loading

Logout succeed

Logout succeed. See you again!

ebook img

Alkaloid Variation Among Epichloid Endophytes of Sleepygrass PDF

pages23 Pages
release year2015
file size0.4 MB
languageEnglish

Preview Alkaloid Variation Among Epichloid Endophytes of Sleepygrass

Alkaloid Variation Among Epichloid Endophytes of Sleepygrass (Achnatherum robustum) and Consequences for Resistance to Insect Herbivores By:Tatsiana Shymanovich, Susanna Saari, Mary E. Lovin, Alan K. Jarmusch, Scott A. Jarmusch, Ashleigh M. Musso, Nikki D. Charlton, Carolyn A. Young, Nadja B. Cech, Stanley H. Faeth Shymanovich, T., Saari, S., Lovin, M.E., Jarmusch, A.K., Jarmusch, S.A., Musso, A.M., Charlton, N.D., Young, C.A., Cech, N.B., Faeth, S.H. (2014). Alkaloid Variation Among Epichloid Endophytes of Sleepygrass (Achnatherum robustum) and Consequences for Resistance to Insect Herbivores. Journal of Chemical Ecology, 41(1), 93-104.doi: 10.1007/s10886-014- 0534-x The final publication is available at Springer via http://dx.doi.org/10.1007/s10886-014- 0534-x. ***© Springer. Reprinted with permission. No further reproduction is authorized without written permission from Springer. This version of the document is not the version of record. Figures and/or pictures may be missing from this format of the document. *** Abstract: Epichloid endophytes are well known symbionts of many cool-season grasses that may alleviate environmental stresses for their hosts. For example, endophytes produce alkaloid compounds that may be toxic to invertebrate or vertebrate herbivores. Achnatherum robustum, commonly called sleepygrass, was aptly named due to the presence of an endophyte that causes toxic effects to livestock and wildlife. Variation in alkaloid production observed in two A. robustum populations located near Weed and Cloudcroft in the Lincoln National Forest, New Mexico, suggests two different endophyte species are present in these populations. Genetic analyses of endophyte-infected samples revealed major differences in the endophyte alkaloid genetic profiles from the two populations, which were supported with chemical analyses. The endophyte present in the Weed population was shown to produce chanoclavine I, paspaline, and terpendoles, so thus resembles the previously described Epichloë funkii. The endophyte present in the Cloudcroft population produces chanoclavineI, ergonovine, lysergic acid amide, and paspaline, and is an undescribed endophyte species. We observed very low survival rates for aphids feeding on plants infected with the Cloudcroft endophyte, while aphid survival was better on endophyte infected plants in the Weed population. This observation led to the hypothesis that the alkaloid ergonovine is responsible for aphid mortality. Direct testing of aphid survival on oat leaves supplemented with ergonovine provided supporting evidence for this hypothesis. The results of this study suggest that alkaloids produced by the Cloudcroft endophyte, specifically ergonovine, have insecticidal properties. Keywords: Alkaloid chemoprofiles | Epichloë | Ergonovine | Herbivores | Indole-diterpenes | Insecticide Article: Introduction Wild grasses have evolved symbiotic relationships with endophytic fungi that cope with multiple abiotic and biotic stresses (Cheplick and Faeth 2009; Kannadan and Rudgers 2008). The most well studied of these fungal endophytes are Epichloë species that systemically infect many cool- season pooid grasses. The most pronounced and well known effect of these endophytes is the production of bioactive alkaloids that can protect their host from vertebrate and invertebrate herbivores and pathogens (Clay 1996; Crawford et al.2010). Epichloid alkaloids are grouped into four classes: ergot alkaloids (e.g., chanoclavine, ergonovine, and ergovaline), lolines (e.g., N- acetylnorloline and N-formylloline), indole-diterpenes (e.g., terpendole C and lolitrem B), and peramine. Each has varying biological activity against vertebrate or invertebrate herbivores (Panaccione et al. 2014). A given endophyte may produce alkaloids from one or more classes, and multiple alkaloids from within each class (Schardl et al. 2013a, c). Genome sequencing of multiple Epichloë species has indicated that the source of variation for the type of alkaloid produced stems mainly from the remarkable variation in presence of alkaloid genes among Epichloë species and strains (Schardl et al. 2013c). HybridEpichloë species, by the nature of arising from multiple progenitors, have the potential to increase genetic variation for alkaloid production (Schardl and Craven 2003; Schardl et al. 2012, 2013a, c). However, environmental factors, such as soil nutrients or herbivore grazing, may modulate alkaloid levels (Bultman et al. 2004; Hunt et al. 2005). Accumulating evidence also indicates that Epichloë species and strains vary greatly not only among grass species but also within a single grass species. For example, Hordelymus europaeus (Oberhofer and Leuchtmann 2012), Festuca arizonica (Sullivan and Faeth 2008), and Bromus laevipes (Charlton et al. 2014) can harbor both hybrid and nonhybrid Epichloë species. Achnatherum robustum (formerly Stipa robusta) is native to mountainous areas of the southwestern USA, and is commonly known as sleepygrass because of its long-recognized toxic and narcotic effects on livestock (Jones et al. 2000). Indeed, sleepygrass is one of the relatively few epichloid-infected native grasses known to be highly toxic to vertebrates (Faeth 2002b). The toxic effects are due presumably to ergot alkaloids (ergonovine and lysergic acid amide) (Petroski et al. 1992) produced by an asexual, seed-borne epichloid endophyte. Infected grasses with high levels of ergot alkaloids occur in a restricted range of A. robustum near Cloudcroft, NM in the Lincoln National Forest (Faeth et al. 2006). Endophyte-infected A. robustum from this location show very high levels of the ergot alkaloids ergonovine (EN), lower levels of lysergic acid amide (LAA), isolysergic amide, and much lower levels of ergonovinine. The presence of these alkaloids could explain the toxic effects of sleepygrass on livestock, such as narcotized sleep, elevated body temperature, weakness, frequent urination, dizziness, hyper salivation, diarrhea, and potential death (Miles et al. 1996; Petroski et al. 1992). Cytotoxic effects to animal muscle tissue also have been described for ergonovine and ergonovinine (Zhang et al. 2014). Although less well studied, ergot alkaloids also may have deterrent and toxic effects on invertebrate herbivores (Panaccione et al. 2014; Schardl et al. 2013a). In contrast to the Cloudcroft population, endophyte-infected A. robustum from other nearby and distant populations do not produce ergot alkaloids such as those found in the Cloudcroft population. One of these populations is located within 22 km from Cloudcroft in the Lincoln National Forest near Weed, NM, USA (Faeth et al. 2006). It is likely that A. robustum is a host for more than one endophyte species, based upon dramatic differences in alkaloids produced among different endophyte-infected plants (Faeth et al. 2006). Presently, only one endophyte species, Epichloë funkii (formerly Neotyphodium funkii) has been described from A. robustum(Leuchtmann et al. 2014; Moon et al. 2007). Epichloë funkii, a hybrid endophyte with E. elymi and E. festucae ancestral progenitors, was described based on a single plant collection in Colorado, USA (Moon et al. 2007). Recent draft genome sequence of E. funkii indicates the presence of EAS biosynthesis genes required for production of chanoclavine I, an early ergot alkaloid pathway intermediate, IDT/LTM biosynthesis genes required for production of terpendoles from the indole-diterpene pathway, and the perA gene required for peramine production (Schardl et al. 2013c). To date, however, only chanoclavine I has been detected from E. funkii-infected plant tissues, while peramine and indole-diterpenes have not been analyzed (Schardl et al. 2013a, c). The alkaloid genetic profile of E. funkii does not support the production of ergonovine, yet ergonovine is found at high levels in endophyte- infected sleepygrass plants from the Cloudcroft population. Therefore, this evidence suggests that a different Epichloë species with the capability to produce ergonovine also infects A. robustum. Our goal was to examine the variation in epichloid endophytes, their alkaloid genes and products, and the ecological consequences for herbivores, in two disjunct, but nearby A. robustum populations (Cloudcroft and Weed). We tested whether the endophytes and their associated alkaloids differentially affected herbivores via a standard insect bioassay with aphids. To test for a mechanism underlying the observed variation in aphid resistance, we tested the anti- herbivore properties of a specific ergot alkaloid, ergonovine, in controlled experiments. Methods and Materials Field Plants To study endophyte infection status (E), variation in production of the alkaloids ergonovine and lysergic acid amide (A) and alkaloid levels, we sampled A. robustum plants established in 2005 in an experimental plot at the Arboretum of Flagstaff, Flagstaff, Arizona (Faeth et al. 2010). The experimental plot included three groups: uninfected plants (E-A-), endophyte-infected not producing ergonovine (E+A-), and endophyte-infected producing ergonovine (E+A+). Seed used for this plot (Table 1), originated from Cloudcroft and Weed natural populations, New Mexico, USA collected during 2001–2004 (Faeth et al. 2006). Each group was organized from multiple seedlings grown from 1 to 2 maternal plants. In September 2011, one tiller per plant was collected, checked for endophyte infection, and stored at −20 °C for alkaloid analyses. In May 2013, we recollected several plant samples from each group and tested for endophyte infection, ergot alkaloid production, and endophyte alkaloid genotype. Achnatherum robustum is an obligate outcrossing species, and plants were allowed to naturally pollinate each other within the experimental plot to produce seed. Table 1 Origin of Achnatherum robustum field plot plants Group a Origin of population Coordinates Maternal plant ID E-A- Weed, New Mexico N:32o 47.7′ W:105o 35.7′ 5–91 b E+A- Weed, New Mexico N:32o 47.7′ W:105o 35.7′ 5–110 E+A+ Cloudcroft, New Mexico N:32o57.5′ W: 105o 43.1′ 4–134 Cloudcroft, New Mexico N:32o57.5′ W: 105o 43.1′ 4–136 aE- = Epichloë free plant, E+ = Epichloë infected plant; A- = no ergonovine production, A+ = ergonovine production bSubsequent analysis of these plants revealed endophyte-infected plants existed within this group Maintenance of Greenhouse Plants To establish plants for herbivory experiments, chemotyping, and genotyping, second generation seeds originating from the Cloudcroft and Weed populations (2010 collection from the experimental plot) were planted on January 5, 2011 in potting mix soil (Timberline, USA) in 300 ml pots. Seedlings were grown in the greenhouse at 25 °C/ 22 °C day/night temperatures and natural light conditions and fertilized with 20:20:20 soluble fertilizer with minor elements (Southern Agricultural Insecticides, Inc., Hendersonville, NC, USA) twice a month. One tiller was sampled prior to the herbivory experiment (April 2011) to determine endophyte infection status and alkaloid production. This sampling was repeated after the herbivory experiment (January 2012) to confirm endophyte infection. Samples for genetic studies were taken in December 2012. Detection of Endophyte Infection Status The Phytoscreen Immunoblot Kit “Neotyphodium Field Tiller” (Agrinostics, Ltd. Co, GA, USA) was used to determine the infection status of all plant samples. One tiller per plant was tested by imprinting the base of the tiller onto nitrocellulose paper to detect endophyte presence by immunoblot analysis, while the remainder of the tiller was retained for chemical analysis. Fresh samples were used from greenhouse plants and frozen samples from field plants. Alkaloid Extraction Leaf samples were freeze-dried and extracted with 95 % methanol (40 mg in 1 ml) at 5 °C for 48 h. The extract was filtered through a 0.22 μm spin filter (Corning Inc.), air dried, and re- dissolved in 17 % aqueous methanol. The resulting extracts were stored at 5 °C until time of analysis. Lysergic Acid Amide and Ergonovine Analysis To detect and quantify ergot alkaloids, HPLC-HESI-MS analyses were performed on a triple quadruple mass spectrometer (TSQ Quantum, Thermo, San Jose, CA, USA) interfaced to an HPLC system with photodiode array detector (monitored at 300 nm) and quaternary pump (Agilent HP1100 series). A binary solvent composition of aqueous 0.1 % formic acid (solvent A) and 0.1 % formic acid in methanol (solvent B) was employed with a flow rate of 0.20 ml/min on a C18 column (50 × 2.1 mm, 3 μm particle size, Prevail packing,Grace, Deerfield, IL, USA). Separation was achieved using a linear gradient that initiated at 95%A:5%B (v/v) and remained isocratic from 0 to 4 min; decreased linearly from 95%A:5%B to 90%A:10%B from 4 to 5 min; from 90 %A:10 %B to 70 %A:30 %B from 5 to 11.5 min; from 70 %A:30 %B to 10 %A:90 %B from 11.5 to 11.6 min; remained isocratic at 10 %A:90 %B from 11.6 to 16 min; increasing from 10 %A:90 %B to 95 %A:5 %B from 16 to 16.1 min; and remained isocratic at 95 %A:5 %B from 16.1 to 24 min. Aqueous solutions of the ergot alkaloids lysergic acid amide tartrate (98 % pure by LC-MS) and ergonovine maleate (Sigma-Aldrich, 100 % pure by TLC) were employed as standards for quantitation. The mass spectrometer was operated in the positive ion mode with a 0.1 s scan time and a scan width of 0.5 m/z.Quantification was performed using selected reaction monitoring (SRM) with a 268 to 208 transition for lysergic acid amide and a 326 to 223 transition for ergonovine. Alkaloid quantities were calculated by linear regression of the relevant calibration curves. Analysis of N-acetylnorloline, Chanoclavine I, and Peramine Loline alkaloids, chanoclavine I, and peramine were analyzed by using ultra performance liquid chromatography – high resolution mass spectrometry (UPLC-HRMS) on an Orbitrap mass spectrometer with electrospray ionization (ESI) source (LTQ Orbitrap XL, Thermo, San Jose, CA, USA) coupled to Acquity UPLC (Waters Corp., Milford, MA, USA). A hydrophilic interaction chromatography (HILIC) column (150 × 2.1 mm, 5 μm particle size, 120 Å pore size, Alltima packing, Grace, Deerfield, IL, USA) was utilized for the analysis of all extracts, with a 0.3 ml/min flow rate and a 3 μl injection volume. The samples were analyzed using the following gradient composition, where A = 0.1 % formic acid in (acetonitrile) and B = 0.1 % formic acid in (water), 95.1 % A from 0 to 8 min. Mass spectrometric detection was conducted in the positive ion mode with a scan range of 75–300 m/z. Capillary temperature was 275 °C, sheath gas pressure was 20 (arbitrary units), and spray, capillary, and tube lens voltages were 4.5 kV, 20 V, and 100 V, respectively. For comparison, this method was applied to the analysis of endophyte- infected Elymus canadensis (strain NFe746), and the alkaloids N-acetylnorloline, peramine, and chanoclavine I were all detected, consistent with previous literature (Charlton et al. 2012; Clay and Schardl 2002; Schardl et al. 2013c). A synthetic standard of N-acetylnorloline also was analyzed as a positive control. Indole-Diterpenes Chemical Analysis Indole-diterpene analyses were performed by AgResearch in New Zealand using LC-MS/MS according to Rasmussen et al. (2012). DNA Extraction and Chemoprofiling Tillers from greenhouse and field plants were evaluated for the presence of associated Epichloë species, and the endophyte was characterized using PCR. DNA was isolated from plant material with MagAttract 96 DNA Plant Core Kit (QIAGEN Inc.) according to manufacturer’s instructions. PCR with six multiplex primers sets were used to determine endophyte infection status, mating type, and genes present at each alkaloid loci as described in Charlton et al. (2014). In addition, the multiplex three primer set included primers, dmaW818(311 + 21)d (5′-AACCCATCAACGGAGCAACTG) and dmaW818(1068 + 21)u (5′- GCCAAACACTGTGAAATACACCTG), designed to the E. gansuensis var. inebrians e818 dmaW EN gene required for ergonovine production (L. Chen, C. L. Schardl unpublished). Aphid Biological Assay An aphid bioassay was employed to test the effects of endophytic alkaloids from different endophyte-infected A. robustum on herbivore resistance (e.g., Cheplick and Faeth 2009). In total, 101 greenhouse grown plants originating from the Cloudcroft population and 54 plants from the Weed population were evaluated. Twenty seven plants from the Cloudcroft population with total ergonovine plus lysergic acid amide (EN+LAA) ergot alkaloid levels greater than 26.7 μg/kg (at the age of 3 months) were selected for one group, and 26 infected plants from the Weed population with no detectable ergonovine and lysergic acid amide alkaloids were selected for the other group. Two Rhopalosiphum padi L. aphid populations were used for this experiment: wild NC (North Carolina) origin (collected in Greensboro, NC) and NY (New York) origin (obtained from the UNC-Chapel Hill collection). The NY population has been observed to be more tolerant to endophytic alkaloids (M. Dekker, pers. communication). Rhopalosiphum padi has been used commonly to bioassay the effects of endophytic alkaloids on herbivores (Leuchtmann et al. 2000; Saari et al. 2014). Aphids were reared on oat (Avena sativa) plants, so they were naïve to fungal alkaloids (oats do not produce alkaloids). This experiment continued for 30 day in October-November 2011 when plants were 10 month old. Initially, three aphids were placed on A. robustum plants enclosed with clear plastic cups and thin fabric secured on top for air exchange. Every 3 days, wingless and winged aphid numbers were recorded, and an additional three aphids were added to each plant to maintain populations. Both wingless and winged forms were recorded because aphids may produce winged forms when host plant quality deteriorates (Braendle et al. 2006; De Barro 1992). Bioassay to Test Anti-Herbivore Activity of Ergonovine To test the direct effects of the ergot alkaloid ergonovine on aphid herbivores, 20 one-wk-old oat (Avena sativa) seedlings (seed material from Nasco, Fort Atkinson, WI, USA) were cut at soil level and placed into an aqueous ergonovine solution (1.5 ppm, 1 ml) in a microcentrifuge tube covered with aluminum foil. Each leaf was secured in the tube with a small piece of sponge. Ergonovine was adsorbed naturally due to transpiration. A 15 ml clear plastic centrifuge tube with the end cut off was inverted to cover the leaf in the microfuge tube, and the hole was closed with a small roll of KimWipes to allow some gas exchange. Five R. padi (NY) aphids of 3rd and 4th instar were added to each leaf. For the control group, deionized water was used in place of the ergonovine solution. Plants were placed in a growth chamber at 25 °C with 16 h of L/D for 4 days. All aphids were counted, and leaves were freeze-dried to determine the ergonovine concentration. Extraction and LC-MS analysis of ergonovine levels in three control and 20 ergonovine treated leaves was performed as described above. We did not have sufficient lysergic acid amide, the second candidate for insecticidal properties, to test the direct effects on aphids. Statistical Analysis RGui 32-bit software with R Commander Package was used for statistical analyses. For ergot alkaloid concentration measurements, averages and population standard deviations were determined. For the ergonovine testing bioassay, we used aphid means with SE counts; one- way ANOVA test was performed to determine the difference between the treatment groups, and a simple linear regression model was used to test the effect of ergonovine concentration on aphid numbers. Data from the aphid biological assay was non-normally distributed, so we used rank transformation and Wilcoxon nonparametric tests for comparing the differences at each of ten measurements between two plant and two aphid populations. Because of repeated measures, overall aphid numbers between populations also were compared with Hotelling’s T 2 test for ranked data. To test differences in the collective number of wingless and winged forms over all time periods, we used the Pearson’s Chi-square test. Results Infection Status and Ergot Alkaloid Levels in Seedlings from Cloudcroft and Weed Populations Differences were observed in alkaloid content and endophyte infection status between 3 month old seedlings originating from Cloudcroft and Weed populations. When the endophyte infection status was determined by immunoblot analysis for 155 greenhouse three-month old seedlings, only the Weed population tested positive for endophyte infection, while all Cloudcroft seedlings appeared to be endophyte free. However, chemical analysis revealed the presence of ergot alkaloids (ergonovine and lysergic acid amide) at varying levels in 74 out of 101 Cloudcroft population seedlings (Table 2) despite negative immunoblot results. All 54 plants from the Weed population seedlings tested negative for the presence of ergot alkaloids, ergonovine, and lysergic acid amide. Table 2 Ergonovine (EN) and Lysergic Acid Amide (LAA) levels from three-month- old Achnatherum robustum Population # of # of Highest Mean Highest Mean # plants plants plants concentration EN ± concentration LAA ± tested EN + EN + EN (ppb or SDb(ppb LAA (ppb or SD (ppb LAA LAA Not μg/kg)a or μg/kg) μg/kg) or detected detected μg/kg) Cloudcroft 74 27 248 25 ± 36 31 3.7 ± 5.1 101 plants Weed 0 54 0 0 0 0 54 plants aAlkaloid concentrations were calculated as μg of alkaloid per kg of dry leaf material bMeans and standard deviation (SD) were calculated for all plants tested in the group, including plants that produced no detectable alkaloids Infection Status and Ergot Alkaloid Production in Field Plot Plants Endophyte infection status and ergot alkaloid analysis of 105 adult plants originating from all four mother plants from the Cloudcroft and Weed populations were determined (Table 3). Endophyte infection was detected by the immunoblot method from the adult plants for both populations. We detected seven endophyte-free plants out of 59 Cloudcroft plants and six endophyte-free plants out of 46 plants from the Weed population. Surprisingly, the purported E- A- group (Faeth et al. 2006) from Weed mother plant 5–91 had only four uninfected plants from the total of 21 plants (Table 3), suggesting that the original mother plant was mistakenly identified as uninfected. The original infection status of the majority (23 of 25) of the E+A- group plants was confirmed by immunoblot. As expected, the ergot alkaloids ergonovine and lysergic acid amide were detected only from plants that originated from Cloudcroft, E+A+ group. Ergonovine levels in dry plant tissues ranged from 0 to 2.67 μg/g, and lysergic acid amid levels ranged from 0 to 1.18 μg/g (Table 3). Table 3 Endophyte infection status and Ergonovine (EN) and Lysergic Acid Amide (LAA) levels in Achnatherum robustum field plot plants in September 2011 Populatio Status in 2011 Range of Mean EN Range of Mean Total n /Status (immunoblottin ENb(pp ± SD (ppm LAAb(pp LAA ± SD Mean when g and alkaloid m or or μg/g)d m or (ppm or EN+LAA planting/ testing) μg/g)c μg/g)c μg/g)d ± SD (ppm # plants or μg/g)d testeda Cloudcroft 52 plants 0 to 2.67 1.023 ± 0.6 0 to 1.18 0.369 ± 0.2 1.392 ± 0.8 (E+A+) 59 (E+A+) 0 8 6 plants 7 plants (E-) 0 0 0 0 0 Weed 23 plants (E+A-) 0 0 0 0 0 (E+A-) 25 2 plants (E-) 0 0 0 0 0 plants Weed (E- 4 plants (E-A-) 0 0 0 0 0 A-) 21 17 plants (E+A- 0 0 0 0 0 plants )e aE- = Epichloë free plant, E+ = Epichloë infected plant; A- = no ergonovine production, A+ = ergonovine production b EN ergonovine, LAA lysergic acid amide cAlkaloid concentrations were calculated as μg of alkaloid per g of dry leaf material dMeans and standard deviation (SD) were calculated for all plants tested in the group, including plants that produced no detectable alkaloids eOriginally E-A- plants but changed to E+A- based upon positive immunoassay tests Genetic and Chemical Variation of Endophytes from Two Populations Infection status, mating type, and alkaloid gene profiles were determined for 26 Cloudcroft and nine Weed samples that originated from all mother plants used in our aphid experiments. Within each population, endophytes from all mother plants had the same genetic profiles represented in Fig. 1. However, the endophytes from the Weed and Cloudcroft populations are genetically distinct from each other (Fig. 1). The endophyte from the Weed population resembles E. funkii (Schardl et al. 2013c), whereas the endophyte from the Cloudcroft population is distinct in mating type and alkaloid gene profiles.

See more

The list of books you might like