loading

Logout succeed

Logout succeed. See you again!

ebook img

Biological Science, Global Edition PDF

pages1363 Pages
release year2017
file size454.26 MB
languageenglish

Preview Biological Science, Global Edition

Brief Contents 1 Biology and the Tree of Life 45 unit 5 the diverSification of life 562 BioSkills 62 26 Bacteria and Archaea 562 unit the molecular oriGin and evolution 1 of life 99 27 Protists 583 28 Green Algae and Land Plants 605 2 Water and Carbon: 29 Fungi 634 The Chemical Basis of Life 99 30 An Introduction to Animals 657 3 Protein Structure and Function 122 31 Protostome Animals 678 4 Nucleic Acids and the RNA World 137 32 Deuterostome Animals 699 5 An Introduction to Carbohydrates 151 33 Viruses 726 6 Lipids, Membranes, and the First Cells 163 un2it cell Structure and function 186 un6it how plantS work 748 7 Inside the Cell 186 34 Plant Form and Function 748 8 Energy and Enzymes: An Introduction 35 Water and Sugar Transport in Plants 771 to Metabolism 215 36 Plant Nutrition 791 9 Cellular Respiration and Fermentation 233 37 Plant Sensory Systems, Signals, 10 Photosynthesis 254 and Responses 809 11 Cell–Cell Interactions 278 38 Plant Reproduction and Development 837 12 The Cell Cycle 297 unit 7 how animalS work 862 unit 3 Gene Structure and expreSSion 315 39 Animal Form and Function 862 13 Meiosis 315 40 Water and Electrolyte Balance in Animals 880 14 Mendel and the Gene 333 41 Animal Nutrition 899 15 DNA and the Gene: Synthesis and Repair 360 42 Gas Exchange and Circulation 918 16 How Genes Work 379 43 Animal Nervous Systems 943 17 Transcription, RNA Processing, 44 Animal Sensory Systems 966 and Translation 392 45 Animal Movement 986 18 Control of Gene Expression in Bacteria 411 46 Chemical Signals in Animals 1005 19 Control of Gene Expression in 47 Animal Reproduction and Development 1025 Eukaryotes 423 48 The Immune System in Animals 1052 20 The Molecular Revolution: Biotechnology and Beyond 442 unit 21 Genes, Development, and Evolution 462 8 ecoloGy 1073 unit 49 An Introduction to Ecology 1073 4 evolutionary patternS and proceSSeS 479 50 Behavioral Ecology 1095 22 Evolution by Natural Selection 479 51 Population Ecology 1114 23 Evolutionary Processes 500 52 Community Ecology 1136 24 Speciation 524 53 Ecosystems and Global Ecology 1160 25 Phylogenies and the History of Life 540 54 Biodiversity and Conservation Biology 1183 S ince its trailblazing First Edition, Biological Science has delivered numerous biology teaching innovations that emphasize higher-order thinking skills and conceptual understanding rather than an encyclopedic grasp of what is known about biology. With each edition, this approach has grown and improved to better help students make the shift from being novice learners to expert learners. Central to this shift is a student-centered approach that provides deep support for the learning of core content and the development of key skills that help students learn and practice biology. This model represents the . . . ultimately . . . to become . . . and then to apply overarching goal of the Sixth completing the course active learners what they have learned Edition: To help novice learners as expert learners who through practice . . . to new situations . . . progress from instruction . . . think like biologists. Instruction Practice Application Content Skills TThinking like a biologist On the pages that follow, we will show how the text and MasteringBiology resources work together to achieve this goal. Unique Chapter-opening Roadmaps set the table for learning by visually grouping and organizing information to help students anticipate key ideas as well as recognize meaningful relationships and connections that are explored in the chapter that follows. 1 Biology and the Tree of Life Each Roadmap begins with a statement of why the chapter topic is important. This vervet monkey In this chapter you will learn about baby is exploring Key themes to structure your thinking about biology its new world and learning how to find starting with including including food and stay alive. It What does it mean Three of the greatest The process of represents one of the to say that something unifying ideas in biology doing biology 1.6 key characteristics of is alive? 1.1 life introduced in this Key topics from each chapter—replication. first second and third chapter are previewed, and Life is cellular 1.2 Life evolves 1.3 Life processes information 1.4 related ideas are connected both predict through linking words. The tree of life 1.5 I n essence, biological science is the study of life. It searches for ideas and observations that unify our understanding of the diversity of life—from bacteria living in hot springs to humans and majestic sequoia trees. Chapter section numbers The goals of this chapter are to introduce the nature of life and explore how biologists go about study- help students find key ideas ing it. The chapter also introduces themes that will resonate throughout this book: • Analyzing how organisms work at the molecular level. easily in the chapter. • Understanding organisms in terms of their evolutionary history. This chapter is part of the • Helping you learn to think like a biologist. Big Picture. See how on pages 60–61. Let’s begin with what may be the most fundamental question of all: What is life? 1 Big Picture Concept Maps are referenced on the opening page of related chapters, pointing students to summary pages that help them synthesize challenging topics. Instruction Practice Application Big Picture Concept Maps integrate visuals and words to Content New Diversity Big Picture help students synthesize information about challenging topics in biology that span multiple chapters and units. Skills DIVERSITY OF LIFE Big Picture activities are available at MasteringBiology Viruses are enormously Zygomycetes TtlAoihfhrrergcies ahie nnaB-tiediosgaom t,mPh saie acno tiddnnuo rEhEmeuya sakprhtiaonhorts yhwa aeBrs.esa M itcssht,oieen sd rg tii vlaei,d- ing daetsinhogvi veot eeahmlnurresetst sei teon r oleanvofeen,t o sdboinr ufgaac tllarl iiuefvaneed riiesm em dnpaoolt rtant Lmtlihvikueineyltg iaca onebTarilsml ruhdoeleaera bsnlarse od,nh t frue oueyttrnleergaigtreta oiinron teatrnisssorse ompfhrlhvosipesms;d MIGCZCYHLRGOYOOMTSRMEPIRYODCORSEMI DaTYnIEACdSO TA HyffBTsuoeopaasorkosvredeerie;de s mtisihntoor yocgoimapllendulyh t dsfcchaueoleenu tr mgbat ahi- anastnhhdt yaa tp feodrm cBealcletedr ipar oaknadr yAortcehsa eina .the domains γ-Proteobacteria Spirochaetes Multicellularity FUNGI BASIDIOMYCOTA abmnaudssi dhbirraoa;oc imknecstl,u fpduuen fgfbialls, Only some of the many lineages DOMAIN BMACyTcEoRpIAlasma Ascomycota oifBnofi rgtl ih mvPiisionc rgtteru e ordeereg (ttasoane ipliessr )mCa. chYstao iacpuret ece y ariosnn uc 2url6u st–dere3e ted2h- is SCAFipcyrmtairinnoicoocubbhtaaaececsttteeersriiaa ASCOMYCOTA Fscitnraaoucclrfllmfleu-leddi kss eea,p nmaos ntraoredsurse ccy luitsenus,a r;ase t THE BIG PICTUREtAefoUT(tbsmtgphrhhexchrelnospuieaaelcennd3412meICo.t tnruf ek t....ea c ,cB5cra ry Hirttte iYoIttαaMCIbflnsh6iriosisdnhhhgooeeonf.e-goe0iutEe ee eear pun dantm w csP– soin rh ssCu r snro ,tk ls io5otfoe oiue.kranciotidr g hentfc6 ontK olirBirtdlytegthiieloeeac eue1rcnfhtl reotieen seu t utn hrah)egorthwYbeaee eel rooson e(edf trxo dadb s tbotOhe onrc xi poaifacdd rienCbocoe ednghpbaflmtncoeUaee x h ken rinelypdeEhdnt ndia per a hct saBbxoRrvls ietli holcaot.ehi obnsaweiepohhxfaoer k f e lwmt sltluoa lteterSUoh,o u oessoi ebYplp nk hpfewaft tabt l oN tlitileiiscoeolannnan“u,thloie.u lgh.it vw psg sddeenDo s…pitrn oNeto hir rp n 1na sraowaulEneeoi3ss.rgtcwfn a wo) u TR tttm.oepcr hut rha e fdehaSerooe neel”yl nlfn sTes l aeo…E n dAwritpuAndrirochnhka Nojsw eaeywsgwDrlrl yeerl eyfyoarmrtc saIfioinuh coN asbm puto rmaoheigm.Gofr r mreacr(ssaoacvopyhiloauslnnwar ionleo pasiTned w bsr asfahogvolmareen noiebait crnsnciochinmnna cta e nersetitAtcuneshs so h ptttm rmsotAathdrehe.poo)enrreeee.r sarircct ing arwrwhdekei inanixtiiettno ethhAs ga c. BE ossaucmhtmhwrckooaaTemtamacwfrneLhmoresobaosryanmeor i nmbrfnaaa ts efaseomodr imrninearnnm oaoccugnaEPpcefl ourylasophkmelou augren ngtnonael-knhrga i- ogebaccrttrsbactelneiayneniapioe srue,rteicoi ygnieesytshunltnalseltoiltyneedeeni onntladddssiseertmgrtse i aac eall slxg ,cr oaeunppdt plantsDiatDDoOOmMMsAAIINN AECELSPDERGFCDAWDBACFTαKεδBβCγRU----ohauuu-laphCoernaiiiKrihrPPiPpnaalPoPemaeroirngrnHdcAirilacttraoryaalmranwraureolAdRteogo ootoeeaoommbflearanmeEYnmrnm titatc ntramtrla poreeAmeAsegci ey mihlciangaflooassoolsdoodhapoaahoraiiellndobbsfblbgcaeigblenagielaleaedladalaheaadaaoeeatrexdtcscscsoaaeclcseotetalsttaaetnetttsteeneeaetsaoserrsrrriitisiiaaaaaa MUafaeUapppuoCnnnlnlrrnntohcaoicidaidmlmhlcldnioodib kel knmroPt aaaluleoasetlreLunarploc u n sA ylfiaplfiamenuasmd Nuhrriisrcnnnei nTyosttahMgllsygg Sgelvlausiei e,v lc, stm meieLtc AeleotnllsNhPnlseu DetttrrlA a hoi vrPrNeat iLitI tbsyMA itlN AaoTtVLeuSaSrPCstaghcol uanrsorlsyaypmurDni pcgtmoMiuesr estousaotauuslr l cesyg ahuilonlla lsilrSmol ipewtsaeo FdnslNstlseo-o rawtvoneeca rhcls ootarrddil FCRCSCCRFMRTVSRUCSLHCWMPECGHAHXAielaecpetieooeneylhonoolheivoraoonhvuonrrtlhgcddongtumoieomlrtrvehnodlsidbenkinwlssiamfownn riareunssrspioogeaae iwbwedkgdocgdmtnotse oohesrcrlwou t earghspoooeksiwrswfjadponyahaoertemtoaossrorflib eetdtednoaollstrtaerelrseadsssnserirestressrdlesmdgmsm.smlste slaseee isdswstsstslel saoastlr.emssGNPSPGALLENYROAAEMEGDPLPENNNDEOCRRIEVNONLTTPDAOOUOSESS HYSTTTASPSOOSEOCLPESROSSTUGERROTTZLARMOOOAOSEMSMMARTCSO HEEMOSSZ::EOSA 6svfirMToascATomiitCToMToostGAsdicaATo3sltnnnieierlpepspepblc5ynhhhfff0hfvhferennihacsycpi or oethreckleee,edeeeeo0ledesenser geommhlllto0tlssaieuuesdaccrccc leec ,u osoeiicrrummmp0, smm0lponsd,sddnsoidii rieebd ,1tunnt eeeesep0r i0ht isc,,asioisspbdaaooo2nryooot8v r nss nksss l0opiadea,nai,,satsnode a,eessssss5 a , sgg ep0 ttreimil inedpraontttddesntstddnneon,lreom es 0 l r0sodmn getzcsadddts e ccddscebspmssdss0s c0oocd ri,ucnnll iiilgstiispnhoi: wmuupuvvvuv vsr0olhssa wlrtcvdtlrikiiacomeeeddeenudiiesb bedtoomnopbisredghrltrrrrv:rrflcciiiieryuieszo oonan sssnbeesssaeoseeepoahi do:rpeeedemggpneeddgcein, sasresblw n ao as ms a ru de csc:stsoppp1llm s owin v ,niie,sbmss,r pr,onn fn0hhheu e siaort a,eaebeveeass0yy ynto:rbatsld eceaa :lllis0etiauuulsk ssr idsggr e ,mmm t , ee,s 703 “You should be able to…” activities Big Picture topics include: encourage students to analyze • Doing Biology, pp. 60–61 • Evolution, pp. 560–561 important patterns within each Big • The Chemistry of Life, • NEW! Diversity of Life, Picture concept map. pp. 184–185 pp. 746–747 • Energy for Life, pp. 276–277 • Plant and Animal Form and • Genetic Information, Function, pp. 860–861 pp. 440–441 • Ecology, pp. 1206–1207 Big Picture concept map tutorials are challenging, higher-level activities that require students to build their own concept map and to answer questions about the content. They are automatically graded to make it easy for professors to assign. New to the Sixth Edition are tutorials on diversity. A wide variety of practice questions and exercises are designed to encourage readers to pause and test their understanding as they proceed through each chapter. All questions and exercises are highlighted in blue throughout the text. (a) Using the genetic code to predict an amino acid sequence (b) Your turn—a chance to practice using the genetic code Non-template strand Non-template strand 5′ATGGCCAATGACTTTCAA TAA 3′ 5′ATGCTGGAGGGGGTTAGACAT 3′ 3′ TACCGGTTA CTGAAAGTT ATT5′ 3′ TACGACCTCCCCCAATCTGTA5′ Template strand of the DNA sequence ... Template strand of the DNA sequence ... 5′.A.. wUouGld GbeC traCnscAribAedU asGACUUUCAA UAA 3′ 5′... would be transcribed as 3′ Figure and table caption ... and translated as ... and translated as questions and exercises Met (start)Ala Asn Asp Phe Gln (stop) Remember that RNA contains U (uracil) instead of T (thymine), ask students to critically and that U forms a complementary base pair with A (adenine) Figure 16.7 The Genetic Code Can Predict Amino Acid Sequences. The strand of DNA that is transcribed is the examine information in figures template strand, and the strand of DNA that is not transcribed is the non-template strand. The non-template strand has the same polarity and sequence as the RNA except that where a T occurs in DNA, a U is found in RNA. Fill in the mRNA and amino acid sequences in part (b). and tables. • The code is non-overlapping. Once the ribosome locks Once biologists understood the central dogma and genetic onto the first codon, the reading frame is established, and the code, they were able to explore and eventually understand the ribosome then reads each separate codon one after another. molecular basis of mutation. How do novel traits—such as dwarf- • The code is nearly universal. With a few minor exceptions, ing in garden peas and white eye color in fruit flies—come to be? all codons specify the same amino acids in all organisms. • The code is conservative. When several codons specify the CHECK YOUR UNDERSTANDING Check Your Understanding same amino acid, the first two bases in those codons are usu- ally identical. If you understand that … activities ask students to The last point is subtle, but important. Here’s the key: If a • Tcohme sbeinqauteionncse o of ft hbraesee sb ains emsR sNpeAc cifoy nsspteitucitfeics aam ciondoe a. cPidasrt iicnu tlhaer change in DNA sequence leads to a change in the third position protein encoded by the gene. work with important concepts of a codon, it is less likely to alter the amino acid in the final • The genetic code is redundant. There are 64 combinations of protein. This feature makes individuals less vulnerable to single bases, but only 20 amino acids plus start and stop “punctuation in the chapter. base changes in their DNA sequences. Compared with randomly marks” need to be specified. gneontyepraict eedf fceocdtse so, ft hsem eaxlli stailntegr agetinoentsi ci nco dDeN Am isneiqmuieznesc et.h eS tpahteed- You should be able to … another way, the genetic code was not assembled randomly, like 1. Underline the start and stop codons in the mRNA sequence alentdte irss r dermaawrnk afrbolym e aff ihcaietn. Itt. has been honed by natural selection 2. Q5co'U-uAUlNdAT UcITCoAdCTeIAV fEUo GSr ttGhaCtee Af hoCollUowwU miUnaAgn AayAm dCiinf-f3oe' raecnitd m seRqNuAe nsceeq upelunsc eas Tthhee cVeanlturea lo dfo Kgnmoaw, ibnigo ltohgeis tCso cdaen Knowing the genetic code and sMtoept- Tcropd-Conys:-(Stop) 1. Predict the codons and amino acid sequence encoded by a Answers are available in Appendix A. particular DNA sequence (see Figure 16.7). 2. Determine the set of mRNA and DNA sequences that could code for a particular sequence of amino acids. 16.4 What Are the Types and Why are a set of mRNA or DNA sequences predicted from a Consequences of Mutation? given amino acid sequence? The answer lies in the code’s redun- dancy. For example, if a polypeptide contains phenylalanine, you This chapter has explained that the information in DNA is put RESEARCH Research boxes teach students how QUESTION: Is the inheritance of seed shape in peas affected by whether the genetic determinant comes from a male or female gamete? we know what we know about biology by HYPOTHESIS: The type of gamete does affect the inheritance of seed shape. NULL HYPOTHESIS: The type of gamete does not affect the inheritance of seed shape. using current and classic research to model EXPERIMENTAL SETUP: the observational and hypothesis-testing Pollen from round- A cross ... to female organ of Round-seeded parent The reciprocal cross... from wrinkled- seeded parent ... wrinkled-seeded parent. receives pollen ... seeded parent. process of scientific discovery. Male parent Female parent Female parent Male parent PREDICTION OF “SEX MATTERS” HYPOTHESIS: Offspring phenotypes will be different in the two crosses. PREDICTION OF NULL HYPOTHESIS: Offspring phenotypes will be identical in the two crosses. Each Research box concludes with a RESULTS: question or exercise that asks students Results are identical to think critically about experimental design First cross: All progeny have round seeds. Reciprocal cross: All progeny have round seeds. by predicting outcomes, analyzing the setup CONCLUSION: It makes no difference whether the genetic determinant for seed shape comes from the male gamete or from the female gamete. used to test a hypothesis, or interpreting Figure 14.3 Mendel Also Performed a Reciprocal Cross. SOURCE: Mendel, G. 1866. Versuche über Pflanzen-hybriden. Verhandlungen des naturforschenden Vereines in Brünn 4: 3–47. English translation available from ESP: data found in experimental results Electronic Scholarly Publishing (www.esp.org). PROCESS OF SCIENCE Some people think that experiments are failures if the hypothesis being tested is not supported. What does it mean to say that an experiment failed? Was this experiment a failure? “Solve It” Tutorials engage learners in a multi-step investigation of a “mystery” or open question in which students must analyze real data. Instruction Practice Application Content End of chapter case studies PUT IT ALL TOGETHER: Case Study with instructor Skills resources Steps to Building Understanding Each chapter ends with three groups of questions that build in difficulty TEST YOUR KNOWLEDGE Begin by testing your basic knowledge of new information. How does gigantism affect the physiology of animals? Many species of animals on islands are larger than related species on TEST YOUR UNDERSTANDING the mainland. Scientists hypothesize that this phenomenon, called Once you’re confident with the basics, demonstrate island gigantism, evolved in response to the scarcity of competitors your deeper understanding of the material. and predators on islands. Reduced competition and predation allows species to exploit more resources and frees them from the need to TEST YOUR PROBLEM-SOLVING SKILLS hide in small refuges. 11. QUANTITATIVE The graph shown here compares the a verage Work towards mastery of the content by answering questions carapace (shell) length of mainland and island tortoises. that challenge you at the highest level of competency. Summarize the results (*** means P 6 0.001, see BioSkills 3), ratio is higher in mainland or island tortoises. *** m) 100 c h ( 80 gt NEW! “Put It All Together” case studies appear at en 60 the end of every chapter and provide a brief summary of ce l 40 a contemporary biology research in action. Each case study p 20 a r connects what students learn in class with current, real-world Ca 0 biology research questions. At least one question requires Island Mainland tortoises tortoises students to analyze real data or apply quantitative skills. Source: Jaffe, A. L., G. J. Slater, and M. E. Alfaro. 2011. Biology Letters 7: 558–561. 12. Which tortoises, mainland or island, need to eat more food per gram of their body mass? 13. Given the adverse weather conditions and prolonged drought that are associated with oceanic islands, which of the following physiological effects of gigantism would have been of the least benefit to the tortoises? a. the increased fasting ability associated with large size b. the increased physical stability associated with large size c. better maintenance of body temperature d. a larger surface area for floating on the ocean to enable long- distance migration NEW! Select Case study questions from the end of chapter 14. CAUTION True or false: The warmer the environment is, the faster are assignable in MasteringBiology. the giant tortoise can digest. NEW! Classroom activity questions about the case study 15. Suppose that a small mainland tortoise and a large island are available for clickers to help instructors easily incorporate poikilothermic, the small or large tortoise? Why? the case studies into their classroom teaching. 16. CAUTION On a trip to the Galápagos Islands, you overhear a group of tourists refer to tortoises as “cold blooded.” Explain why this word is not accurate to describe a giant tortoise. Instruction Practice Application Content Expanded BioSkills moved Skills to the front of the book NEW! Unique BioSkills reference section is BioSkills now placed earlier in the text to draw attention to key skills students need to succeed in biology. In this book you will learn that BioSkills Asking Questions and Designing Studies are essential for doing biology starting with Previously located in an appendix at the end Chapter 1: Introduces core principles and best practices BigPicture 1: Provides a visual summary of how to think like a biologist The narrative throughout the text models how to think like a biologist, of the text, this easy-to-find reference material including end-of-chapter case studies. Experiment boxes, graphs, and other visual models in each chapter help you to visualize scientific ideas. now follows Chapter 1 to better support the then using this BioSkills section to review and practice with development of skills throughout the course. Quantifying Biology Using Common Lab Tools Visualizing Biology Reading Biology Each BioSkill includes practice exercises. 1: Using the Metric System and 6: Separating and Visualizing 12: Reading and Making Visual 15: Translating Greek and Latin Significant Figures Molecules Models Roots in Biology 2: Reading and Making Graphs 7: Separating Cell Compo- 13: Reading and Making 16: Reading and Citing the 3: IBnatersr parnedti nUgs iSntga nSdtaatrids tEicrarol r n ebny tCsentrifugation 14: RPehayldoignegn Cehtiecm Tirceaels Primary Literature Tests 8: Using Spectrophotometry Structures 4: Working with Probabilities 9: Using Microscopy See 2: Reading and Making 5: Using Logarithms 10: Using Molecular Biology Graphs Tools and Techniques 11: Using Cell Culture and wsuhcecreess wsuhcecreess Model Organisms as Tools requires requires Monitoring Your Own Learning where success requires 17: Recognizing and Correcting Misconceptions Table B3.1 Asterisk Rating System for P Values and Statistical Significance 18: Using Bloom’s Taxonomy for Study Success P Value Asterisk Rating Statistical Significance Level Meaning 1188 P > 0.05 None Not significant Greater than a 1 in 20 chance of being wrong (i.e., incorrect rejection of the null hypothesis) P < 0.05 * Statistically significant Less than a 1 in 20 chance of being wrong P < 0.01 ** Statistically significant Less than a 1 in 100 chance of being wrong P < 0.001 *** Statistically significant Less than a 1 in 1000 chance of being wrong EXPANDED! BioSkill on Interpreting Standard Error Bars and Using Statistical Tests includes a new discussion of commonly used tests, such as chi square, t-test, and analysis of variance (ANOVA). A new section discusses interpreting P values and statistical significance. BioSkills review questions are available in the Study Area for self-paced learning and practice. Additional BioSkills questions in the item library are assignable for homework. Instruction Practice Application Making Models 25.1 Tips on Drawing Phylogenetic Trees Content Model-based reasoning boxes, videos, The closeness of taxon labels cannot be used to determine and aligned questions added throughout book and in MasteringBiology relationships among taxa. To understand why, you must view and Skills draw trees as flexible models that can rotate at each node (like mobiles hanging from a ceiling) rather than as a static structures. Atlantic Sockeye Pink Pink Sockeye King NEW! Unique Making Models boxes King Coho appear at strategic points throughout chapters as a guide for developing a Coho Atlantic deeper understanding of biology concepts These trees have the same meaning. by interpreting and creating visual models. MODEL Draw one more “equivalent” tree with the same meaning as the two above, rotating one or more of the nodes. To see this model in action, go to https://goo.gl/mskc9S Readers can access the videos via QR codes, through the eText, or in the Study Area of MasteringBiology. NEW! Interactive whiteboard videos accompany each Making Models box to reinforce learning and to demonstrate how to build visual models. NEW! Making Models activities are assignable for homework and include the whiteboard videos plus application questions that help in developing the skills of interpreting visual models. Informed by current science education research and Instruction Practice Application curriculum reform strategies, the Sixth Edition instructor resources Content For instructors, assessment provide a broad range of easy-to-use assessment options. matrix with Bloom’s rankings, and Vision and Change core Skills concept and competency tags NEW! Chapter Assessment Grids help instructors quickly identify suitable assessment questions in the text according to Bloom’s taxonomy ranking, core concepts and core com- petencies discussed in the Vision and Change in Under- graduate Biology Education report, and, when applicable, common student misconceptions. “Blue Thread” questions, including end-of-chapter problems, are ranked BLOOMS TAXONOMY RANKING according to Bloom’s taxonomy and are assignable in MasteringBiology. NEW! When applicable, common student misconceptions are addressed MISCONCEPTIONS and identified with targeted questions. NEW! Each question that covers a Core Concept from the Vision and Change VISION & CHANGE in Undergraduate Biology Education report is noted in the chapter assessment CORE CONCEPTS grid and in MasteringBiology. NEW! Core Competencies from the Vision and Change in Undergraduate VISION & CHANGE Biology Education report are indicated in the chapter assessment grid and in CORE COMPETENCIES MasteringBiology. EXPANDED! Questions, activities, and tutorials are tagged by Bloom’s ranking, and Vision and Change Core Concepts and Core Competencies.

See more

The list of books you might like