Logout succeed
Logout succeed. See you again!

Application of Cytochrome b Gene Sequences for Identification of Parrots from Korean Zoos PDF
Preview Application of Cytochrome b Gene Sequences for Identification of Parrots from Korean Zoos
Anim. Syst. Evol. Divers. Vol. 36, No. 3: 216-221, July 2020 https://doi.org/10.5635/ASED.2020.36.3.028 Review article Application of Cytochrome b Gene Sequences for Identification of Parrots from Korean Zoos Jung-il Kim1, Thinh Dinh Do1, Duri Lee1, Yonggu Yeo2, Chang-Bae Kim1,* 1Department of Biotechnology, Sangmyung University, Seoul 03016, Korea 2Conservation and Health Center, Seoul Zoo, Gwacheon 13829, Korea ABSTRACT Parrots are common targets for illegal trade because of their beauty and high price. Accurate identification is necessary for the prevention of illegal trade and conservation of parrots. In the present study, mitochondrial markers of cytochrome b (CYTB) gene were used to identify parrot species from Korean zoos. Totally, 27 samples were collected from Seoul Zoo, Cheongju Zoo, and Uchi Zoo. After collection, total DNA of samples was extracted and used for PCR amplification. CYTB fragments were sequenced from all samples examined. The obtained sequences were used for GenBank blast, distance estimation, and phylogenetic analysis. All species were identified using CYTB sequences that determined 27 samples belong to 13 species in 7 genera, and 3 families. Our finding demonstrated the usefulness of CYTB sequences for identifying parrot species in Korean zoos. Keywords: zoo, illegal trade, DNA barcoding, CYTB gene INTRODUCTION of their colorful plumage and mimicry ability, parrots (the order Psittaciformes) are in high demand as pets and highly Natural exploitation together with human activities has result- prized. It is reported that parrot is the most traded bird among ed in the loss of world biodiversity. Conservation measures all avian orders (Bush et al., 2014). According to the Interna- are necessary to protect wild species from extinction. Because tional Union for Conservation of Nature (IUCN), 37 parrot of threats to biodiversity in nature, conservation of species in species are endangered, 18 species are critically endangered its natural habitat may be challenging. In this circumstance, and 16 species are already extinct (https://www.iucnredlist. zoos have changed the roles from animal exhibitions to insti- org). Most parrots are protected by the Convention on Inter- tutions that handle multiple missions such as conservation, national Trade in Endangered Species of Wild Fauna and Flo- scientific research, and education (Witzenberger and Hoch- ra (http://checklist.cites.org/#/en). Therefore, accurate identifi- kirch, 2011). It is well-known that zoo is important to raise cation of parrots is necessary to support authorities to manage people’s awareness on wildlife conservation and protection. parrot trade. However, morphological identification of parrots In addition, many endangered species are growed and bred in is challenging due to their slight difference in morphology. zoos for conservation targets and they could be reintroduced DNA barcoding has been proven to be a powerful tool for to their natural habitats in the future (Wirtz et al., 2018). The discrimination of wildlife products that are obtained from accumulation of specimens may result in difficult tasks for illegal trade (Lahaye et al., 2008; Presti et al., 2015). For ani- zoo staff in species recognition. A reliable and accurate meth- mals, the mitochondrial protein-coding genes and ribosomal od for species identification is useful for zoo staff to conduct RNA genes are popular markers for DNA barcoding tech- their role in conservation and management. nique. Of mitochondrial markers, in addition to cytochrome High demand for wildlife products from humans has re- c oxidase subunit I (COI) gene, cytochrome b (CYTB) gene sulted in the illegal wildlife trade. The illegal wildlife trade is is also used for molecular analysis (Arif and Khan, 2009). In a serious problem that threats the survival of wild organisms avian, particularly CYTB gene has been used for the studies of and shows negative effects on wildlife conservation. Because phlogenetics, so that is more represented than other genes on This is an Open Access article distributed under the terms of the Creative *To whom correspondence should be addressed Commons Attribution Non-Commercial License (http://creativecommons.org/ Tel: 82-2-2287-5288, Fax: 82-2-2287-0070 licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, E-mail: [email protected] and reproduction in any medium, provided the original work is properly cited. eISSN 2234-8190 Copyright The Korean Society of Systematic Zoology Identification of Parrots Using CYTB Gene Table 1. Parrot samples collected and examined in this study Family Species name Zoos Form No. of samples Cacatuidae Cacatua alba Seoul zoo Blood 1 Cacatua ducorpsii Uchi zoo Feather 1 Cacatua galerita Seoul zoo Blood 1 Cacatua goffiniana Seoul zoo Blood 1 Cacaua moluccensis Seoul zoo Feather 1 Cheongju Zoo Feather 1 Nymphicus hollandicus Seoul zoo Feathers 2 Cheongju Zoo Feathers 2 Psittacidae Ara ararauna Seoul zoo Feather 1 Cheongju Zoo Feather 1 Uchi zoo Feather 1 Ara chloropterus Seoul zoo Feather 1 Uchi zoo Feather 1 Ara macao Seoul zoo Feather 1 Myiopsitta monachus Seoul zoo Feathers 2 Psittaculidae Eclectus roratus Seoul zoo Feather 1 Uchi zoo Feather 1 Lorius garrulus Seoul zoo Feather 1 Cheongju Zoo Feather 1 Melopsittacus undulatus Seoul zoo Feathers 2 Cheongju Zoo Feathers 2 Uchi zoo Feather 1 Table 2. Cytochrome b (CYTB) gene primers used in this study Primer name Direction Sequence (5′-3′) Reference MT-A1 F CAACATCTCAGCATGATGAAACTTCG Wink and Sauer-Gürth (2000) Mte R GCAAATAGGAAGTATCATTCTGG Fritz et al. (2006) ND5L 14754 F GGACCAGAAGGACTTGCCGACCTA Ribas (2004) H15400 R AAGAATCGGGTTAGGGTGGGG Braun (2014) L15311 F GTCCTACCATGAGGTCAAATATC Braun (2014) HThr 16082 R TCTTTTGGTTTACAAGACCAATG Kornegay et al. (1993) reference databases such as GenBank (Branicki et al., 2003; Seoul Zoo (Seoul). Another set of samples including 12 feath- Coghlan et al., 2013). Also, CYTB gene have been widely ap- ers were collected from Cheongju Zoo (Cheongju), and Uchi plied for avian species identification (Lee et al., 2008; Aliaba- Zoo (Gwangju). The sample information used in this study is dian et al., 2009; Boonseub et al., 2009) and estimating inter- presented in Table 1. The ethical procedure for using blood specific genetic relationship (Moore and DeFilippis, 1997). In and muscle tissue was approved by the Seoul Zoo IACUC (no. this study, partial mitochondrial protein-coding genes (CYTB 2019-001). gene) were used to identify parrot species from Korean zoos. Upon sample collection, total DNA was extracted and For this purpose, the partial CYTB gene of all samples was measured purity and concentration. The partial mitochondri- sequenced and analyzed. al CYTB gene was amplified for all collected samples. CYTB primers used in this study are listed in Table 2. The 20 μL of PCR reaction mixture contained 10 μL of 2 DyeMix MATERIALS AND METHODS (Enzynomics, Korea) with 1.0 U of Taq polymerase, 1 μL of × each primer (5 pmole/μL), 100 ng DNA and distilled water There were 15 feather and blood samples collected from up to 20 μL. The amplification protocol was as follows: ini- Anim. Syst. Evol. Divers. 36(3), 216-221 217 Jung-il Kim, Thinh Dinh Do, Duri Lee, Yonggu Yeo, Chang-Bae Kim Table 3. Cytochrome b (CYTB) gene sequences of parrot species in the present study in comparison to GenBank database No. Family Species name No. of samples Accession no. Identity (%) E-value 1 Cacatuidae Cacatua alba 1 MT275977 99.0 0 2 Cacatua ducorpsii 1 MT275978 100 3E-163 3 Cacatua galerita 1 MT275979 100 0 4 Cacatua goffiniana 1 MT275980 99.9 0 5 Cacatua moluccensis 2 MT275981-MT275982 100 0 6 Nymphicus hollandicus 4 MT275983-MT275986 100 0 7 Psittacidae Ara ararauna 3 MT275987-MT275989 100 0 8 Ara chloropterus 2 MT275990-MT275991 99.7 0 9 Ara macao 1 MT275992 100 0 10 Myiopsitta monachus 2 MT275993-MT275994 99.9-100 0 11 Psittaculidae Eclectus roratus 2 MT275995-MT275996 100 0 12 Lorius garrulus 2 MT275997-MT275998 99.7 0 13 Melopsittacus undulatus 5 MT275999-MT276003 99.7-100 0 Table 4. Intraspecific distance and interspecific distance (%) of congenetic species based cytochrome b (CYTB) sequences No. Family Species name Intraspecific distance (%) Interspecific distance (%) 1 Cacatuidae Cacatua alba 0.00-0.33 5.97-11.30 2 Cacatua ducorpsii 0.00 2.03-11.82 3 Cacatua galerita 0.00-0.67 3.07-8.60 4 Cacatua goffiniana 0.00-0.33 1.34-11.00 5 Cacatua moluccensis 0.00-1.68 5.23-13.52 6 Psittacidae Ara ararauna 0.00-0.52 6.00-13.39 7 Ara chloropterus 0.00-0.52 4.32-10.24 8 Ara macao 0.00-0.78 3.76-11.16 9 Psittaculidae Lorius garrulus 0.16 2.30-3.48 Distances were estimated based sequences in this study and GenBank sequences. tial denaturation at 95°C for 2 min followed by 35 cycles of (Kumar et al., 2018). denaturation at 95°C for 45 s, annealing at 52°C for 1 min, extension at 72°C for 1 min and final elongation at 72°C for 5 minutes. The PCR products were analyzed by electropho- RESULTS AND DISCUSSION resis in 1% (w/v) agarose gels in 1% tris-acetate buffer. The PCR products were sequenced directly by Sanger sequenc- Totally, 27 sequences of CYTB gene were generated. The ing. blast result of CYTB sequences showed identity >99.0% with DNA sequence data sets were verified quality, and the sequences available on Genbank for all samples (Table 3). consensus sequence was extracted from forward and reverse Intraspecific distance and interspecific distance for examined sequences using Geneious 9.1 software (Kearse et al., 2012). species are presented in Table 4. Among five Cacatua species The consensus sequence was blasted on GenBank database collected in this study, maximum intraspecific distance var- and identified species with the highest similarity. For the ge- ied from 0% (C. ducorpsii) to 1.68% (C. moluccensis). These nus with multiple species and sequences available on Gen- values are lower than minimum interspecific distance of the bank, additional sequences were retrieved from GenBank for same species. The similar pattern was also found in Ara spp. further analyses. Sequence distances were estimated using and Lorius garrulus (Table 4). Combination of blast result Kimura-2-parameter (K2P) distance model (Kimura, 1980) in and comparision of sequence distances, there were 13 parrot MEGA X software (Kumar et al., 2018). For reconstruction of species identified from three Korean zoos. The examined par- the phylogenetic tree, the Maximum likelihood method with rots belonged to 7 genera and 3 families of the order Psittaci- 1,000 bootstrap replicates in MEGA X software was used formes. The finding based on CYTB sequences is consistent 218 Anim. Syst. Evol. Divers. 36(3), 216-221 Identification of Parrots Using CYTB Gene Fig. 1. Phylogenetic analysis of Eclectus roratus complex based on cytochrome b (CYTB) sequences. GeneBank accession numbers of sequences are next to species. The sequences in this study were lablled with black dots. Bootstrap values >50 are shown at nodes. to species labelled by zoos (Table 1). ly which taxonomy is under discussion or recently identified Further analyses of Eclectus roratus sequences indicated in zoo is necessary for management and protection of parrots. that E. roratus is divided into 4 clusters and 2 samples in this In this study, DNA barcoding was applied to identify parrots study belonged to a cluster that includes 3 subspecies: E. r. from different Korean zoos. With CYTB marker, all collected aruensis, E. r. polychloros and E. r. solomonensis (Fig. 1). species were identified based on blast results and the com- Our finding is congruent with the results reported by Braun et parison between intraspecific and interspecific variations. al. (2016). According to NCBI Taxonomy (http://www.ncbi. Especially, E. roratus in this study might be identified to E. nlm.nih.gov/taxonomy), E. roratus is a single species of the polychloros following Braun et al. (2016). It could be help- genus Eclectus and includes six subspecies: E. r. aruensis, E. r. ful to for management and protection of parrots in Korean cornelia, E. r. polychloros, E. r. riedeli, E. r. roratus, and E. r. zoos by correct identification. Since the first study of Hebert solomonensis. However, based on analyses of CYTB sequenc- et al. (2004), numerous studies have used DNA barcoding to es together with morphological and geographical data, Braun identify bird species, including parrots. Together with oth- et al. (2016) revealed that Eclectus roratus is species complex er mitochondrial markers, more CYTB sequences have been and its 6 subspecies could be devided into 4 independent spe- generated and accumulated on databases. With the increasing cies: E. roratus, E. cornelia, E. riedeli, and E. polychloros. accumulation of CYTB sequences from different localities in Accordingly, E. polychloros consisted of 3 subspecies: E. r. the world, CYTB gene becomes a powerful approach for avi- aruensis, E. r. polychloros, and E. r. solomonensis while each an. Therefore, the gene has been applied to study avian iden- remaining species consisted of 1 subspecies. This demon- tification and phylogeny (Astuti et al., 2006; Lee et al., 2008). strated that CYTB marker is a useful tool for discrimination of This step is necessary to protect endanger bird species like species complex in parrot. many parrots from extinction. Due to their beauty and ability, parrots are one of the most In this study, CYTB gene sequences were applied to iden- common captive birds (Frynta et al., 2010). The illegal trade tify parrot species from three Korea zoos. The result showed that meets human’s high demand is a serious threat to parrots. that the use of CYTB sequences was effective for parrot iden- Under biodiversity threats zoo has emerged its role in species tification. In addition, the marker is able to separate indepen- conservation. The accurate identification of parrots particular- dent species from species complex group as the case of E. Anim. Syst. Evol. Divers. 36(3), 216-221 219 Jung-il Kim, Thinh Dinh Do, Duri Lee, Yonggu Yeo, Chang-Bae Kim eclectus. More species should be included in the future study Branicki W, Kupiec T, Pawlowski R, 2003. Validation of cyto- to show the effectiveness of CYTB gene sequences and re- chrome b sequence analysis as a method of species identi- solve better phylogeny of parrots. fication. Journal of Forensic Science, 48:83-87. https://doi. org/10.1520/JFS2002128 Braun MP, 2014. Parrots (Aves: Psittaciformes): evolutionary history, phylogeography, and breeding biology. PhD disser- ORCID tation, Heidelberg University, Heidelberg, Germany. Braun MP, Reinschmidt M, Datzmann T, Waugh D, Zamora R, Jung-il Kim: https://orcid.org/0000-0001-7851-2493 Häbich A, Neves L, Gerlach H, Arndt T, Mettke-Hofmann C, Thinh Dinh Do: https://orcid.org/0000-0001-8945-1518 Wink M, 2016. Influences of oceanic islands and the Pleis- Duri Lee: https://orcid.org/0000-0002-5784-3653 tocene on the biogeography and evolution of two groups of Yonggu Yeo: https://orcid.org/0000-0002-5578-2877 Australasian parrots (Aves: Psittaciformes: Eclectus roratus, Chang-Bae Kim: https://orcid.org/0000-0002-1040-7600 Trichoglossus haematodus complex). Rapid evolution and implications for taxonomy and conservation. European Jour- nal of Ecology, 3:47-66. https://doi.org/10.1515/eje-2017- CONFLICTS OF INTEREST 0014 Bush ER, Baker SE, Macdonald DW, 2014. Global trade in exotic pets 2006-2012. Conservation Biology, 28:663-676. No potential conflict of interest relevant to this article was https://doi.org/10.1111/cobi.12240 reported. Coghlan ML, White NE, Murray DC, Houston J, Rutherford W, Bellgard MI, Haile J, Bunce M, 2013. Metabarcoding avian diets at airports: implications for birdstrike hazard man- ACKNOWLEDGMENTS agement planning. Investigative Genetics, 4:27. https://doi. org/10.1186/2041-2223-4-27 We thank Seoul Zoo, Cheongju Zoo and Uchi Zoo for sample Fritz U, Auer M, Bertolero A, Cheylan M, Fattizzo T, Hunds- supplement. Samples were collected with the assistance of dörfer AK, Sampayo MM, Pretus JL, Široký P, Wink M, So Young Jung, Jung Yeol An, In Hui Park, Han Sol Kim, Su 2006. A rangewide phylogeography of Hermann’s tortoise, Yeon Seo, Mihyun Yoo, and Hany Lee (Seoul Zoo), Jeong Ho Testudo hermanni (Reptilia: Testudines: Testudinidae): im- Kim (Cheongju Zoo) and Jong Woog Choi (Uchi Zoo). This plications for taxonomy. Zoologica Scripta, 35:531-543. work was supported by Korea Environment Industry & Tech- https://doi.org/10.1111/j.1463-6409.2006.00242.x nology Institute (KEITI) through Public Technology Program Frynta D, Lišková S, Bültmann S, Burda H, 2010. Being attrac- tive brings advantages: the case of parrot species in captiv- based on Environmental Policy, funded by Korea Ministry of Environment (MOE) (2018000210004). ity. PLoS ONE, 5:e12568. https://doi.org/10.1371/journal. pone.0012568 Hebert PDN, Stoeckle MY, Zemlak TS, Francis CM, 2004. Identification of birds through DNA barcodes. PLoS Biolo- REFERENCES gy, 2:e312. https://doi.org/10.1371/journal.pbio.0020312 Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Stur- Aliabadian M, Kaboli M, Nijman V, Vences M, 2009. Molec- rock S, Buxton S, Cooper A, Markowitz S, Duran C, Thier- ular identification of birds: performance of distance-based er T, Ashton B, Meintjes P, Drummond A, 2012. Geneious DNA barcoding in three genes to delimit parapatric species. Basic: an integrated and extendable desktop software plat- PLoS ONE, 4:e4119. https://doi.org/10.1371/journal.pone. form for the organization and analysis of sequence data. 0004119 Bioinformatics, 28:1647-1649. https://doi.org/10.1093/bio- Arif IA, Khan HA, 2009. Molecular markers for biodiversity informatics/bts199 analysis of wildlife animals: a brief review. Animal Biodi- Kimura M. 1980. A simple method for estimating evolution- versity and Conservation, 32:9-17. ary rates of base substitutions through comparative studies Astuti D, Azuma N, Suzuki H, Higashi S, 2006. Phylogenetic of nucleotide sequences. Journal of Molecular Evolution, relationships within parrots (Psittacidae) inferred from mi- 16:111-120. https://doi.org/10.1007/BF01731581 tochondrial cytochrome-b gene sequences. Zoological Sci- Kornegay JR, Kocher TD, Williams LA, Wilson AC, 1993. ence, 23:191-198. https://doi.org/10.2108/zsj.23.191 Pathways of lysozyme evolution inferred from the sequenc- Boonseub S, Tobe SS, Linacre AMT, 2009. The use of mito- es of cytochrome b in birds. Journal of Molecular Evolu- chondrial DNA genes to identify closely related avian spe- tion, 37:367-379. https://doi.org/10.1007/BF00178867 cies. Forensic Science International: Genetics Supple ment Kumar S, Stecher G, Li M, Knyaz C, Tamura K, 2018. MEGA Series, 2:275-277. https://doi.org/10.1016/j.fsigss.2009. X: molecular evolutionary genetics analysis across comput- 08.050 ing platforms. Molecular Biology and Evolution, 35:1547- 220 Anim. Syst. Evol. Divers. 36(3), 216-221 Identification of Parrots Using CYTB Gene 1549. https://doi.org/10.1093/molbev/msy096 ca em Psitacídeos (Aves: Psittacidae): Padrões e Processos Lahaye R, van der Bank M, Bogarin D, Warner J, Pupulin F, de Diversificação no Neotrópico. Universidade de São Paulo, Gigot G, Maurin O, Duthoit S, Barraclough TG, Savolainen Instituto de Biociências, São Paulo, pp. 1-151. V, 2008. DNA barcoding the floras of biodiversity hotspots. Wink M, Sauer-Gürth H, 2000. Advances in the molecular sys- Proceedings of the National Academy of Sciences of the tematics of African raptors. In: Raptors at risk (Eds., Chan- United States of America, 105:2923-2928. https://doi.org/ cellor RD, Meyburg BU). WWGBP/Handcock House, Sur- 10.1073/pnas.0709936105 rey, pp. 135-147. Lee JCI, Tsai LC, Huang MT, Jhuang JA, Yao CT, Chin SC, Wirtz S, Böhm C, Fritz J, Kotrschal K, Veith M, Hochkirch A, Wang LC, Linacre A, Hsieh HM, 2008. A novel strate- 2018. Optimizing the genetic management of reintroduction gy for avian species identification by cytochrome b gene. projects: genetic population structure of the captive Northern Electrophoresis, 29:2413-2418. https://doi.org/10.1002/ Bald Ibis population. Conservation Genetics, 19:853-864. elps.200700711 https://doi.org/10.1007/s10592-018-1059-6 Moore WS and DeFilippis VR, 1997. The window of taxonom- Witzenberger KA, Hochkirch A, 2011. Ex situ conservation ge- ic resolution for phylogenies based on mitochondrial cyto- netics: a review of molecular studies on the genetic conse- chrome b. In: Avian molecular evolution and systematics (Ed., quences of captive breeding programmes for endangered an- de Mindeel DP). Academic Press, New York, pp. 84-119. imal species. Biodiversity and Conservation, 20:1843-1861. Presti FT, Guedes NMR, Antas PTZ, Miyaki CY, 2015. Popula- https://doi.org/10.1007/s10531-011-0074-4 tion genetic structure in Hyacinth Macaws (Anodorhynchus hyacinthinus) and identification of the probable origin of confiscated individuals. Journal of Heredity, 106(S1):491- Received April 7, 2020 502. https://doi.org/10.1093/jhered/esv038 Revised July 3, 2020 Ribas CC, 2004. Filogenias Moleculares e Biogeografia Históri- Accepted July 7, 2020 Anim. Syst. Evol. Divers. 36(3), 216-221 221