Logout succeed
Logout succeed. See you again!

Bacillus subtilis Strains with Antifungal Activity against the Phytopathogenic Fungi PDF
Preview Bacillus subtilis Strains with Antifungal Activity against the Phytopathogenic Fungi
Agricultural Sciences, 2017, 8, 1-20 http://www.scirp.org/journal/as ISSN Online: 2156-8561 ISSN Print: 2156-8553 Bacillus subtilis Strains with Antifungal Activity against the Phytopathogenic Fungi Ayslu Mirkasimovna Mardanova*, Guzel Fanisovna Hadieva, Marat Tafkilevich Lutfullin, Irina Valer’evna Khilyas, Leyla Farvazovna Minnullina, Adelya Gadelevna Gilyazeva, Lidiya Mikhailovna Bogomolnaya, Margarita Rashidovna Sharipova Departments of Microbiology, Institute of Fundamental Medicine and Biology, Kazan Federal University, Kazan, Russia How to cite this paper: Mardanova, A.M., Abstract Hadieva, G.F., Lutfullin, M.T., Khilyas, I.V., Minnullina, L.F., Gilyazeva, A.G., Bogo- Bacillus strains isolated from the rhizosphere soil of potato roots were eva- molnaya, L.M. and Sharipova, M.R. (2017) luated for the potential antagonistic activity against fungal pathogens in vitro Bacillus subtilis Strains with Antifungal and in vivo. Two bacterial isolates were identified as new Bacillus subtilis Activity against the Phytopathogenic Fungi. strains by 16S rRNA and GyrB gene sequencing and were designated GM2 Agricultural Sciences, 8, 1-20. http://dx.doi.org/10.4236/as.2017.81001 and GM5, respectively. Strains were characterized by their ability to inhibit growth of a number of phytopathogenic fungi. It was shown that GM5 strain Received: November 16, 2016 inhibited growth of phytopathogenic fungi more effectively than GM2 strain. Accepted: December 27, 2016 Both strains were capable of producing a number of hydrolytic enzymes as Published: December 30, 2016 well as antimicrobial metabolites (ammonia and HCN). In addition, GM2 Copyright © 2017 by authors and strain also produced siderophores. Four genes encoding antimicrobial pep- Scientific Research Publishing Inc. tides were identified in the genome of GM2 strain: ituC, bmyB, bacA and This work is licensed under the Creative srfA. Genome of GM5 contained two genes encoding for antimicrobial pep- Commons Attribution International License (CC BY 4.0). tides, srfA and fenD. Purified lipopeptide fraction from GM5 but not from http://creativecommons.org/licenses/by/4.0/ GM2 strain was able to control Fusarium solani spread in the plate assay. Open Access Furthermore, Bacillus subtilis strain GM2 promoted growth of wheat but only GM5 strain was able to protect wheat seedlings from Fusarium oxysporum infection. Keywords Bacillus subtilis, Fusarium, Phytopathogenic Fungi, Antagonistic Activity, Antimicrobial Peptides 1. Introduction Biological control is an environmentally-friendly alternative to chemical pesti- cides and it is an attractive method protecting the plants from pathogens, be- cause the wide usage of chemicals has a negative impact on the environment and DOI: 10.4236/as.2017.81001 December 30, 2016 A. M. Mardanova et al. human health. Many biocontrol agents were isolated by screening of the large number of soil or plant-associated microorganisms for antagonism against phy- topathogens in vitro or in planta [1] [2]. A number of bacterial species with an- tagonistic activity were isolated from the rhizosphere of different plants. Among those, bacilli and pseudomonads are the most common isolates [1] [2] [3] [4]. It is known that various species of the Bacillus genus are able to stimulate the plant growth [5]. Bacteria can promote plant growth through a number of me- chanisms, such as improvement of plant nutrition; induction of systemic resis- tance; toxicity to pests and antagonism pathogens [5] [6] [7]. The antagonistic activity of Bacillus is associated with the synthesis of various antimicrobial pep- tides [8] [9], secreted enzymes [10], proteins [11] and volatile organic com- pounds (VOCs) [5] [10]. Many Bacillus isolates were shown to have antifungal activity against phytopathogenic fungi that make them good biocontrol candi- dates [12] [13] [14]. Cyclic lipopeptide fengycin plays an important role in this process [15]. The strains of the species B. subtilis can vary considerably both phenotypically and genetically and that affects their antagonistic potential. Comparative analy- sis of proteomes of two B. subtilis strains with antagonistic potential highlighted the major differences in the composition of intracellular and extracellular pro- teins [11] [16], some of which can be associated with antimicrobial properties. Because of their fast growth, ability to effectively grow in low cost media and to sporulate under undesirable conditions Bacillus isolates are the attractive candi- dates for application as the biocontrol agents. There is a growing demand for such agents since it is expected that global market for biopesticides will signifi- cantly expand in the next 3 - 5 years (www.bccresearch.com/market-research/chemicals/biopesticides-chm029e.html; [17]). The aim of this study was to directly compare two antagonistic strains of Вacillus spp. isolated from potato roots, in their ability to suppress phytopatho- genic fungi through production of cyclic lipopeptides, hydrolytic enzymes and siderophores. In addition, we evaluated plant growth promoting potential of B. subtilis GM2 and GM5 on wheat seedlings. Finally, we showed that one of the two B. subtilis isolates, GM5, can protect wheat seedlings against Fusarium oxysporum and, therefore, represents a biocontrol candidate with the potential for its application in agriculture. 2. Material and Methods 2.1. Isolation and Identification of Antagonistic Strains Several bacterial strains were isolated from the rhizosphere of potato roots. The non-rhizosphere soil was removed by gentle shaking. The rhizosphere-asso- ciated soil was collected from roots by dipping and gentle shaking in sterile wa- ter under aseptic conditions. The resulting soil suspension was used to inoculate LB agar plates and pure cultures were obtained by repetitive streaking to single colonies on the additional LB plates. Plates were incubated for 48 h at 28˚C. For 2 A. M. Mardanova et al. long-term storage bacterial strains were kept at –70˚C in LB-broth with 15% glycerol (v/v). The colonies with different colony morphologies were selected for further studies. Bacterial isolates were screened for their activity against Fusarium sp. as described in section In vitro antagonistic activity. Two bacterial isolates with the highest inhibitory activity were selected for further characterization. Pure bacterial cultures grown overnight at 30˚C were analyzed by MALDI BioТyper (Bruker Daltonik). This technique is based on the comparison of a number of bacterial proteins against preexisting database. Scores were calculated by Biotyper software as arbitrary units with values between 0 and 3 as a result of comparison of each sample mass spectrum to the reference mass spectra in the Bruker database. Species identification is possible when the of score values lie between 2.300 and 3.000 according to manufacturer’s recommendations. Ge- nomic DNA was isolated by standard technique [18]. The 16S rRNA genes were amplified by PCR using primers: Fw 5’-gagtttgatcctggctcag, Rev 5’-acggttacc- ttgttacgactt. DNA gyrase subunit B genes were amplified with the following pri- mers: UP1 5’-GAAGTCATCATGACCGTTCTGCAYGCNGGNGGNAARTTY- GA and UP2r 5’-AGCAGGGTACGGATGTGCGAGCCRTCNACRTCNGCRT- CNGTCAT. PCR analysis was performed according to the established protocol [19]. PCR products were separated on agarose gel [18]. The obtained sequences were analyzed using the BLAST software (https://blast.ncbi.nlm.nih.gov/Blast.cgi). 2.2. Phytopathogenic Fungi and Culture Condition In this study we used the following phytopathogenic fungi: Fusarium avena- ceum, Fusarium oxysporum, Fusarium redolens, Fusarium solani, Fusarium sp., Alternaria tenuissima (all from Kazan Federal University Department of Micro- biology fungal collection, Kazan, Russia), Alternaria alternata TP 712, Alternaria solani 12RKL15, Doratomyces sp. 14raKKLD and Colletotrichum coccodes 14raKK6 (all from Lomonosov Moscow State University Department of Micro- biology fungal collection). The fungi were cultivated in the Czapek medium (NaNO, 3.0 g; KHPO, 1.0 g; MgSO∙7HO, 0.5 g; KCl, 0.5 g; FeSO∙7HO, 0.01 3 2 4 4 2 4 2 g; agar, 15 g; distilled water, 900 ml; pH 4.5) [20]. The plates were incubated at 28˚C for 5 - 14 days. 2.3. In Vitro Antagonistic Activity Assay The interaction studies of rhizobacteria and phytopathogenic fungi were per- formed using the in vitro dual-culture analysis. Mycelial discs with 8 mm di- ameter were cut from the target fungi colonies cultured on Czapek plates for seven days and were placed on fresh Czapek plate. Lawns of bacterial individual strains were grown on LB plates for 48 h and were excised from the plate with a sterile scalpel (8 mm). Bacterial blocks were placed at the distance of 3 cm from the fungal discs on the same agar plate. Control plates without bacterial strains were prepared simultaneously. Plates were incubated at 28˚C for 7 - 14 days and 3 A. M. Mardanova et al. examined for the inhibition of fungal growth. To calculate the percent of inhibi- tion we repeated these experiments three times. The growth inhibition of the test fungus was calculated using the following formula: Inhibition(%)=(R−r) R×100 (1) where R—(a control value) represents the radial growth of fungus in control sets. r—the radial growth of the fungus in sets with bacteria. 2.4. Antagonistic Activity of Extracellular Bacterial Metabolites Czapek broth was used in studies of antagonistic activity of extracellular bacteri- al metabolites against the micromycetes. Bacterial cultures were grown in LB broth at 37˚C for 3 days. Cells were removed by centrifugation at 13,000 g for 30 min and then supernatant was filtered through sterile 0.22 microns membrane filter (CAMEO®, GVS, Italy). The resulting supernatant was added to the Czapek broth at the 1 to 4 ratio (10 ml of bacterial culture and 40 ml of Czapek me- dium). The fungal spores were added at the concentration of 2 × 107 and culti- vated aerobically at 28˚C for 6 days on the shaker at 60 rpm (IKA®KS 4000, Germany). Next, fungal cultures were filtered through a filter paper (Whatman No. 1), dried and weighed. Czapek broth without bacterial metabolites and treated in the similar fashion to as described above served as a control. To study temperature stability of metabolites with inhibitory activity bacterial cell-free culture filtrate collected as described above was subjected to autoclave steriliza- tion (30 minutes at 121˚C). The percent of the weight reduction of test fungus was calculated using the following formula: Inhibition(%)=(W −W ) W ×100 (2) 1 2 1 where W—the weight of the test fungus in control flasks (without bacterial metabo- 1 lites). W—the weight of the fungus in flasks with media containing bacterial metabo- 2 lites. 2.5. Microscopy of Fungal Mycelia The morphological changes caused by antagonistic bacteria on the mycelia of the phytopathogenic fungal species (Fusarium sp., A. alternata) after culturing on Czapek plates for 6 - 7 days were directly examined under optical microscope (XSZ-148E, Russia, under 40× magnification). 2.6. Production of Hydrolytic Enzymes and Antifungal Metabolites Proteolytic activity was determined in well-established plate assay [21] based on the appearance of zones of clearance in the LB-agar containing skim milk (10%). The amylolytic and pectinolytic activities were evaluated on plates containing minimal M9 media [18] supplemented with 0.5% yeast extract and 0.2% soluble 4 A. M. Mardanova et al. starch (v/w) or 0.5% pectin (v/w) to test for amylase and pectinase, respectively. Plates were incubated at 30˚C and after 2 - 3 days were overlaid with 0.1% Lu- gol’s iodine to identify clear zone formation. Cellulase activity was assayed on indicator plates containing 0.5% carbox- ymetylcellulose (CMC) [22]. Plates were incubated at 28˚C for 72 h and then were extensively washed to remove bacteria off the media surface. Next, plates were stained with 1 g∙l−1 Congo Red solution for 30 min. Formation of clear zones around the colonies indicated CMC degradation. Siderophore production was assessed on chrome azurol S (CAS) agar plates by observing the color change from blue to orange. The plates were incubated at 30˚C for 5 - 7 days [22]. Ammonia production was tested in colorimetric assay. Addition of 1 ml of Nessler’s reagent to the 72-h-old bacterial culture grown in peptone broth re- sulted in the development of the yellowish-brown color if ammonia are present in the media [23]. HCN production of the isolates was detected by the method of Bakker and Schippers [24]. Briefly, HCN production was determined by the color change of the filter paper previously dipped in 2% sodium carbonate/0.05% picric acid so- lution and placed on the bacterial lawn. Brown color indicated the presence of HCN. 2.7. PCR Amplification of the Genes Responsible for the Synthesis of Antimicrobial Peptides The genes responsible for the synthesis of antimicrobial metabolites were identi- fied by PCR amplification using specific primers to sequences of genes srfA (surfactin), bacA (bacilysin), fenD (fengycin), bmyB (bacillomycin), ituC (itu- rin). Partial sequence of ituC (acyl-protein synthetase ItuC) gene from B. subtilis B010 (http://www.ncbi.nlm.nih.gov/nuccore/262182344) with the size of 468 b.p. was used to design primers for ituC gene; B. subtilis QST713 (353 b.p., http://www.ncbi.nlm.nih.gov/nuccore/DQ011330.1) sequence was used for bmyB (peptide synthase BmyB) gene; B. subtilis subsp. spizizenii TU-B-10 (615 b.p., http://www.ncbi.nlm.nih.gov/gene/11241385) sequence was used for bacA (ba- cilysin biosynthesis protein BacA) gene; B. subtilis subsp. subtilis 168 (10764 b.p., http://www.ncbi.nlm.nih.gov/gene/938306) sequence was used for srfA (surfactin synthase subunit 1 SrfA) gene; B. subtilis (7774 b.p., http://www.ncbi.nlm.nih.gov/nuccore/AJ011849.1) sequence was used for fenD (fengycin synthetase FenD) gene. Multiple alignments of the genes involved into antimicrobial peptide biosyn- thesis for sequenced B. subtilis strains present on the NCBI server (http://www.ncbi.nlm.nih.gov/) were performed to design primers to the con- servative regions (Table 1). The annealing temperature of primers was calculated using the program Oli- goCalc (http://www.bio.bsu.by/molbiol/oligocalc.html). Amplification of these marker genes showed that each gene had one specific band of the expected size. 5 A. M. Mardanova et al. Table 1. Primers for antimicrobial peptide biosynthesis genes. Annealing Name Sequence Expected size, bp Gene product temperature, ˚C ituC-F TGCCATTATTGTCTACGGAG 50 270 acyl-protein synthetase ItuC ituC-R ATAAATCATACAGCCGAC 43 bmyB-F ACGGCAGGTTTTGATTTTT 45 290 bacillomycin L synthetase BmyB bmyB-R CGTTCCTTATCTCCGGA 47 bacA-F CATTTCCAATTTTACTCTTC 44 410 bacilysin biosynthesis protein BacA bacA-R TACTTTTGCCGTGCAAGCTC 52 srfA-F AACGGGGAGCCTGTTCAATA 52 420 surfactin synthase subunit 1 SrfAA srfA-R ACAAGTTCAGGCACCGATTC 52 fenD-F AAAGGTGTGTGGAATTGATG 48 430 fengycin synthetase FenD fenD-R GCTGTCTCCTCTATCAAAAA 48 2.8. Lipopeptide Fraction Preparation B. subtilis strains GM2 and GM5 were grown in 200 ml of LB-broth at 30˚C for 72 h. Bacteria were removed by centrifugation at 12000 g for 30 min at 4˚C fol- lowed by filtration of conditioned media through 0.22 µm filters (Millipore). pH was adjusted to 2.5 using 6N HCl. Acidified conditioned media were subjected to centrifugation at 10,000 g for 30 min at 4˚C. Resulting pellets were dissolved in methanol-water (50/50), incubated for 3 h at room temperature and spun down by centrifugation at 10,000 g for 10 min. Methanol-soluble fraction was transferred to a new tube and dried under vacuum at 45˚C for 3 h. Dried sam- ples were dissolved in 50 µl of methanol-water (50/50) and used for HPLC anal- ysis. An equal volume of LB-broth was treated in a similar fashion and used as a negative control. 2.9. HPLC Analysis Lipopeptides were dissolved in methanol and separated by HPLC using Acclaim® Polar Advantage II (PA2) С18 reverse-phase column (5 µm, 250 × 4.6 mm) and UltiMate 3000 UHPLC system (Thermo Scientific, Dionex, USA) as described by Roy et al. [25]. 2.10. Antifungal Activity of Lipopeptide Fraction Antifungal activity of HPLC-purified lipopeptide fraction from B. subtilis GM2 and GM5 was determined by disc diffusion assay. Mycelial discs with 8 mm di- ameter were cut from the target fungi colonies of F. oxysporum and F. solani cultured on Czapek plates for seven days and were placed on fresh Czapek plate. 10 µl of each lipopeptide fraction (see sections Lipopeptide fraction preparation and HPLC analysis) were placed on the sterile filter discs (6.5 mm). Methanol- PBS (50/50) was used as a control. Filter discs were placed 3 cm away from the fungus and plates were incubated at 30˚C for 6 days. Formation of growth inhi- bition zone around lipopeptide-containing discs indicated the presence of anti- 6 A. M. Mardanova et al. fungal activity. 2.11. Plant Growth Promotion and Antifungal Activity of B. subtilis GM2 and GM5 on Wheat Seedlings Wheat seeds were sterilized in 70% ethanol for 30 s, washed three times with ste- rile water, incubated for 5 min in 2.5% sodium hypochlorite, washed again with sterile water three more times and air dried. Sterilized seeds were placed on ste- rile filter paper soaked in sterile water and incubated in a Petri dish at room temperature for 24 h. Twenty seedlings were selected for each experimental group. To evaluate plant growth promotion by B. subtilis GM2 and GM5 seedl- ings were incubated either with water or with 3-days old bacterial suspension (107 CFU/ml) for 1 h, placed on water soaked filter and incubated in sterile Petri dish at 25˚C for 8 days. To evaluate antifungal activity of B. subtilis GM2 and GM5 8 mm mycelial discs of 7-days-old F. oxysporum (see section In vitro antagonistic activity assay) were placed in 500 ml of sterile water and incubated for 30 minutes at room temperature with shaking (200 rpm) to release spores. Resulting spore suspen- sion was further diluted to 105 CFU/ml. Wheat seedings were placed on the ste- rile paper filters soaked either in water or in 5 ml of spore suspension and incu- bated in the Petri dishes for 8 days at room temperature. Seedling survival was expressed in percent of total number of seedlings in each group. Root and shoot dry weights were measured and the average values were calculated and com- pared to corresponding weights obtained for seedlings from the control group. 3. Results We isolated 48 bacterial isolates from three independent potato plants rhizos- phere characterized by different colony morphology. Twenty five isolates were identified as Gram positive bacteria; the remaining 23 isolates had Gram nega- tive staining. Organism identification by MALDI BioТyper showed that Bacillus species were predominant among Gram positive bacteria: Bacillus subtilis (14 isolates), Bacillus pumilus, Bacillus weihenstephanensis, Bacillus thuringiensis. Other Gram positive bacteria included Lysinibacillus fusiformes, Lysinibacillus sphaericus, Brevibacterium iodinum. Among Gram negative bacteria were iden- tified Acinetobacter calcoaceticus, Citrobacter freundii, Enterobacter amnigenus, Enterobacter cloacae, Enterobacter ludwigii, Myroides odoratus, Providencia al- califaciens, Serratia rubidaea, Serratia plymuthica, Serratia grimesii, Pseudomo- nas putida, Alcaligenes faecalis and Brevundimonas diminuta. Analysis of antagonistic activity of newly isolated strains against phytopato- genic Fusarium sp. showed that 18 Gram positive and 6 Gram negative isolates strongly suppressed the growth of this microscopic fungus. Thirteen out of 18 Gram positive bacteria were identified as B. subtilis. We selected two bacterial isolates with highest antagonistic activity against Fusarium sp., GM2 and GM5, for further studies. Both strains were gram-posi- tive endospore-forming rods. Oxidase and catalase reactions were positive for 7 A. M. Mardanova et al. both strains. The identification by Biotyper (MALDI-TOFF analysis) allowed assigning both strains to the Bacillus genus: score value for the strain GM2 was 2.150, and for GM5 – 2.164. This assignment was further confirmed by 16S rRNA and subunit B of gyrase genes homology. Based on the analysis of 16S rRNA full- gene sequence strain GM2 had the closest similarity to B. subtilis strains JCM 1465, NBRC 13719 and BCRC 10255 (99% of identity to the sequence of the available 1044 bp fragment of 16S rRNA gene). Sequence of the subunit B of gy- rase gene was 97% identical to the corresponding gene from B. subtilis subsp. spizizenii TU-B-10 (1011 bp). On the basis of 16S rRNA gene homology strain GM5 was close to the strain B. subtilis 168 (98% for sequence with the size of 1010 bp), and also to strains JCM 1465, NBRC 13719 and BCRC 10255 (98% of homology for 942 bp fragment). By the homology of subunit B of DNA gyrase gene sequence the strain GM5 was also similar to the corresponding gene from B. subtilis strains TO-A JPC, KCTC 1028 and 168 (98% for 978 bp fragment). Thus, we concluded that both isolates are the new strains of B. subtilis. As shown in Figure 1, the strains B. subtilis GM2 and B. subtilis GM5 dem- onstrated antagonistic activity against all tested phytopathogenic fungi: F. ave- Figure 1. Antagonism of B. subtilis GM2 and B. subtilis GM5 against fungal phytopathogens: (1) Alternaria alternata ТP 712; (2) Alternaria solani 12RKL15; (3) Alternaria tenuissima; (4) Fusarium avenaceum; (5) Fusarium solani; (6) Fusarium oxysporum; (7) Fusarium sp.; (8) Fusarium redolens; (9) Colletotrichum coccodes 14raKK6; (10) Doratomyces sp. 14raKKLD. Growth inhibition of fungal mycelia was examined in dual culture assay on agar plate. 8 A. M. Mardanova et al. naceum, F. oxysporum, F. redolens, F. solani, Fusarium sp., A. alternata ТP 712, A. solani 12RKL15, A. tenuissima, Doratomyces sp. 14raKKLD and C. coccodes 14raKK6. Antagonistic activity was evaluated based on the ability to inhibit growth of micromycetes colony compared to the control plates (Table 2). The highest an- tagonistic activities of both strains were observed against Doratomyces sp. 14raKKLD (GM2—72% and GM5—79%). B. subtilis GM5 had a greater ability to inhibit growth of all listed micromycetes. For example, the strain GM5 inhi- bited growth of A. alternata ТP 712, F. avenaceum, F. redolens by 72%, 66% and 65%, respectively while GM2 strain inhibited growth of the corresponding fungi by 48%, 54% and 55% respectively. Next, we tested the ability of bacterial metabolites to inhibit the growth of F. redolens in liquid culture. Growth inhibition of micromycetes in the Czapek broth containing bacillary metabolites (20% of the volume) was calculated by the comparison of amount of micromycetes’ dry biomass with the control cultures grown in media without metabolite addition (Table 3). To study the effects of heat-treatment on stability of metabolites autoclaved conditioned medium was used. Metabolites of both strains effectively inhibited growth of micromycetes in the liquid medium (by 82% and 88% for GM2 and Table 2. Inhibition of mycelial growth by B. subtilis GM2 and B. subtilis GM5 after seven days of co-culture. % of inhibition at 7 days Micromycetes B. subtilis GM2 B. subtilis GM5 Alternaria alternate ТP 712 48.5 ± 2.4 72.7 ± 4.2 Alternaria solani 12RKL15 45.5 ± 3.1 51.5 ± 2.8 Alternaria tenuissima 45.7 ± 2.6 60.0 ± 4.7 Colletotrichum coccodes 14raKK6 53.3 ± 4.0 63.3 ± 4.4 Doratomyces sp. 14raKKLD 72.4 ± 4.8 79.3 ± 4.1 Fusarium spp. 59.5 ± 3.3 64.9 ± 4.6 Fusarium avenaceum 54.8 ± 3.7 66.7 ± 3.9 Fusarium oxysporum 43.2 ± 3.5 54.1 ± 3.8 Fusarium redolens 55.3 ± 4.0 65.8 ± 3.9 Fusarium solani 44.2 ± 3.3 58.1 ± 3.8 Table 3. Effect of B. subtilis GM2 and B. subtilis GM5 metabolites on the growth of F. redolans. % of inhibition Strains Autoclaved liquid culture No heat treatment (121˚C, 30 min) B. subtilis GM 2 82.1 ± 4.7 80.6 ± 3.9 B. subtilis GM 5 88.1 ± 3.6 86.6 ± 3.8 9 A. M. Mardanova et al. GM5 strains, respectively). Autoclaving of the conditioned media did not lead to the loss of inhibitory activity (89% of inhibition by the GM5 strain and 80% by GM2 strain). Therefore, the autoclaving of conditioned media did not cause in- activation of metabolites with antifungal activity. Thus, the strains B. subtilis GM2 and B. subtilis GM5 secrete the metabolites into the growth media, which are capable micromycetes’ growth inhibition both in liquid and solid media. The B. subtilis GM2 and GM5 strains were analyzed for their ability to pro- duce hydrolytic enzymes (Figure 2) and other antimicrobial metabolites (Table 4). Both strains had extracellular protease, amylase, pectinase and cellulase activi- ties. Also both strains were able to produce such antimicrobial metabolites as ammonium and HCN. Interestingly, only GM2 strain was capable to secrete si- derophores on chrome azurol S (CAS) agar, which was revealed by orange halo formation around colonies after 5 - 7 days of incubation. There was almost no orange halo around colonies of GM5 strain even after 7 days of incubation, which indicates an absence or very low level of siderophore production under growth conditions used in our study (data not shown). The exometabolites of B. subtilis GM2 and B. subtilis GM5 affected mycelium morphology of Fusarium sр. and A. alternata in different ways. In addition to Figure 2. Production of hydrolytic enzymes by B. subtilis GM2 and GM5: I—protease production on skim milk agar, II—amylase production on medium containing 0.2% soluble starch, III—pectinase production on medium containing pectin 0.5%, IV—cellu- lose production on medium containing 0.5% carboxymetyl cellulose. Table 4. Production of antifungal metabolites by antagonistic Bacillus subtilis strains. B. subtilis strains Secreted products GM2 GM5 siderophore + – ammonia + + HCN + + Hydrolytic enzymes protease + + amylase + + pectinase + + cellulase + + *+: positive reaction; –: negative reaction. 10