrata (Forskål, 1775) is a complex Portunus trituberculatus dominates the official global of four similar species (Keenan et al., 1998). Likewise, catch, with disclosed landings of 346,982 tonnes in 2004, the commercially important shovel-nosed lobster Thenus compared with 199,731 and 19,344 tonnes, respectively, for orientalis (Lund, 1793) was found to be a species complex P. pelagicus and the Scylla species [then combined under the comprising fi ve species (Burton & Davie, 2007). These 199 Lai et al: Revision of the Portunus pelagicus species complex studies suggest that the evolutionary history of speciation examined, we have attempted to attribute literature records across the Indo-West Pacifi c region is more complex than based on the descriptions and figures. Records without previously thought, and that other putative widespread species clear data were regarded as incertae sedis and are treated may also show similar patterns if carefully scrutinised. While separately. Where a type specimen was lost or destroyed, Portunus pelagicus is reportedly widespread throughout the a neotype was designated to stabilise the name and prevent Indo-West Pacifi c region, there have been indications that it subsequent confusion. may be a species complex. Published descriptions and fi gures of P. pelagicus from Africa, Asia, India and Australia, when Material examined is deposited in the following institutions: compared directly, show that several distinct colour morphs MNHN - Muséum national d’Histoire naturelle, Paris, exist. Nonetheless, earlier taxonomic reviews regarded France; MPL – Mauritius Institute, Port Louis, Mauritius ; these differences as mere geographic variants (Stephenson, MZUF – Museo Zoologico La Specola dell’Università di 1968b), although Stephenson (1972a) speculated that such Firenze, Italy; NHM – Natural History Museum, London, regional variability was the result of speciation processes at United Kingdom; NHMW – Naturhistorisches Museum work. Dissimilarity in larval morphology has also suggested in Wien, Vienna, Austria; QM – Queensland Museum, that the Indian, Pacifi c and Australian populations of P. Brisbane, Australia; RMNH – Naturalis (ex Rijksmuseum pelagicus may constitute different species (Prasad & Tampi, van Natuurlijke Historie), Leiden, The Netherlands; SAM 1953; Shinkarenko, 1979; Yatsuzuka & Sakai, 1980). An – South Australian Museum, Adelaide, Australia; SMF allozyme study of various populations of northern Australian – Senckenberg Museum Forschungsinstitut, Frankfurt am P. pelagicus by Bryars & Adams (1999) showed that there Main, Germany; WAM – Western Australia Museum, Perth, were two genetically distinct populations in the northern Western Australia; ZMB – Zoologisches Museum Berlin, waters around Darwin. Berlin, Germany; ZMUC – Zoological Museum, University of Copenhagen, Copenhagen, Denmark; ZRC – Zoological The present study was therefore initiated to determine Reference Collection, Raffles Museum of Biodiversity whether Portunus pelagicus is a species complex, and, if so, Research, National University of Singapore, Singapore. the number of species, and the genetic and morphological distinctions between them. To do this, we obtained specimens Morphometrics. – Fourteen measurements were taken (Fig. 1; of P. pelagicus from throughout its known geographic range, Table 1), and standardised using ratios. Statistical tests were and have used DNA, morphometric and morphological undertaken using SPSS 11.5 (SPSS, Inc., Chicago, IL). Data methods to examine them. were tested for normal distribution using the Kolmogorov- Smirnov-test. Morphometric ratio comparisons between individual males from different geographic regions were MATERIALS AND METHODS carried out with a one-way ANOVA and a post hoc Schefe test for comparison between groups. Stepwise discriminant Specimen collection. – Specimens of Portunus pelagicus analyses (DA) were performed to determine groupings. sensu lato were collected from 25 localities throughout its Owing to sexual dimorphism, only males were used for this reported range. These included Japan, Indonesia, Australia, portion of the study. Missing values were substituted by Singapore, Thailand, Sri Lanka, India, Madagascar, Israel group means. The default F-value of 3.0 was assigned as the and the United Arab Emirates. In particular, type specimens minimum value for variables to enter the model. of all available names currently considered to be synonyms were examined, and fresh specimens from type localities were Genetic analyses. – Localities and numbers of specimens obtained whenever possible [e.g., from the Red Sea, the type sampled for DNA analyses are given in Table 5. Freshly locality of P. segnis (Forskål, 1775)]. Fresh specimens were collected specimens were preserved in 95% ethanol. Total collected by colleagues, ourselves, or obtained from markets DNA was isolated using Qiagen’s DNeasy Tissue Kit at fi shing ports. Samples were preserved in 95% ethanol. following the manufacturer’s protocol. DNA was eluted in between 50 to 100 µl of elution buffer AE and stored at Morphological examination and taxonomy. – Measurements -20°C. All buffers used in the procedure were supplied in the were made to the nearest 0.1 mm using electronic vernier kit with the exception of 100% absolute ethanol. calipers, and drawings were made using a camera lucida attached to a stereomicroscope. Terms and defi nitions used in The COI gene was amplified using Polymerase Chain this study follow Wee & Ng (1995). Measurements provided, Reaction (PCR) with universal primers COIa (5ʹ– in millimeters, are of the carapace width (taken at the widest AGTATAAGCGTCTGGGTAGTC–3ʹ) and COIf (5ʹ– point) and length (taken from the median frontal teeth to CCTGCAGGAGGAGGAGATCC–3ʹ) obtained from the posterior border of the carapace) (Fig. 1), respectively. Kessing et al. (1989). This primer pair amplifi es a COI G1 and G2 refer to the male fi rst and second gonopods, fragment that corresponds to positions (5ʹ to 3ʹ) 681–1294 respectively. of the mitochondrial genome. PCR were performed in a fi nal volume of 50 µl containing 5 µl 10× Taq Polymerase In addition to freshly collected material, specimens were Buffer, 5 µl (25 mM) MgCl), 5 µl 0.5 mM dNTPs, 1 unit 2 borrowed from museums, especially available type material. Taq polymerase (Perkin Elmer) and 0.5 µl each of 25 pmol/µl Where historically reported material could not be re- COIa and COIf. 200 THE RAFFLES BULLETIN OF ZOOLOGY 2010 An initial denaturation step of 94°C for 2 minutes was The purifi ed PCR product was subject to cycle sequencing followed by 30 cycles of 1 minute at 94°C, 1 minute at 50°C using the ABI PRISM® Dye terminator kit containing and 1.5 minutes at 72°C. All PCR products were checked for AmpliTaq and BigDye (ver. 3) dye terminator. Each positive amplifi cation by visualising its presence compared sequencing reaction volume comprised of 5–8 ng of PCR with a 100 bp DNA ladder (Promega, Madison, USA) when product, 1 µl of BigDye, 0.5 µl of 5x BigDye sequencing electrophoresed in a 1% agarose gel stained with ethidium buffer, 0.4 µl of sequencing primer (COIa or COIf, 2pmol/µl) bromide. Positively amplifi ed fragments were purifi ed from and topped up to 5 µl with sterile Milli-Q water. The cycle excess dNTPs and primers using QIAquick PCR purifi cation sequencing profi le comprised 30 cycles of 30 sec at 95°C, 15 columns (Qiagen) following the manufacturer’s protocol. sec at 50°C and 4 minutes at 60°C. All extension products Fig. 1. Schematic drawings of a generalized Portunus pelagicus illustrating morphological terms and measurements used in the study. A, dorsal surface and appendages; B, cheliped; C, pereiopods; D, abdomen. 201 Lai et al: Revision of the Portunus pelagicus species complex Table 1. List of dimensions measured and ratios used in morphometric analyses. Character measured Ratio derived Carapace Carapace length (CL) Carapace width (excluding 9th anterior-lateral tooth) (CW1) CW1/CL Carapace width (including 9th anterior-lateral tooth) (CW2) CW2/CL Appendage Major cheliped merus length (MEL) Major cheliped merus width (MEW) MEL/MEW Major cheliped manus length (MAL) Major cheliped dactylus length (DAL) MAL/DAL 4th pereiopod merus length (4PL) 4th pereiopod merus width (4PW) 4PL/4PW Natatory leg dactylus length (NDL) Natatory leg dactylus width (NDW) NDL/NDW Abdomen Penultimate segment length (PL) Penultimate segment width (PW) PL/PW Telson width (TW) PL/TW are purifi ed using ethanol and sodium acetate precipitation. Haplotype parsimony network. – Identical COI sequences Sequences were read using the ABI 3100 automated capillary were collapsed into distinct haplotypes and relationships sequencer. between haplotypes were analysed in a parsimony network estimated with TCS version 1.21 (Clement et al., 2000) using Sequence analyses. – To avoid pseudogenes (Bensasson the statistical parsimony procedure described in Crandall et al., 2001; Gusmão et al., 2000; Mathews et al., 2002; (1994) and Templeton et al. (1992). This method estimates Williams & Knowlton, 2001), sequences with ambiguous the unrooted tree and provides a 95% plausible set for all chromatograms were discarded and the remainder were sequence type linkages within the unrooted tree. Outgroup weights were calculated following Castelloe & Templeton translated to amino acids to check for stop codons. Sequence (1994), which predicts the oldest haplotype based on neutral contigs were aligned by eye using the programme Sequencher coalescent theory applied to intraspecifi c networks (Posada version 4.0 (Genecodes, Ann Arbor) and subsequently aligned & Crandall, 2001). with ClustalX Multiple Sequence Alignment Program version 1.7 (Thompson et al., 1997) using preset settings and edited Species delimitation. – The barcoding hypothesis of fi xed in MacClade v.4.08 (Maddison & Maddison, 2005) before inter- and intra-specifi c divergence thresholds at the COI being exported into MEGA (Kumar et al., 2004), Arlequin locus (Hebert et al., 2003) was tested by plotting pair-wise v.3.00 (Schneider et al., 2000), PAUP* 4.0b10 (Swofford, percentage divergences within and between sequences for all 2002) and TCS (Clement et al., 2000) for further analyses. four species. However for clarity, we specifi cally excluded the haplotypes of P. reticulatus that are the same as P. pelagicus Tree reconstruction. – We used Modeltest ver. 3.7 (Posada (see Results). & Crandall, 1998) to determine the substitution model for the dataset with the resultant best fi t model using the Akaike Information Criterion (AIC) being Tamura-Nei (TrN) + RESULTS invariable sites (I) + gamma distribution (G). Two tree search methods [Maximum Parsimony (MP) and Minimum To prevent confusion, the term Portunus pelagicus sensu lato Evolution (ME)] were used to infer relationships between henceforth applies to the broad concept of the species as it putative species. A heuristic tree search was conducted has been considered to date. Portunus pelagicus sensu stricto using the MP algorithm with 100 random sequence additions refers to the revised and restricted concept of the species as and tree bisection-reconnection branch swapping. Three defi ned by the present study. other portunid species were used as outgroups: Charybdis lucifera (Fabricius, 1798), Portunus sanguinolentus (Herbst, In total, 468 specimens were examined. These include 127 1873) and P. trituberculatus (Miers, 1876). PAUP* 4.0b10 individuals from the Pacifi c, 149 from the Western Indian (Swofford, 2002) and MEGA version 2.0 (Kumar et al., 2004) Ocean and Persian Gulf region, 49 from east of the Indian were used for MP and ME tree construction, respectively. subcontinent, Sri Lanka and Andaman sea, and 143 specimens Topological robustness was assessed with 1,000 bootstrap from Australia and New Caledonia. replicates for both methods. 202 THE RAFFLES BULLETIN OF ZOOLOGY 2010 Table 2. List of nominal names associated with Portunus pelagicus, authority and type locality. Name Author Type locality Type material status Cancer pelagicus Linnaeus, 1758 Ambon, Moluccas Lost; neotype designated Cancer segnis Forskål, 1775 Jeddah, Red Sea Lost; neotype designated Cancer cedonulli Herbst, 1794 East Indian Sea Lost; neotype designated Cancer reticulatus Herbst, 1799 East Indian Sea Lectotype deposited at the Berlin Zoological Museum. Portunus denticulatus De Procé, 1822 Philippines Lost; neotype designated Portunus armatus A. Milne-Edwards, 1861 Shark Bay, Western Australia Lectoype deposited at Natural History Museum, London Portunus pelagicus var. sinensis Shen, 1932 China Holotype deposited Zoological. Museum Fan Memorial Institute of Biology Portunus mauritianus Ward, 1942 Mauritius Holotype deposited at Desjardins Museum, Mauritius. Sixty-four specimens were measured for discriminant 4.786; P< 0.05); and 3) cheliped manus to dactylus (MAL/ function analyses, and partial COI sequences were obtained DAL) (df = 3, F = 9.549; P< 0.01). The post hoc Schefe’s test from 300 individuals of P. pelagicus sensu lato collected from also showed that CW2/CL is signifi cantly different between 25 localities (Table 5). A minimum of three individuals per Portunus armatus and P. segnis (P < 0.05), MEL/MEW is population was sampled, although it was only possible to signifi cantly different between P. armatus, P. reticulatus sample a single specimen from Pakistan as the specimens and P. pelagicus (P < 0.05), and MAL/DAL is signifi cantly were severely decayed and damaged in transit. different between P. pelagicus and P. reticulatus, and P. pelagicus and P. armatus (P < 0.05). Morphology. – Morphological character analysis initially suggested four natural groupings: — 1) a true Portunus Genetics. – Three hundred individuals of P. pelagicus sensu pelagicus morphotype predominantly distributed in Southeast lato were sampled from 25 populations across the Indo- Asia; 2) a distinctive Australian morphotype; 3) another West Pacifi c, and were found to consist of 128 specimens morphotype in the eastern Indian Ocean centred on the of P. pelagicus sensu strict, 50 specimens of P. armatus, 77 western Bay of Bengal through to the Andaman Sea; and specimens of P. reticulatus, and 45 specimens of P. segnis. a final morphotype in the western Indian Ocean. These For P. reticulatus, the sample size includes 21 specimens groupings thus formed the species concepts that we tested using genetic and morphometric techniques. There are seven available names in the synonymy of P. pelagicus sensu lato that are potentially available to use for the four recognised morphotypes (Table 2). The full justifi cation of our decisions regarding valid name allocation is given under the systematic accounts. However, to simplify discussion of the results of the morphometric and genetic analyses we here use the following names for the four species now recognised: Portunus pelagicus (Linnaeus, 1758), P. segnis (Forskål, 1775), P. reticulatus (Herbst, 1799) and P. armatus (A. Milne-Edwards, 1861) (see Table 3 for synonyms and distribution summaries). Morphometrics. – Results of the canonical analysis of the output from the discriminate function analysis are given in the scatter plot (Fig. 2) with 80.6% of original grouped cases correctly classifi ed. Of eight variables tested, only three were signifi cantly different in single character ratios whilst no clear groupings (with a 95% confi dence interval) could be elucidated with discriminant function analysis. One-way ANOVA analyses of ratios among males of different species revealed signifi cant differences in: 1) carapace width to Fig. 2. Scatter plot of canonical scores from forward stepwise carapace length (CW2/CL) (df = 3, F = 4.153; P< 0.05); 2) discriminant function analysis. Group 1, Portunus armatus; 2, P. cheliped merus length to width (MEL/MEW) (df = 3, F = reticulatus; 3, P. segnis; 4, P. pelagicus. 203 Lai et al: Revision of the Portunus pelagicus species complex Table 3. Names assigned to each morphotype group, synonymies if any, and geographic distribution. Morphotype group Synonyms Distribution P. pelagicus sensu stricto P. cedonulli West Pacifi c Ocean; Japan to Indonesian Archipelago, P. denticulatus Straits of Malacca to Thailand. Northern Territory, P. pelagicus var. sinensis Australia, Bay of Bengal (?) P. segnis P. mauritianus West Indian Ocean; West of Indian sub-continent, Pakistan, Persian Gulf, Red Sea, Mediterranean Sea, East coast of Africa. P. reticulatus None East Indian Ocean; East of Indian subcontinent, Sri Lanka, Bay of Bengal P. armatus None Australia, New Caledonia possessing haplotypes considered typically P. pelagicus Fig. 3, haplotype 32 in Fig. 5A, C). The sister species to P. (Figs. 3, 5). Furthermore, there is a clade comprising two pelagicus is P. segnis, collected from the Western border of individuals collected from Japan that may possibly represent the Indian Ocean and the Red Sea with relatively high ME a cryptic species. Due to sampling constraints and other bootstrap support (98%). Two specimens of “P. pelagicus” circumstances, voucher specimens were not always kept. collected from the northwestern Pacifi c in Kyushu, Japan, Of the 300 individuals, 109 unique COI haplotypes were possessed two unique haplotypes which were not only obtained. All unique haplotype sequences have been deposited signifi cantly divergent from the rest, but also make up a in Genbank (accession numbers EF661877–EF661976 and sister clade with P. reticulatus and P. armatus (“**” in Fig. GQ272555–GQ272564). A total of 102 polymorphic sites 3). Unfortunately, due to administrative and legal constraints and 113 substitutions (91 transitions, 22 tranversions) out beyond our control, only tissue samples were kept from these of 573 basepairs (i.e., 17.8% variable sites) were observed two specimens and we were unable to further assess them for all four species. morphologically. Thus, they are not further considered in the following taxonomic account but neverthess possibly Haplotype and nucleotide diversities of individual populations represent a fi fth cryptic species. ranged from 0 to 1 and 0 to 0.013 respectively. Tables 4 and 5 summarise various population parameters as calculated The next well-supported clade with a bootstrap value of 99% comprises haplotypes obtained from individuals of by Arlequin for each species, and by species populations P. reticulatus and P. armatus, collected from two distant respectively. Portunus segnis was collected from locality geographic regions, India/Sri Lanka, and Australia/New codes 1–5; P. reticulatus, 6–8; P. pelagicus, 9–18 and P. Caledonia. Owing to low percentage divergence between armatus, 19–25. Sample size is denoted by n, number them, their relationships could not be resolved with a high of haplotypes (Nh), number of polymorphic sites (Np), degree of confi dence (i.e., moderate to insignifi cant bootstrap haplotype diversity (h) and nucleotide diversity (π). In value for P. reticulatus and P. armatus clades respectively) general, each species group displayed high haplotype diversity even though haplotypes obtained from these two species and low nucleotide diversity. are distinctly unique with no overlap (note, however, the overlap of haplotypes between P. pelagicus and P. reticulatus Phylogenetics. – Phylogenetic analyses were carried out using as discussed above). the entire data set of 109 unique haplotypes. Both analyses reproduced trees of the similar topology as that shown in Species delimitation. – Maximum and minimum inter-specifi c Fig. 3. Out of 573 characters used in the analysis, 106 were divergence between these four species ranged between parsimony informative, and the MP tree recovered had a 8.8% and 1.2% while intra-specifi c divergence ranged from length of 275 steps (CI = 0.771 and RI = 0.757). While it is between 0% to a maximum of 2% (Fig. 4). The overlap clear that the species complex is closely related and that each between inter and intra-specifi c divergence (Fig. 4A) is terminal clade (with the exception of the P. armatus clade) singularly attributed to low genetic differentiation between shows high bootstrap support (>80), it was not possible to P. reticulatus and P. armatus; haplotypes of these two species infer which of the four species is basal to the rest as they were were connected together when a parsimony network was polarized into two distinct dichotomies. Average inter-specifi c constructed using TCS. percentage divergences for the four species are reported in Table 6 and the frequency histograms of both inter and intra- Despite this low divergence, no common haplotypes are specifi c divergence is illustrated in Fig. 4. shared between these two species. Although they can be considered as a single molecular taxonomic unit because of Owing to more intensive sampling effort for P. pelagicus, a this, morphological differences between these two species higher degree of polymorphism was observed. Interestingly, suggest otherwise (see Systematic account for detailed 21 out of 77 specimens of P. reticulatus (27%) collected discussion). Inter-specifi c divergence between P. segnis and from India, Sri Lanka and Phuket shared the same or similar P. pelagicus ranged from 3.2–4.8% accounting for the peak in haplotypes common to P. pelagicus (annotated by "*" in frequency denoted by “B” in Fig. 4, whilst the range shown 204 THE RAFFLES BULLETIN OF ZOOLOGY 2010 Fig. 3. Minimum Evolution bootstrap tree incorporating all unique COI haplotypes. Haplotypes of specimens obtained from Portunus pelagicus, P. segnis, P. reticulatus and P. armatus with P. trituberculatus, P. sanguinolentus and Charydis lucifera as outgroups. ‘*’ Indicates the dominant haplotype found in P. pelagicus shared with eight P. reticulatus individuals. ‘**’ Denotes two individuals collected from Japan that may constitute a possible cryptic species. 205 Lai et al: Revision of the Portunus pelagicus species complex Table 4. Species population parameters. Sample size is denoted by (n), number of haplotypes (Nh), number of polymorphic sites (Np), haplotype diversity (h, to 3 decimal places) and nucleotide diversity (π, up to four decimal places). Superscript 1 and 2 refer to analysis of P. reticulatus haplotypes excluding those shared with P. pelagicus and analysis of P. pelagicus haplotypes excluding two haplotypes found from Japan that may constitute a possible cryptic species respectively. Species N Nh Np h π Portunus armatus 50 29 38 0.950 ± 0.017 0.0189 ± 0.0097 Portunus reticulatus 77 22 52 0.776 ± 0.040 0.0570 ± 0.0279 Portunus reticulatus1 54 17 17 0.649 ± 0.076 0.0018 ± 0.0014 Portunus segnis 45 11 15 0.753 ± 0.045 0.0076 ± 0.0042 Portunus pelagicus 128 49 58 0.925 ± 0.013 0.0138 ± 0.0071 Portunus pelagicus2 126 44 39 0.891 ± 0.020 0.0056 ± 0.0032 in “C” accounts for all divergences between P. armatus/P. dominating across the entire region, in consensus with the reticulatus and P. pelagicus/P. segnis. ME tree (Fig. 3). The exceptions are haplotypes 32 and 58, which occur in both P. reticulatus and P. pelagicus. Intraspecifi c haplotype relationships. – Four haplotype statistical parsimony networks generated by TCS were Haplotype network for P. pelagicus: Portunus pelagicus obtained from sequence data of all four species and they sensu stricto (Fig. 5A) shows high degrees of haplotype are presented in Fig. 5. diversity. There are at least three widespread haplotypes with Haplotype 32 occurring with the highest frequency (n = 25) The relationships between haplotypes of Portunus pelagicus, and in the most localities (6). Haplotype 32 is also common P. segnis, P. reticulatus and P. armatus are illustrated (Fig. in P. reticulatus (n = 18). The remaining 25 individuals of 5A, B, C, D, respectively). One network we have not shown P. pelagicus possessing Haplotype 32 make up 19.4% of the consists of two haplotypes from the three northern Pacifi c total number of individuals collected from the Pacifi c (n = specimens (marked ** in Fig. 3). These are separated from 129). The next most common haplotype, Haplotype 58 (n each other by a single mutational step, but differ from other = 17) differs from Haplotype 32 by a single mutation step. P. pelagicus haplotypes by at least 25 mutational steps, and The third most common haplotype (Haplotype 51) comprised may represent a cryptic fi fth species. Each circle represents a 16 individuals. Together, these three haplotypes account for unique COI haplotype; the size of the circle refl ects haplotype 45% of the individuals sequenced. Thirty-seven haplotypes frequency and small unshaded circles represent a putative were singletons, appearing only in a particular individual single mutation that was not sampled in the study, but while fi ve haplotypes, Haplotype 57, 76,79, 97, 98 were would join all haplotypes within a 95% statistical confi dent private, i.e., it occurred in more than one individual, but parsimony network if present. were restricted to a single locality. There are weak star-like phylogenies radiating from haplotypes 32, 51 and 58 but a Based on the parsimony network, most haplotypes are species high number of uncommon haplotypes spread out throughout specifi c and geographically restricted with no single haplotype the network for P. pelagicus were noted. Haplotype network for P. segnis: haplotypes obtained for P. segnis (Fig. 5B) show two co-dominant haplotypes separated from each other by two mutational steps. Haplotype 102 (n = 16) is obtained from individuals collected from Mozambique and Madagascar while Haplotype 99 (n = 16) is restricted to the Red and Mediterranean Seas. Of the remaining nine haplotypes, six are singletons, one is shared between two individuals and the other is shared amongst three. Haplotype network for P. reticulatus and P. armatus: due to low genetic divergence, COI haplotypes from individuals of P. armatus and P. reticulatus were joined together within the same parsimony network, but separated by a small but discrete break of fi ve mutation steps at the 95% confi dence interval (fi gure not shown). However, the two gene networks separate at a 99% confi dence limit (Fig. 5C, D). At this level, the four haplotypes obtained from P. armatus collected from Fig. 4. Frequency histogram of intra and inter-specifi c divergence New Caledonia separate from the main network as well. for COI locus for the four species excluding outlier haplotypes for clarity. A, Divergence between Portunus armatus and P. reticulatus; Despite this low divergence, the patterns of relationships B, divergence between P. pelagicus and P. segnis; C, divergence between P. armatus/P. reticulatus and P. segnis/P. pelagicus. between haplotypes found within these two species differ. 206 THE RAFFLES BULLETIN OF ZOOLOGY 2010 Table 5: List of localities and number of specimens used for each species. Sample size is denoted by (n), number of haplotypes (Nh), number of polymorphic sites (Np), haplotype diversity (h, to 3 decimal places) and nucleotide diversity (π, to 4 decimal places). Code Species/Locality n Nh Np h π Portunus segnis 1 Israel: off Ashjod 18 6 8 0.562 ± 0.134 0.0038 ± 0.0022 2 United Arab Emirates: Abu Dhabi 5 2 1 0.400 ± 0.237 0.0014 ± 0.0014 3 Pakistan 1 1 0 0.000 0.000 4 Madagascar: Tulear 18 18 2 0.4640 ± 0.125 0.0009 ± 0.0009 5 Mozambique: Maputo Bay 3 1 0 0.000 0.000 Portunus reticulatus 6 India: Chennai 14 11 46 0.956 ± 0.045 0.0239 ± 0.0128 7 Sri Lanka 49 14 46 0.631 ± 0.074 0.0379 ± 0.0188 8 Thailand: Phuket 14 4 4 0.495 ± 0.151 0.0038 ± 0.0025 Portunus pelagicus 9 Singapore 7 5 10 0.857 ± 0.137 0.0060 ± 0.0040 10 Indonesia: Sumatra, Padang 6 4 7 0.867 ± 0.129 0.0044 ± 0.0032 11 Indonesia: Lombok 10 7 9 0.867 ± 0.107 0.0058 ± 0.0037 12 East Malaysia: Sarawak 4 4 8 1.000 ± 0.177 0.0070 ± 0.0053 13 Indonesia: Sulawesi, Manado 3 3 5 1.000 ± 0.272 0.0058 ± 0.0051 14 Philippines: Visayas, Samar and 37 14 10 0.824 ± 0.051 0.0039 ± 0.0024 Negros Islands 15 Taiwan 8 2 1 0.250 ± 0.180 0.0044 ± 0.0006 16 Japan: Okinawa, Naha 14 3 2 0.385 ± 0.149 0.0007 ± 0.0008 17 Japan: Kyushu, Amakusa 26 14 41 0.905 ± 0.037 0.0138 ± 0.0074 18 China: Xiamen 14 5 5 0.725 ± 0.104 0.0053 ± 0.0033 Portunus armatus 19 Australia: Northern Territory, Darwin 4 4 8 1.000 ± 0.177 0.0076 ± 0.0056 (Ludmilla Creek) 20 Australia: Western Australia 5 4 11 0.900 ± 0.161 0.0094 ± 0.0064 21 Australia: South Australia, 6 3 11 0.600 ± 0.215 0.0075 ± 0.0050 Spencer Gulf vicinity 22 Australia: South Australia, 4 3 2 0.833 ± 0.222 0.0018 ± 0.0017 Gulf St Vincent, Brighton Beach 23 Australia: New South Wales 10 8 13 0.956 ± 0.059 0.0095 ± 0.0057 24 Australia: Queensland, 16 10 16 0.917 ± 0.049 0.0073 ± 0.0043 Moreton Bay 25 New Caledonia 5 4 3 0.723 ± 0.222 0.0024 ± 0.0021 The network of haplotypes for P. reticulatus collected from In contrast, haplotypes unique to P. armatus show no distinct Sri Lanka and Chennai, India, resemble a star phylogeny, pattern, possibly due to low sample size. Of 50 individuals with Haplotype 31 common to approximately 41% (32 out sampled, no signifi cantly dominant haplotype was observed of 77 individuals) of the sample size and 17 other haplotypes although eight individuals collected from South Australia differing from it by 1 to 3 mutational steps. The second most and New South Wales share Haplotype 15 (16%). The common haplotype (n = 18) obtained from P. reticulatus second most common haplotype in the P. armatus network specimens collected from the Bay of Bengal is Haplotype 32. is Haplotype 1, comprising six individuals collected from This is the most common haplotype found in P. pelagicus. New South Wales and Moreton Bay. Haplotypes were also Haplotype 32 is separated from 31 by a sharp genetic break not observed to be region specifi c, but heterogeneously of at least 38 mutational steps (6.6% uncorrected differences). distributed throughout the network. While singleton Haplotype 51, the third most dominant haplotype found haplotypes were observed, two private haplotypes noted in in P. pelagicus occurred in two P. reticulatus individuals this network are Haplotypes 24 and 27, collected from two collected from Phuket. Haplotype 51 differed from 32 by individuals from Western Australia and New Caledonia three mutational steps. respectively. The four haplotypes from fi ve specimens of P. armatus collected in New Caledonia are also distant from the main Australian network, separated by fi ve mutational steps. 207 Lai et al: Revision of the Portunus pelagicus species complex Fig. 5. Minimum parsimony spanning network constructed with TCS of Portunus pelagicus complex using a 573-basepair fragment from the COI gene. Each line represents one substitution; small unshaded circles indicate additional substitutions separating two haplotypes. The size of the circle is representative for the frequency of the haplotypes. Filled patterns correspond to geographic affi nity of haplotypes. Network for: A, P. pelagicus; B, P. segnis; C, P. reticulatus; D, P. armatus. For key to localities, see Table 6. 208