loading

Logout succeed

Logout succeed. See you again!

ebook img

at all. Taxonomic studies on some leuconostoc-like organisms from fermented sausages: description of a new genus Weissella for the Leuconostoc paramesenteroides group of species PDF

pages9 Pages
file size0.676 MB
languageEnglish

Preview at all. Taxonomic studies on some leuconostoc-like organisms from fermented sausages: description of a new genus Weissella for the Leuconostoc paramesenteroides group of species

Journal of Applied Bacteriology 1993,7 5, 595-603 Taxonomic studies on some leuconostoc-like organisms from fermented sausages: description of a new genus Weissella for the Leuconostoc paramesenteroides group of species M.D. Collins, J. Samelisl, J. Metaxopoulos’ and S. Wallbanks AFRC Institute of Food Research, Department of Microbiology, Reading Laboratory, Reading, UK and ’Agricultural University of Athens, Department of Food Science and Technology, Athens, Greece 4509/03/93:a ccepted 3 July 1993 M.D. COLLINS, J. SAMELIS, J. METAXOPOULOS AND s. WALLBANKS. 1993. Taxonomic studies were performed on some unknown Leuconostoc-like organisms from fermented Greek sausage. Comparative 16s rRNA sequence analysis showed the unidentified organisms represent a new line within the Leuconostoc pararnesenteroides group of species. On the basis of the results of this and earlier phylogenetic investigations, it is proposed that Leuconostoc paramesenteroides and related species be reclassified in a new genus Weissella. In addition a new species, Weissella hellenica, is proposed for the isolates from fermented sausage. INTRODUCTION acid but differed from currently-recognized species in a number of biochemical tests. In this paper we describe the Leuconstocs are a diverse group of Gram-positive catalase- phenotypic characteristics of these isolates and the results negative cocci which share many characteristics with the of a comparative 16s rRNA phylogenetic analysis. genus Lactobacillus and other ‘lactic acid bacteria’. Apart from their typically irregular coccoid morphology, leuco- MATERIALS AND METHODS nostocs are distinguished from gas-forming hetero- fermentative lactobacilli primarily by their inability to Bacterial strains produce ammonia from arginine and the formation of only D( -)-lactate from glucose (Garvie 1986). Some atypical Strains were isolated from dry, naturally-fermented Greek species of heterofermentative lactobacilli, however, e.g. sausage on MRS agar (De Man et al. 1960) incubated at Lactobacillus viridescens and Lact. fructosus do not deami- 30°C for 3 d under anaerobic conditions. Two representa- nate arginine and form predominantly D( -)-lactate. The tive strains have been deposited in the National Collection reliable differentiation of leuconostocs from such hetero- of Food Bacteria (NCFB 2973 = LV346; NCFB fermentative lactobacilli by phenotypic criteria is currently 2972 = LV338). very difficult. Furthermore, recent molecular systematic investigations have revealed these taxa are phylogenetically Biochemical tests intermixed, In particular, 16s rRNA sequencing studies Strains were tested for Gram reaction and catalase pro- show leuconostocs comprise three distinct genetic lines : the duction (Harrigan and McCance 1976). Growth at different genus Leuconostoc sensu stricto, the Leuconostoc paramesen- temperatures was observed in MRS broth after incubation teroides group (which includes the atypical lactobacilli Lact. at 15°C for 5 d, 37°C and 45°C for 5 d, and at 4°C and confusus, Lact. minor, Lact. kandleri, Lact. halotolerans and 10°C for 10 d. Growth in the presence of 8% and 10% Lact. viridescens) and the species Leuc. oenos (Yang and NaCl was observed in MRS broth at 30°C for 5 d. The Woese 1989; Martinez-Murcia and Collins 1990, 1991 ; ability to grow at pH 3.9 was tested in MRS broth adjusted Collins et al. 1991). In the course of a survey of the lactic with HCl to pH 3.9. Strains were tested for the ability to acid flora of dry naturally-fermented Greek sausage, we iso- grow on acetate agar (Rogosa et al. 1951) adjusted to pH lated a group of Leuconostoc-like organisms. The sausage 5.6 as described by Shaw and Harding (1984). Production isolates resembled leuconostocs in producing D( -)-lactic of hydrogen peroxide was tested on manganese dioxide agar (MRS agar supplemented with 0.75% manganese dioxide and with 0.5% xanthan gum) (Whittenbury 1964). Gas Correspondence to: Dr M.D. Collms, AFRC Institute of Food Research, (CO,) production from glucose was determined in MRS Microbiology Department, Reading Laboratory, Earley Gate, Whiteknights Road, Reading RG6 ZEF, UK. broth with diammonium citrate replaced by ammonium 596 M.D. COLLINS ET AL. sulphate (Hitchener et al. 1982). The fermentation of car- tinguish the genus Weisseila from leuconostocs was synthe- bohydrates was tested according to Sharpe (1979) by the sized by the phosphoramidite method on a model 391 DNA miniplate method described by Jayne-Williams (1976). synthesizer (Applied Biosystems, Warrington, UK). The Sugar fermentation was also tested with the API 50 CHL probe was labelled with fluorescein with the ECL 3’ end system. The configuration of lactic acid formed from labelling and detection kit (Amersham International, UK) glucose was tested enzymatically by D-laCtate and L-lactate according to the manufacturer’s instructions. dehydrogenase (Boehringer Mannheim). Production of rRNA gene products for hybridizations were generated acetoin from glucose was tested by Voges-Proskauer test with two primers pA (sequence 5’ GAGAGTTTGA- (Barritt’s modification; Harrigan and McCance 1976). TCCTGGCTCAGGA) and pE* (sequence 5’ TT- Hydrolysis of arginine was tested in MRS broth without CGAATTAAACCACATGC). Amplified rDNA products meat extract but containing 0.05% glucose and 0.3% argin- (ca 1 pg) were denatured by boiling for 5 rnin and applied ine, and 0.2% sodium citrate replacing ammonium citrate to Hybond N + nylon membrane (Amersham International) (Shaw and Harding 1984). Production of dextran (slime) with the Bio-Rad slot-blot apparatus (Bio-Rad, Hemel from sucrose was observed on MRS agar in which glucose Hempstead, UK) as described by the manufacturer. DNA was replaced by 5% sucrose (Hitchener et al. 1982). was fixed to the membrane by placing it on 3 mm paper (Whatman Laboratory Division, Maidstone, UK) soaked in DNA base composition 0.4 mol I-’ NaOH, followed by 2 x 15 rnin washes in 2 x SSC (standard saline citrate). Prehybridization, Chromosomal DNA was isolated as described by Pitcher et hybridization, post-hybridization washing and immunologi- al. (1989). DNA base composition was estimated by cal detection of the probe were performed according to the thermal denaturation in standard saline citrate as described ECL kit manufacturer’s instructions (Amersham by Garvie (1978) with DNA from Escherichia coli NCDO International). Hybridizations were performed for 2 h at + 1984 (K12) (51.5 mol% G C) as standard. 42°C and probes were used at a concentration of 20 ng m l ~ P ost-hybridization stringency washes (2 x 15 16s rRNA gene sequence determination and analysis min) were performed in 1 x SSC containing 0.1% SDS at 47°C. After incubation with detection reagents, membranes Approximately 2.5 pg of chromosomal DNA was subjected were exposed to autoradiography film (Fuji, Genetic to PCR amplification in a total volume of 100 p1 containing Research Instrumentation Ltd, Dunmow, UK) for 1-3 1 unit of Tag polymerase (Amersham International). The min. Stripping of membranes for re-probing with 16s reaction involved 36 cycles of denaturation at 92°C for 2 rRNA universal probe (sequence 5’ TTACCGCGGCTG- min, primer annealing at 55°C for 1 min and primer exten- CTGGCACGT 3’) was achieved by boiling in 0.5% SDS sion at 72°C for 1.5 min. DNA was extracted with chloro- for 8 min followed by washing in 2 x SSC for a further 5 form and purified with the Geneclean I1 kit (BIO 101, min. Inc.) according to the manufacturer’s instructions. Qualit- ative analysis of the DNA fragments was performed by agarose gel electrophoresis. Sequencing of the amplified RESULTS AND DISCUSSION product was performed with LY-~~dAST P and SEQUE- All 11 sausage isolates were found to be phenotypically NASE version 2.0 sequencing kit (USB) as described pre- homogeneous and formed large coccoid (but sometimes viously by Hutson et al. (1993). Reaction products were lenticular) cells occurring in pairs or chains. The strains separated on 55 cm wedge shaped (0.2-0.6 mm) 6% were Gram-positive, catalase-negative, facultative anaer- acrylamide-7 mol I-’ urea gels at 55°C with an LKB obes. All grew slowly in MRS broth but failed to grow on Macrophor 2010 sequencing unit operated at 50 W per gel. acetate agar (pH 5.6) or in 10% NaCl. They were all het- Sequences were aligned and similarity values were deter- erofermentative although gas production was relatively mined with the Wisconsin Molecular Biology package poor. The strains were similar to leuconostocs in producing (Devereux et al. 1984). Nucleotide substitution rates (K,,,, D( -)-lactate. values) were calculated, and an unrooted phylogenetic tree The partial 16s rRNA gene sequences of representative was produced by using the algorithm of Fitch and Margol- strains of the sausage bacterium were investigated to deter- iash (1967) contained in a program written by Felsenstein mine their relationship with known leuconostocs and other (1982). lactic acid bacteria. The 165 rRNA gene sequence of strain LV346 determined by direct sequencing of amplified pro- Oligonucleotide probe hybridizations ducts is shown in Fig. 1. The sequence consisted of a con- Oligonucleotide probe Wgp (sequence 5’ CCTACCTC- tinuous stretch of 1525 nucleotides representing TTAG(C/T)(A/G)GGGGATAA 3’) designed to dis- approximately 98% of the total 16s rRNA gene. Two frag- MOLECULAR SYSTEMATICS OF LEUCONOSTOCS 597 CCUGGCUCAGGAUGAACGCUGGCGGCGUGCCAAUACAUGC~GUCGAAUGGGACCGCUUUGUGCUU~UUGAUAUGACGAGCUUGCUCUGAUUUGAUUUUUUGAUU UCAAAGAGUGGCGAACGGGUGAGUAACACGUGGGUAACCUACCUCUUAGCAGGGGAUAACAUUUGG~CAAGUGCUAAUACCGUAUAAUACCAACAACC GCAUGGUUGUUGGUUGAAAGAUGGUUCUGCUAUCACUAAGAGAUGGACCCGCGGUGCAUUAGCUAGUUGGU~GGUAAUGGCUUACCAAGGCAAUGAUGC AUAGCCGAGUUGAGAGACUGAUCGGCCACAAUGGGACUGGGACUGAGACACGGCCCAUACUCCUACGGGAGGCAGCAGUAGGG~UCUUCCACAAUGGGCGCAAGC CUGAUGGAGCAACGCCGCGUGUGUGAUGAAGGGGUUUCGGCUCGU~CACUGUUAUAAGAGAAGAACGGCACUGAGAGU~CUGUUCAGUGUGUGACGG UAUCUUACCAGAAAGGAACGGCUAAAUACGUGCCAGCAGCCGCGGU~UACGUAUGUUCC~GCGUUAUCCGGAUUUA~GGGCGU~GCGAGCGCAGA C G G U U A U U U A A G U C U G A A G U G A A A G C C C U C A G C C C U G C U C C A U G U G UAGCGGUGAAAUGCGUAGAUAUAUGGAAGAACACCAGUGGCGAAGGCGGCUUUCUGGACUGUAACUGACGUUGAGGCUCG~GUGUGGGUAGC~CAG GAUUAGAUACCCUGGUAGUCCACACCGUAAACGAUGAGUGCUAGAUGUUCGAGGGUUUCCGCCCUUGAGUGUCGCAGCU~CGCAUUAAGCACUCCGCCU GGGGAGUACGACCGCAAGGUUGAAAGCCCUCACUCAAAGGAAUUGACGGGGACCCGCAC~GCGGUGGAGCAUGUGGUUU~UUCG~GCAACGCGAAGAACCUUAC CAGGUCUUGACAUCCCUUGACAACGCUAGAAAUAGCGCGUUCCCUUCGGGGACAAGGUGACAGGUGGUGCAUGGUUGUCGUCAGCUCGUGUCGUGAGAUG UUGGGUUAAGUCCCGCAACGAGCGCAACCCCUUAUUAUUAGUUGCCAGCAUUCAGUUGGGCACUCUAGUGAGACUGCCGGUGAU~CCGGAGGAAGGUGG GGAUGACGUCRAAUCAUCAUGCCCCUUAUGACCUGGGCUACACACGUGCUACAUGGCAUAUACAACGAGUCGCUAACCCGCGAGGGUACGCUAAUCUCU UAAAGUAUGUCUCAGUUCGGAUUGUAGGCUGCAACUCGCCUACAUG~GUCGGAAUCGCUAGUAAUCGCGGAUCAGAACGCCGCGGUG~UACGUUCCCG GGUCUUGUACACACCGCCCGUCACACCAUGAGAGUUUGUACACCCAAAGCCGGUGGGGUAACCUUUUAGGAGCCAGCCGUCUAAGGUGGGACAGAUGAU UAGGGUGAAGUCGUAACAAGUAGCCGU Fig. 1 Nucleotide sequence of derived 16s rRNA of Weissellu heNenica (NCFB 2973) ments (approx. positions 50 to 200 and 900 to 1100, which ences (18 mismatches, four unmatched for a comparison of includes variable regions V1 and V6, nomenclature of Neefs 15 18 bases) between these two taxa, however, is signifi- et al. 1990) of the 16s rRNA genes of two other strains cantly greater than that observed between strains of the (LV338, LV315) were sequenced and found to be identical same species. The presence of characteristic ‘signatures’ to that of LV346, thereby demonstrating genetic homo- within the 16s rRNA of the unknown organism provides geneity of the unknown isolates. Similarity values for a further evidence of its genospecific separatedness. Most 1330 nucleotide region (ranging from positions 107 to 1410 notable of these is diagnostic sequences in helix 1007/1022 of the Escherichia coli numbering system) of the 16s rRNA of variable region V6 which readily distinguishes the sequence from strain LV346 and homologous sequences of unknown bacterium from all known species of the Leuc. over 100 reference strains from the major phylogenetic lines paramesenteroides group (Table 2). Earlier 16s rRNA within the lactic acid bacteria were determined. Approx- sequencing studies (Yang and Woese 1989; Martinez- imately 100 nucleotides proximal to the 5’ end of the rRNA Murcia and Collins 1990, 1991) demonstrated that Leuc. gene were omitted from the similarity calculations in order paramesenteroides and related species (viz. Lact. confusus, to remove alignment problems arising from considerable Lact. kandleri, Lact. minor, Lact. halotolerans, Lact. variation in the length of the V1 region (see Neefs et al. 1990 virzdescens) form a natural phylogenetic group, separate for nomenclature) between species. A matrix of representa- from Leuconostoc sensu stricto and other lactic acid bacteria. tive sequence similarities is shown in Table 1. Strain A recent comparative study of 23s rRNA gene sequences LV346 exhibited very high sequence relatedness (98.6%) to (Martinez-Murcia et al. 1993) confirmed the phylogenetic Leuc. paramesenteroides. Relatively high sequence simi- distinctiveness of the Leuc. paramesenteroides cluster and it larities were also shown with other species of the Leuc. is now evident that this grouping merits separate generic paramesenteroides group of organisms (ca 94-97 %), status. Therefore, based upon the results of the present and although significantly lower values were displayed with earlier phylogenetic investigations, we propose Leuc. para- members of Leuconostoc sensu stricto (ca 89-91 %). Evolu- mesenteroides and related species be reclassified in a new tionary distance (KnUcv)a lues between the sausage isolates, genus for which we propose the name Weissella. We further leuconostocs and other representative lactic acid bacteria propose the unknown bacterium from fermented sausage be were calculated, and a distance matrix tree constructed recognized as a new species with the name Weissella hel- . from these data is shown in Fig. 2. The branching pattern lenica of the tree reinforced the high phylogenetic affinity between the unknown strain and the Leuc. paramesen- Description of Weisseiia gen. nov. teroides group of species. In the present study we have characterized a new group (Weissellu M. L. dim. fem. n. named after Norbert Weiss, a of Leuconostoc-like organisms from dry fermented Greek German microbiologist, known for his many contributions sausage. It was evident from both 16s rRNA similarity cal- to the lactic acid bacteria). Cells are generally short rods culations and results of the distance matrix analysis that the with rounded to tapered ends or coccoid in shape occurring closest phylogenetic relative of the unknown bacterium is singly, in pairs or in short chains. Cells are Gram-positive Leuc. paramesenteroides. The number of nucleotide differ- and non-motile. Endospores are not formed. Catalase and I S .r 0 -t r-, N MOLECULAR SYSTEMATICS OF LEUCONOSTOCS 599 Fig. 2 Unrooted tree showing the Leu. mnas phylogenetic interrelationshipso f members of the genus Weissella and some other W bolotolerans lactic acid bacteria. The tree is based on a comparison of ca 1330 nucleotides. A, W wridescens W. Xandferi Aerococcus ;C , Carnobacterium; E , Lb. fermentum \ Enterococcus ;L b, Lactobacillus ;L c, Leu follax Lactococcus ;L eu, Leuconostoc; P, Leu cornosum Pediococcus ;S , Streptococcus ; V, Vagococcus; W, Weissella Leu pseudomesenteroides Leu lochs Lb ocidaphtlus Lb bomsteri Lb delbrubckii \ LC IOCtlS Lc gorvteoe cytochromes are not produced. Chemo-organotrophs, Description of Welssella h8lotolerans (Kandier, having complex nutritional requirements. Hetero- Schillinger and Welss) comb. nov. fermentative. With the exception of Weissella paramesen- A detailed species description may be found in Kandler et teroides and W. hetlenica (which produce D( -)-lactic acid) al. (1983) and Kandler and Weiss (1986). species of the genus generally produce DL lactate from glucose. Acidoduric. Growth occurs at 15°C; growth does not occur at 45°C (with the exception of some strains of W. confusa). Strains of some species hydrolyse arginine. The Description Of weissell8 k8ndleri (HolzaPfel and van cell wall peptidoglycan is based upon lysine; the inter- WYk) comb- nov- peptide bridge contains alanine, or serine and alanine, as A detailed species description may be found in Holzapfel typical constituents. The guanine plus cytosine content of and van Wyk (1982) and Kandler and Weiss (1986). DNA is 37-47 mol%. The type species is W. vzrzdescens. Description of Weissella confus8 (Holzapfel and Description of Weissell8 mlnor (Kandler, Schllllnger Kandier) comb. nov. and Weiss) comb. nov. A detailed species description may be found in Holzapfel A detailed species description may be found in Kandler et and Kandler (1969) and Kandler and Weiss (1986). al. (1983) and Kandler and Weiss (1 986). Table 2 Diagnostic sequences of Weitsella spp. in helix 1007/1022 of variable region W.p aramesenteroides UUGCUAAUCCUAGAAAUAGGACGGUUCC W. hellenica sp. nov. UUGACAACGCUAGAAAUAGCGCG.UUCC V6 of 16s rRNA W. confusa UUGACNACUCCAGAGAGGAG.CG.UUC W. halotolerans UUGACCACCUCAGAGAUGAGGC.UUUCC W. kandleri UUGACCACUCCAG AGAUGG AGC.UUUCC W. minor UUGACCACUUCAGA G AUGAAGC.UUUC W. viridescens UUGACCACUUCAGAGAUGAAGC.UUUC Paired nucleotides are shown underlined. L, W. hellenica nov. sp. D L ys-Ala-Ser Large spherical or lenticular cells d is -); D( D ci a W. paramesenteroides d (4 + + + d NT + + d D Lys-Ala, ; Lys-Ser-Ala, Spherical or lenticular cells % more the lactic of or 0 9 W. confusa + + DL L ys-Ala Short rods thickened at one end d reaction; D, e y a or del W. halotolerans + NT DL Ly s-Ala-Ser Irregular short coccoid rods ns positive; ( ), ai r st W. minor + DL Lys-Ser-Ala, Irregular short coccoid rods with rounded to tapered ends 1 I-89% the of d, Differential characteristics of species of the genus Weissella Table 3 W. Characteristic W. kandleri viridescens Acid produced from: L-Ara binose Cellobiose Galactose Maltose Melibiose Rafinose Ribose Sucrose Trehalose Xylose + - NH, from arginine + NT Dextran formation Lactic acid configuration DL DL L Murein type Lys- Ala-Gly- Ala, Ala-Ser s- y Cell morphology Irregular Small irregular rods rods ~ ~ ~ f, -, 90% more of strains positive; more strains negative; 90% or or NT, 25% more than of total lactic acid is not tested. +); L( MOLECULAR SYSTEMATICS OF LEUCONOSTOCS 601 Table 4 Differential characteristics of species of the genus Leuconostoc Leuc. mesenteroades Leuc. Leuc. Leuc. Leuc. Leuc. subsp. mesenteraides Leuc. Leuc. Characteristic carnosum citreum gelidum lactis mesenteroides subsp. cremoris oenos pseudomesenteroides Acid produced from: + + + + L- Arabinose d + + + Cellobiose d d + + Galactose d - d + + + Maltose d - + + + Melibiose d d + + Rafinose - d - + Ribose - d d d + + + + Sucrose - + + + + + Trehalose + + Xylose d d d NH, from arginine - - - - - - - - + Dextran information d NT d - - - NT Lactic acid D D D D D D D D configuration Murein type NT NT NT Lys-Ala, Lys-Ser-Ala, Lys-Ser-Ala, Lys-Ser, ; Lys-Ser-Ala, Lys-Ala-Ser +, 90% or more strains positive; -, 90% or more strains negative; d, 11-89% of strains positive; D, 90% or more of the lactic acid is D( -); NT, not tested. Description of Weissella paramesenteroldes (Garvle) bacillus broth below pH 44-50. Slime is not produced comb. nov. from sucrose. Voges-Proskauer test negative. Hydrogen peroxide is produced. Acid is produced from L-arabinose, A detailed species description may be found in Garvie glucose, fructose, mannose, a-methyl-D-glucoside, N- (1967, 1986). acetyl-glucosamine, maltose, sucrose, trehalose, D-arabitol and gluconate. Acid is not produced from glycerol, erythri- Description of Weissella viridescens (Niven and tol, D-arabinose, ribose, xylose, adonitol, P-methyl-xyloside, Evans) comb. nov. L-sorbose, rhamnose, dulcitol, inositol, mannitol, sorbitol, a-methyl-D-mannoside, amygdalin, arbutin, salicin, cello- A detailed species description may be found in Niven and Evans (1957) and Kandler and Weiss (1986). biose, lactose, inulin, melezitose, D-raffinose, amidon, gly- cogen, xylitol, fl-gentiobiose, D-lyxose, D-tagatose, fucose, L-arabitol, 2-ceto-gluconate and 5-ceto-gluconate. A very Description of Weissella hellenica sp. nov. weak and delayed reaction with galactose, D-tUranOSe and (Gr. adj. Hellenikos, Greek; N.L. fern. adj. hellenica, melibiose may be observed. The cell wall murein is type Greece, from where the bacterium was first isolated). Lys-L-Ala-L-Ser(L-Ala). The DNA base compositions of + Gram-positive, non-motile, non-sporeforming, spherical strains LV346 and LV338 were 39-4 and 40.0 mol% G C but sometimes lenticular cells usually occurring in pairs or (T,) respectively. The type strain is NCFB 2973 short chains, with a tendency to form clusters. Growth in ( = LV346). Isolated from fermented sausages. MRS broth is slow with cells tending to precipitate. Colo- nies are small, often pin-point, smooth, round and greyish Differentiation of the genus Weissella from the other white. No growth occurs at 37°C. All strains grow at 10°C lactic acid taxa and 4°C (delayed). Heterofermentative but gas production Members of the genus Weissella may be distinguished is relatively poor. All strains produce more than 98% readily from homofermentative lactobacilli, pediococci, D( -)-lactate. Catalase-negative. Arginine is not hydrolysed. enterococci, lactococci and streptococci by the formation of Growth occurs in 8% NaCI, but not in 10% NaCl or on gas from carbohydrates. A cell wall murein based upon acetate agar (pH 5.6). All strains fail to acidify Lacto- lysine with an interpeptide bridge containing alanine, or 602 M.D. COLLINS ET AL. (0) CCTACCTCTTAG(C/T)(A/G)GGGGATA3A’) directed I 2 3 4 5 6 against PCR-amplified 16s rDNA also provides an unequivocal means of distinguishing species of the genus Weissella from Leuconostoc sensu stricto (see Fig. 3). Differentlation of Welssella hellenlca from other Welssella species Weissella hellenica can be distinguished from other species of the genus Weissella by the characteristics shown in Table 3. ib) I 2 3 4 5 6 ACKNOWLEDGEMENTS M.D. Collins and S. Wallbanks gratefully acknowledge the support of the Ministry of Agriculture and Fisheries and Food. We are grateful to Professor T.O. MacAdoo (Virginia Polytechnic Institute and State University, USA) for deriving the species name and to Dr N. Weiss (Deutsche Sammlung von Mikroorganismen, Germany) for Fig. 3 Autoradiograph of slot-blot hybridizations to amplified providing murein composition. 16s rRNA gene fragments of row A: 1, Werssella paramesenterordes (NCDO 803); 2, W. confusa (NCDO 1586); 3, REFERENCES W. vrrrdescens (NCDO 1655); 4, W.m inor (NCDO 1973); 5, W. kandleri (NCDO 2753); 6, W.h alotolerans (NCFB 2781); row B: Collins, M.D., Rodrigues, U., Ash, C., Aguirre, M., Farrow, 1, W. hellenrca (NCFB 2793); 2, Leuc. mesenterordes (NCDO 523); J.A.E., Martinez-Murcia, A,, Phillips, B.A., Williams, A.M. 3, Leuc. lactrs (NCDO 533); 4, Leuc. pseudomesenterordes (NCDO and Walibanks, S. (1991) Phylogenetic analysis of the genus 768); 5, Leuc. oenos (NCDO 1674); 6, Leu. crtreum (NCDO Lactobacillus and related lactic acid bacteria as determined by 1837); row C: 1, Leuc. gelrdum (NCFB 2775); 2, Leuc. carnosum reverse transcriptase sequencing of 16s rRNA. FEMS Micro- (NCFB 2776); 3, Leuc. arnelobiosurn (NCFB 2787); 4, Leuc. fallax biology Letters 77, 5-12. (NCFB 2796); 5, Lact. caser (NCDO 161); 6, Lact. sharpeae De Man, J.C., Rogosa, M. and Sharpe, M.E. (1960) A medium (NCDO 2590); row D: 1, Lact. acetotolerans (NCFB 2798); 2, for the cultivation of lactobacilli. Journal of Applied Bacte- Lact. buchnerr (NCDO 110); 3, Lact. rhamnosus (NCDO 243); 4, riology 23, 13&135. Lact. hrlgardrr (NCDO 264); 5, Ped. pentosaceus (NCDO 990); 6, Devereux, J., Haeberli, P. and Smithers, 0. (1984) A com- Ped. dextrrnrcus (NCDO 1561). (a) Hybridized with Weissella prehensive set of sequence analysis programs for the VAX. probe Wgp; (b) hybridized with the universal probe Nucleic Acids Research 12, 387-395. Felstenstein, J. (1982) Numerical methods for inferring evolution- ary trees. Quarterly Review of Biology 57, 379-404. alanine plus serine or glycine distinguishes Weissella from Fitch, W.M. and Margoliash, E. (1967) Construction of phylogen- heterofermentative lactobacilli. The differentiation of the etic trees: a method based on mutation distances as estimated genus Weissella from Leuconostoc is more problematic and from cytochrome c sequences is of general applicability. Science requires the use of a combination of characters for particu- 155, 279-284. lar species. For example, several species (viz. W. confusa, Garvie, E.I. (1967) The growth factor and amino acid require- W. halotolerans, W. kandleri and W. minor) can be distin- ments of species of the genus Leuconostoc including Leuconostoc guished from leuconostocs by their ability to hydrolyse paramesenteroades (sp. nov.) and Leuconostoc oenos. Journal of arginine and by the formation of DL-lactate. The remaining General Microbiology 48,439-447. species, W. paramesenteroides, W. hellenica and W. virides- Garvie, E.I. (1978) Streptococcus raflnolactis (Orla-Jensen and Hansen); a group N streptococcus found in raw milk. Interna- cens, possess characteristic phenotypic profiles and can be tional JournaI of Systematic Bacteriology 28, 19&193. identified by a battery of biochemical tests (Garvie 1986; Garvie, E.I. (1986) Genus Leuconostoc. In Bergey’s Manual of Sys- Kandler and Weiss 1986; Tables 3 and 4). tematic Bacteriology, Vol. 2, ed. Sneath, P.H.A., Mair, N.S., Species of the genus Weissella form a distinct phylogen- Sharpe, M.E. and Holt, J.G. pp. 1071-1075. Baltimore: Wil- etic group which can be distinguished from members of liams and Wilkins. Leuconostoc sensu stricto by ‘signature’ bases in the 16s Harrigan, W.F. and McCance, M.E. (1976) Laboratory Methods in rRNA (Yang and Woese 1989; Martinez-Murcia and Food and Dairy Microbiology (revised ed.). London : Academic Collins 1990, 1991). A hybridization probe (sequence 5’ Press. MOLECULAR SYSTEMATICS OF LEUCONOSTOCS 603 Hitchener, B.J., Egan, A.F. and Rogers, P.J. (1982) Character- Martinez-Murcia, A.J., Harland, N.M. and Collins, M.D. (1993) istics of lactic acid bacteria isolated from vacuum-packaged Phylogenetic analysis of some leuconostocs and related beef. Journal of Applied Bacteriology 52, 3 1-37. organisms as determined from large-subunit rRNA gene Holzapfel, W.H. and Kandler, 0. (1969) Zur Taxonomie der sequences : assessment of congruence of small- and large- Gattung Lac~obacillus Beijerinck. VI Lactobaciflus coprophilus subunit rRNA derived trees. Journal of Applied Bacteriology 74, subsp. confusus nov. subsp., eine neue Unterart der 532-541. Untergattung Betabacterium. Zentralblatt fir Bakteriologie, Neefs, J.M., Van de Peer, Y., Hendriks, L. and De Wachter, R. Mikrobiologie und Hygiene II. Abt. 123, 657-666. (1990) Compilation of small ribosomal subunit RNA sequences. Holzapfel, W.H. and van Wyk, E.P. (1982) Lactobacillus kandleri Nucleic Acids Research 18, 2237-2242. sp. nov., a new species of the subgenus Betabacterium with Niven, C.F. and Evans, J.B. (1957) Lactobacillus viridescens nov. glycine in the peptidoglycan. Zentralblatt fir Bakteriologie, spec., a heterofermentative species that produces a green dis- Mikrobiologie und Hygiene. I. Abt. Orig. C3, 495-502. coloration of cured meat pigments. Journal of Bacteriology 73, Hutson, R., Thompson, D.E. and Collins, M.D. (1993) Genetic 758-759. interrelationships of saccharolytic Clostridium botulinum types Pitcher, D.G., Saunders, N.A. and Owen, R.J. (1989) Rapid B, E and F and related clostridia as revealed by small-subunit extraction of bacterial genomic DNA with guanidium thiocy- rRNA gene sequences. FEMS Microbiology Letters 108, 103- anate. Letters in Applied Microbiology 8, 151-156. 110. Rogosa, M., Mitchell, J.A. and Wiseman, R.F. (1951) A selective Jayne-Williams, D.J . (1976) The application of miniaturized medium for the isolation and enumeration of oral and fecal lac- methods for characterization of various organisms isolated from tobacilli. Journal of Bacteriology 62, 132-133. the animal gut. Journal of Applied Bacteriology 40, 189-200. Sharpe, M.E. (1979) Identification of the lactic acid bacteria. In Kandler, 0. and Weiss, N. (1986) Genus Lactobacillus. In Identrjication Methods for Microbiologists ed. Skinner, F.A. and Bergey’s Manual of Systematic Bacteriology, Vol. 2, ed. Sneath, Lovelock, D.W. pp. 233-259. Society for Applied Bacteriology P.H.A., Mair, N.S., Sharpe, M.E. and Holt, J.G. pp. 1209- Technical Series No. 14, 2nd edn. London: Academic Press. 1234. Baltimore: Williams and Wilkins. Shaw, B.G. and Harding, C.D. (1984) A numerical taxonomic Kandler, O., Schillinger, U. and Weiss, N. (1983) Lactobacillus study of lactic acid bacteria from vacuum-packed beef, pork, halotolerans sp. nov., nom. rev. and Lactobacillus minor sp. nov., lamb and bacon. Journal of Applied Bacteriology 56, 2540. nom. rev. Systematic and Applied Microbiology 4, 28& 285. Whittenbury, R. (1964) Hydrogen peroxide formation and catalase Martinez-Murcia, A.J. and Collins, M.D. (1990) A phylogenetic activity in the lactic acid bacteria. Journal of General Micro- analysis of the genus Leuconostoc based on reverse transcriptase biology 35, 13-26. sequencing of 16s rRNA. FEMS Mic~obiology Letters 70, Yang, D. and Woese, C.R. (1989) Phylogenetic structure of the 73-84. “leuconostoc” : an interesting case of a rapidly evolving Martinez-Murcia, A.J. and Collins, M.D. (1991) A phylogenetic organism. Systematic and Applied Microbiology 12, 145-149. analysis of an atypical leuconostoc : description of Leuconostoc fallax sp. nov. FEMS Microbiology Letters 82, 55-60.

See more

The list of books you might like