Logout succeed
Logout succeed. See you again!

BMC Developmental Biology - BioMed Central PDF
Preview BMC Developmental Biology - BioMed Central
BMC Developmental Biology BioMed Central Research article Open Access Wnt/β-catenin signaling is required for development of the exocrine pancreas James M Wells1, Farzad Esni2, Gregory P Boivin3, Bruce J Aronow1, William Stuart4, Chelsea Combs3, Angela Sklenka3, Steven D Leach2 and Andrew M Lowy*4 Address: 1Department of Developmental Biology, Cincinnati Children's Hospital Research 45267, Cincinnati, OH 45267, USA, 2The Department of Surgery, The Johns Hopkins University School of Medicine, Baltimore, MD 21210, USA, 3Department of Pathology and Laboratory Medicine, USA and 4Department of Surgery, Division of Surgical Oncology, University of Cincinnati College of Medicine, Cincinnati, OH 45267, USA Email: [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; [email protected]; AndrewMLowy*[email protected] * Corresponding author Published: 12 January 2007 Received: 10 August 2006 Accepted: 12 January 2007 BMC Developmental Biology 2007, 7:4 doi:10.1186/1471-213X-7-4 This article is available from: http://www.biomedcentral.com/1471-213X/7/4 © 2007 Wells et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: β-catenin is an essential mediator of canonical Wnt signaling and a central component of the cadherin-catenin epithelial adhesion complex. Dysregulation of β-catenin expression has been described in pancreatic neoplasia. Newly published studies have suggested that β-catenin is critical for normal pancreatic development although these reports reached somewhat different conclusions. In addition, the molecular mechanisms by which loss of β-catenin affects pancreas development are not well understood. The goals of this study then were; 1] to further investigate the role of β-catenin in pancreatic development using a conditional knockout approach and 2] to identify possible mechanisms by which loss of β-catenin disrupts pancreatic development. A Pdx1-cre mouse line was used to delete a floxed β-catenin allele specifically in the developing pancreas, and embryonic pancreata were studied by immunohistochemistry and microarray analysis. Results: Pdx1-cre floxed β-catenin animals were viable but demonstrated small body size and shortened median survival. The pancreata from knockout mice were hypoplastic and histologically demonstrated a striking paucity of exocrine pancreas, acinar to duct metaplasia, but generally intact pancreatic islets containing all lineages of endocrine cells. In animals with extensive acinar hypoplasia, putative hepatocyte transdifferention was occasionally observed. Obvious and uniform pancreatic hypoplasia was observed by embryonic day E16.5. Transcriptional profiling of Pdx1-cre floxed β-catenin embryonic pancreata at E14.5, before there was a morphological phenotype, revealed significant decreases in the β-catenin target gene N-myc, and the basic HLH transcription factor PTF1, and an increase of several pancreatic zymogens compared to control animals. By E16.5, there was a dramatic loss of exocrine markers and an increase in Hoxb4, which is normally expressed anterior to the pancreas. Conclusion: We conclude that β-catenin expression is required for development of the exocrine pancreas, but is not required for development of the endocrine compartment. In contrast, β-catenin/Wnt signaling appears to be critical for proliferation of PTF1+ nascent acinar cells and may also function, in part, to maintain an undifferentiated state in exocrine/acinar cell precursors. Finally, β-catenin may be required to maintain positional identity of the pancreatic endoderm along the anterior-posterior axis. This data is consistent with the findings of frequent β-catenin mutations in carcinomas of acinar cell lineage seen in humans. Page 1 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 Background factor PTF1 as early as E12.5. Down regulation of the Wnt Over the past several years, key transcription factors and target gene N-myc and the FGFR2 gene was observed in signaling pathways that mediate pancreatic development knockout animals which correlates with the decreased have become increasingly well-defined [1]. The canonical proliferation of nascent exocrine cells and may be respon- Wnt signaling pathway has been shown to play a critical sible for the observed phenotype [10]. Interestingly at role in the development of numerous tissues, and when E14.5, there is also a significant increase in the levels of inappropriately activated, it plays a central role in tumor- the exocrine genes elastase, and amylase, suggesting that igenesis [2-5]. Prior studies have suggested the importance the absence of a Wnt signal may cause precocious differ- of Wnt signaling in pancreatic development, as expression entiation of exocrine progenitor cells. Together, our find- of Wnt1 under control of the Pdx-1 promoter was associ- ings strongly support a critical role for β-catenin in ated with murine pancreatic agenesis [6]. Another study exocrine, but not endocrine development and suggest sev- demonstrated that numerous Wnt pathway genes are eral Wnt-dependent putative regulators of exocrine cell expressed during pancreatic organogenesis [7]. Recently proliferation and differentiation during normal pancre- published studies from two laboratories examined the atic development. effects of deleting β-catenin, the central mediator of canonical Wnt signaling, in the mouse pancreas and Methods reported somewhat conflicting findings. One study sug- Generation of genetically modified mice gested that β-catenin/Wnt signaling was essential for Mice containing a floxed allele of β-catenin were a gener- development of exocrine pancreas, but played no role in ous gift of the Birchmeier laboratory. The β-catenin allele endocrine development, while the other concluded that in this animal contains LoxP sites in the second and sixth the loss of β-catenin/Wnt signaling in the developing intron as described [11]. To obtain conditional deletion mouse resulted in transient pancreatitis, but ultimately of β-catenin within the pancreas, we utilized a Pdx1-cre found that exocrine pancreas eventually recovered [8,9]. transgenic strain, developed in our laboratory, and previ- Furthermore, this study found a decrease in islet cell num- ously reported to mediate efficient recombination in the bers in β-catenin knockout mice suggesting a significant developing mouse pancreas by E10.5 [12]. Mice were gen- role for the Wnt pathway in endocrine lineage develop- otyped using PCR on digests of ear clippings. To identify ment. It is still not clear why these reports reached differ- Cre, the following primers were used to amplify a 475-bp ent conclusions, nor have the molecular pathways that act product: forward 5'-AGATGTTCGCGATTATCTTC-3'; downstream of β-catenin in the pancreas been identified. reverse 5'-AGCTACACCAGAGACGG-3'. We have utilized similar transgenic methods to delete β- The PCR conditions were 94°C for 3 min, then 30 cycles catenin expression from the developing mouse pancreas. at 94°C for 30 s, 58°C for 45 s, and 72°C for 45 s, fol- In addition, we have examined the effects of blocking Wnt lowed by 72°C for 5 min. To identify β-catenin lox ani- signaling in dorsal pancreatic explants using a specific mals, the following primers amplify a 150-bp product for biochemical inhibitor PKF118–310. Finally we compre- wild-type, and a 200-bp product for lox mice: forward 5'- hensively investigated the molecular consequences of ACTGCCTTTGTTCTCTTCCCTTCTG-3'; reverse 5'- deletion of β-catenin on embryonic pancreas develop- CAGCCAAGGAGAGCAGGTGAGG-3' [11]. The PCR con- ment using transcriptional profiling. We analyzed embry- ditions were 94°C for 3 min, then 30 cycles at 94°C for 30 onic pancreata at E14.5, before the pancreas was s, 63°C for 45 s, and 72°C for 45 s, followed by 72°C for phenotypically affected, and at E16.5, when hypoplasia of 5 min. The addition of a final concentration of 1.2 M the exocrine pancreas is evident. Our studies reveal that betaine [Sigma-Aldrich, St. Louis, MO] enhanced the reac- deletion of β-catenin during pancreatic development tion. Timed pregnancies were determined by estimating results in decreased body size of the knockout animals in that the detection of vaginal plugs occurred on E 0.5. association with severe pancreatic hypoplasia and short- ened median survival. The hypoplastic pancreas is marked Tissue processing by striking absence of exocrine mass, with preservation of Mice were euthanized using isoflurane. Pancreata were pancreatic islets. Pancreatic buds exposed to a Wnt inhib- dissected and placed in PBS, fixed in formalin followed by itor also demonstrate decreased expression of exocrine- processed in paraffin wax and sectioned at 4 μm. For fro- specific genes, suggesting that the Wnt signaling function zen sections, tissues were fixed for 2 hours at 4°C in 4% of β-catenin is responsible for the defect in exocrine devel- paraformaldehyde, washed in cold PBS and placed over- opment. Proliferation of exocrine cells is significantly night in 30% sucrose [w/v] in PBS, prior to embedding reduced, suggesting that Wnt signaling promotes exocrine and freezing in OCT. cell proliferation during development. Transcriptional profiling and quantitative RT-PCR of embryonic pancre- ata reveal significant down regulation of the transcription Page 2 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 Immunostaining changed every day and by the end of the culture period, Dewaxed sections were subjected to antigen unmasking explants were either embedded in OCT and frozen in liq- with Citrate solution pH 6. [Invitrogen Inc., Carlsbad, uid nitrogen for immunostaining analysis or put in TRI- CA]. Slides were incubated in 0.3% hydrogen peroxide/ zol® Reagent for total RNA extraction. methanol and then blocked with Beat Block, from Histo- Mouse max kit [Invitrogen Inc.] Primary antibody Anti- RNA isolation and microarray hybridization Active-β-Catenin [anti-ABC] clone 8E7 [Upstate, Char- Pancreata were dissected from 12.5, 14.5 and 16.5 day lottesville, VA] at 1:100 was applied O/N, 4°C. Secondary embryos taken from timed matings of Pdx1-cre floxed β- antibody, chromagen and counterstain were provided and catenin mice and immediately submerged in RNAlater the manufacturer's protocol was used. Primary antibodies [Ambion, Inc., Austin, TX]. Total RNA was purified using to albumin [Abcam Inc., Cambridge, MA] and amylase RNeasy columns [Qiagen, Valencia, CA] according to the [Sigma-Aldrich, St. Louis, MO] were incubated with slides manufacturer's directions and quality was assessed using at 1:3000 and 1:500, respectively, 1 hr R/T after citrate an Agilent 2100 Bioanalyzer [Agilent Technologies, Inc., epitope retrieval, avidin and biotin blocking [Invitrogen Palo Alto, CA]. 120 ng of total RNA from 2 wild type [WT] Inc.]. Nonspecific binding was blocked with appropriate and 4 β-catenin knock-out [KO] pancreata at the 14.5 and serum incubations for 30 minutes. Biotin conjugated sec- 16.5 time points was amplified twice with the Arcturus ondary antibodies [Invitrogen, Inc.] were applied 30 min- RiboAmp kit [Arcturus Bioscience, Inc., Mountain View, utes R/T followed by incubation with HRP Streptavidin 15 CA] and cRNA was labeled with biotin-UTP, CTP using T7 minutes and visualized with DAB [3, 3-diaminobenzi- RNA polymerase [Enzo Life Sciences, Inc., Farmingdale, dine, Dako, Carpinteria, CA]. They were counterstained NY]. Biotinylated cRNA from each embryonic pancreas with Mayer hematoxylin. Apoptotic cells were detected by was purified with RNeasy columns and hybridized to an flourescein in situ tunnel method, TACS TdT kit [R&D Sys- Affymetrix GeneChip mouse genome 430 v2.0 array and tems, Minneapolis, MN]. Proteinase K was used for stained using standard procedures [Affymetrix, Santa epitope retrieval and all steps were performed according Clara, CA]. The 430 v2.0 array contains 45,000 probe sets to manufacturer's protocol. representing over 34,000 mouse genes. Immunofluorescent staining Bioinformatics For immunolabeling, tissues were sectioned and fixed in We sought to identify genes whose expression was lost or 4% PFA for 15 minutes at room temperature, washed in gained as a result of loss of β-catenin gene expression. To PBS and stained as previously described [Esni et al., 2001]. do this, microarrays were generated from RNAs isolated The following antibodies were used at the indicated dilu- from independent wildtype and knockout embryos as tions; rat monoclonal anti-E-cadherin [Zymed Laborato- previously described. Affymetrix MOE430plus2 micro- ries, 1:200], goat polyclonal anti-amylase [Santa Cruz array Cel files generated from GCOS 5.0 were subjected to Biotechnology, 1:500], goat polyclonal anti-β-catenin RMA normalization as implemented in GeneSpring 7.1. [Santa Cruz Biotechnology, 1:100], guinea pig polyclonal All E14.5 genechip RMA values were converted to the ratio anti-insulin [Linco Research, 1:1000], rabbit polyclonal relative the average of the corresponding day wildtype val- anti-Pdx1 [CHEMICON International, 1:250] rabbit poly- ues. In this fashion one does not see the effect of increased clonal anti-PTF1a-p48 [gift from Dr. Helena Edlund, or decreased expression in WT E16.5 relative to WT E14.5. 1:1000], rabbit anti-phosphohistone H3 [Upstate 65– Probe sets were first filtered for those that are over- 570, 1:200]. The following reagents were purchased from expressed or underexpressed in knockout animals at Jackson ImmunoResearch Laboratories: Biotin-conju- E14.5 [486 probesets; initial criteria over 1.25 in 3 of 4 gated anti-goat, anti-guinea pig [1:250, 1:500], Cy3-con- samples or under 0.66 in 3], and the same for E16.5 [513 jugated anti-rabbit [1:300], Cy2-conjugated anti-rat probesets, initial criteria over 1.33 in 4 or under 0.5 in 4]. [1:300], and Cy2-, Cy3-, C5-conjugated streptavidin These two lists were combined [967] and then subjected [1:300, 1:1000, 1:100]. to statistical analysis differentially expression in knock- outs with p < 0.05 using the Students T-test assumption of Explant culture of embryonic pancreas equal distribution and Benjamini-Hochberg false discov- Isolation and culture of pancreatic rudiments were carried ery corrected p-values. This procedure generated a list of out essentially as previously described [13]. Intact E10.5 770 probe sets. Log2 gene expression ratios were then sub- dorsal pancreatic buds were dissected and cultured on jected to hierachical clustering using the standard correla- Millipore® filters for 7 days in culture medium [BioWhit- tion distance metric as implemented in GeneSpring. taker Medium 199, 10% fetal calf serum, 50 U/ml penicil- Individual clusters were then analyzed for functional lin G-streptomycin, 1.25 ug/ml Fungizone®] in the relatedness of genes within the cluster using David 2.0. presence or absence of 20 nM Wnt-pathway inhibitor compound PKF118–310 [ref]. Culture medium was Page 3 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 Quantitative RT-PCR 5'-AGGAAAGAGAGTGCCCTGCAAG-3' reverse For quantitative RT-PCR, total RNA was purified and char- acterized as described above. 500 to 1000 ng of RNA was Results converted to cDNA using random hexamers and Super- β-catenin knockout results in small body size, severe script III [Invitrogen, Carlsbad, CA]. Amplification was pancreatic hypoplasia and early lethality carried out with an ABI 7300 real time PCR system We achieved pancreas-specific deletion of β-catenin by [Applied Biosystems, Foster City, CA] using SYBR green breeding a Pdx1-cre strain developed in our laboratory and the standard protocol. The reference gene was β-glu- with a strain containing a floxed β-catenin allele in the sec- curonidase for all genes except Ptf1, for which Gapdh was ond and sixth intron [11,12]. Pdx1-cre mice heterozygous used. Data was normalized using the delta-delta-Ct for the floxed β-catenin allele displayed no apparent method. Whenever possible, primers were designed to abnormalities in either the embryonic or adult pancreas. span an intronic sequence and were validated by PCR and Mice with conditional knockout of both β-catenin alleles gel analysis. in the pancreas [Pdx1-cre floxed β-catenin] were viable, but demonstrated small body size at birth that persisted into Primer sequences were as follows: adulthood. For simplicity, these animals are referred to as β-catenin KO in the remainder of the text. β-catenin KO β-glucuronidase mice showed no obvious defects in their ability to nurse or wean, but had a significantly shortened lifespan, with a 5'-TTGAGAACTGGTATAAGACGCATCAG-3' forward median survival of 29 days [Figure 1A–B]. Several mice did survive to greater than 6 months. Necropsy revealed 5'-TCTGGTACTCCTCACTGAACATGC-3' reverse no gross defects in development of the stomach, duode- num, colon, spleen or other organs. The pancreata, how- Gapdh ever, were severely hypoplastic, averaging 30% of the 5'-AATGGTGAAGGTCGGTGTG-3' forward 5' GAAGATGGTGATGGGCTTCC 3' reverse Amylase 5'-GGTTCTCCCAAGGAAGCAG-3' forward 5'-TGTCACACGGCCATTTCC-3' reverse Elastase 5'-CATCCAGACAGCTTGCCTC-3' forward 5'-CTCAGGGTGTCAGGACTGTTC-3' reverse Fgfr2 5'-AAGCAGGAGCATCGCATTGG-3' forward 5'-TGACGGGACCACACTTTCCATA-3' reverse N-myc 5'-CTCAAGTCAGTGCAGGCGAG-3' forward PlFifaiegnsucprraeena sa1-nsdp eac hifiycp doeplleatsitoicn golaf nβd-catenin results in shortened Pancreas-specific deletion of β-catenin results in 5'-CCACCGTTACGACATCAATCTC-3' reverse shortened lifespan and a hypoplastic gland. β-catenin KO mice have a median survival of 29 days [A], reduced Ptf1 body size [B] and the pancreas averages 30% of the weight of a wildtype organ [C]. 5'-CAGGCCCAGAAGGTTATCATCTG-3' forward Page 4 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 weight of pancreata from wildtype littermates [Figure 1C]. pancreatic mass, corresponding to a decrease in the Although the cause of death is not known, we have deter- number of recognizable nascent acini [Figure 4A–B]. mined that it is not due to defects in endocrine pancreas function [discussed below]. This finding led us to hypothesize that in normal pancre- atic development, the presence of Wnt signaling would be β-catenin knockout results in loss of exocrine pancreatic critical prior to E16.5. To explore this idea, we examined tissue embryonic pancreas for expression of the dephosphor- To determine the effects of β-catenin deletion on pancre- ylated, active form of β-catenin using a phospho-specific atic morphology, we examined pancreata by standard antibody. We detected activated β-catenin protein expres- H&E staining. At birth, pancreatic tissues from the condi- sion at E12.5 that remained at E14.5 but then rapidly dis- tional β-catenin knockout mice had were characterized by appeared by E16.5 Figure [4C–E]. Dephosphorylated β- a striking paucity of acinar cell mass, numerous tubular catenin protein expression was primarily membranous structures suggesting acinar to duct metaplasia. In addi- and cytoplasmic but rarely nuclear, a finding also reported tion, we observed increased parenchymal fibrosis, and a by Murtaugh et al. [8]. This data suggest that Wnt signal- variable degree of surrounding inflammatory infiltrate, ing is active in developing pancreas prior to the secondary which became more severe by one month of age [Figure transition and that exocrine development likely requires 2A–F]. The phenotype progressed with age as the pancre- Wnt activity until E16.5, but not later as transcriptionally ata from mice surviving longer than 2 months often dem- active dephosphorylated β-catenin is undetectable there- onstrated near complete absence of acinar cell structures after. [Figure 2G–H]. The inflammatory infiltrate associated with the intralobular fibrosis was reminiscent of acute on Preserved acini express β-catenin chronic pancreatitis. In four animals of 23 (17%) exam- Given that the β-catenin KO was based on conditional ined that survived beyond three months, the pancreatic activation of the cre recombinase expressed from a trans- harvested at necropsy had a liver-like histology on H&E, genic allele, it is likely that cre expression was mosaic. suggesting the possibility of hepatic transdifferentiation. While the majority of the acinar pancreas was absent, it Immunostaining of these tissues was positive for albumin was striking that there were clusters of normal appearing demonstrating that a liver-like differentiation program acini. Therefore, we hypothesized that the presence of pre- may be activated in these tissues [Figure 2I–K]. served acini would correspond to the presence of β-cat- enin expression. This proved to be the case as essentially Pancreatic islets cells are preserved in the β-catenin all acini were found to express β-catenin. Co-staining for knockout β-catenin/carboxypeptidase A in E 12.5 pancreata [Figure Pancreatic islet cell number was quantitated in wildtype 5A] revealed that pancreatic enzyme expression is present and β-catenin KO mice by counting islets in serial pancre- only in cells co-expressing β-catenin. It was extremely rare atic sections from newborn mice. We found no significant (<1% of acini) to identify expression of pancreatic acini in difference in islet cell numbers suggesting endocrine the absence of β-catenin expression strongly suggesting development is preserved in the β-catenin KO mouse the requirement o β-catenin expression for proper exo- [data not shown]. Endocrine cells were further character- crine development. ized by immunostaining for insulin and glucagon. These studies revealed that despite the absence of β-catenin Pancreatic progenitor cells expressing Pdx1 are expression, insulin and glucagon cells were present and maintained in the β-catenin KO pancreas normally distributed within the islets [Fig 3A–F]. Three We next sought to evaluate whether deletion of β-catenin separate fasting glucose levels were obtained from 6 one influenced the development of pancreatic progenitors month-old β-catenin KO mice. All mice were found to be expressing Pdx1. In other genetically modified mice, pan- euglycemic [data not shown]. This constellation of find- creatic hypoplasia has been associated with a reduction in ings suggest that no significant defect in endocrine devel- the Pdx1-expressing progenitor cells [14]. We analyzed opment following deletion of β-catenin from the pancreata at E12.5 and found no difference in the number developing mouse pancreas. of cells expressing Pdx1 in the β-catenin KO versus the wildtype [Figure 6A]. Next, we evaluated the expression of β-catenin function is required prior to E16.5 in pancreatic PTF1A-p48, whose expression become restricted to exo- development crine cells at approximately E12.5. As early as E14.5, β-cat- We next analyzed pancreata from β-catenin KO mice enin KO pancreata displayed reduced expression of PTF1 beginning at ED 12.5 to determine when pancreatic devel- protein [Figure 6B]. This data demonstrates that the defect opment was perturbed. We noted no obvious difference in exocrine pancreatic development observed in the β-cat- in the size of pancreata until E16.5, at which point loss of enin KO is not a result of depletion of Pdx1 expressing β-catenin results in an obvious and consistent decrease in progenitors. Instead, a population of cells marked by high Page 5 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 βF-icgautreen in2 KO pancreata display extensive loss of exocrine tissue β-catenin KO pancreata display extensive loss of exocrine tissue. Hematoxylin and eosin stained paraffin sections were used to compare the histology of wildtype versus β-catenin KO pancreata at one day, one month and two months of age. Compared to one day old wildtype pancreas [A], the absence of acini is readily apparent at low power [D]. At two months of age, compared to wildtype [B, C] the β-catenin KO pancreas is hypoplastic with increased areas of interlobular fibrosis [E]. Under 20× magnification, increased formation of tubular duct-like structures are present suggesting acinar to duct metaplasia (arrows) and inflammatory infiltrate (circled) are evident [F and H]. By two months, low power views demonstrate extensive fibrosis and near complete absence of exocrine pancreatic tissue, likely accounting for the shortened lifespan seen in these ani- mals [E and G]. In several mice aged beyond three months, areas of pancreatic parenchyma histologically resemble liver. Immu- nostaining for albumin is absent in wildtype pancreas [J], but abundant in normal liver [I] and in β-catenin KO pancreata [K]. Page 6 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 FEnigduorceri n3e cells are preserved in the absence of β-catenin Endocrine cells are preserved in the absence of β-catenin. Immunofluorescent staining of E15.5 comparing wildtype [A- C] and β-catenin KO [D-F] demonstrates preservation of insulin and glucagon expressing cells in the β-catenin KO [CKO]. PTF1A-p48 expression is severely reduced in the β-catenin the temporal expression of dephosphorylated β-catenin at KO mouse. this stage in the developing pancreas. However, β-catenin also functions in the E-cadherin-catenin cell adhesion Proliferation rate, not apoptosis distinguishes β-catenin complex and it is therefore possible that part of the phe- KO pancreata from wildtype notype we have observed is related to this function of β- In order to determine if the loss of acinar cells in the β-cat- catenin [15]. To investigate this possibility, we cultured enin knockout was related to a decrease in proliferation of explants from E10.5 dorsal pancreatic buds for 7 days in β-catenin-deficient cells, we performed immunostaining the presence of a specific inhibitor of β-catenin/Tcf tran- of β-catenin KO and wildtype pancreata at ED 14.5 using scription, PKF118–310 [16]. Typically, E10.5 dorsal pan- an antiphosphohistone H3 antibody [Figure 7]. These creatic explant cultures robustly express exocrine markers studies revealed a significantly decreased proliferation after 7 days in culture [13]. In contrast, inhibition of Wnt rate in the β-catenin KO versus wildtype [28.2% vs. 48.6% signaling in dorsal bud explants results in a significant p < 0.05, t-test]. We also evaluated for the presence of decrease in expression of amylase, similar to the findings apoptosis within the β-catenin KO animals using a observed in vivo [Figure 8]. When the inhibitor was TUNEL assay, but did not find any significant differences applied after 3 days, no significant effect was observed, between wildtype and knockout animals [data not suggesting that the importance of Wnt signaling in this shown]. These findings suggest that β-catenin expression system is restricted to the first 3 days in culture. These data is required for proliferation, rather than apoptotic resist- provide additional evidence that the Wnt signaling func- ance of exocrine progenitors. tion of β-catenin is required to regulate exocrine cell pro- liferation and differentiation in the fetal pancreas. The Wnt inhibitors result in decreased amylase expression in persistence of PTF1 protein expression in vitro may reflect dorsal pancreatic explants onset of its expression prior to inhibitor addition. Alterna- Thus far, we have demonstrated that deletion of β-catenin tively, loss of PTF1 expression that we observed in vivo is associated with a defect in exocrine development, pos- may be regulated by a Wnt independent function of β-cat- sibly related to decreased proliferation of exocrine pro- enin. Finally, these experiments do not rule out a role for genitors. It is probable that such a defect relates to a β-catenin in cell adhesion in vivo at later stages of devel- decrease in the Wnt signaling function of β-catenin, given opment or in the adult. Page 7 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 βF-icgautreen in4 KO pancreas is hypoplastic by E16.5 β-catenin KO pancreas is hypoplastic by E16.5. Panels A and B depict hematoxylin and eosin staining of E 16.5 wildtype and β-catenin KO pancreas, respectively, each at 25× magnification. Hypoplasia of the developing pancreas is already apparent and was consistently present by this stage. Panels C, D, and E demonstrate wild-type pancreata at E 12.5, 14.5 and 16.5, respec- tively, stained with an antibody specific for the transcriptionally active, dephosphorylated form of β-catenin. Note that staining is abundant at ED12.5, but is undetectable following the secondary transition at E16.5. Transcriptional profiling reveals significant changes in change in β-catenin expression around the secondary gene expression following deletion of β-catenin transition; expression of dephospho-β-catenin is high at Although β-catenin has been shown to be necessary for E14.5 and it is absent at E16.5. Second, there is no mor- proper pancreas development, the molecular pathways phological phenotype at E14.5 whereas at E16.5 there is that are perturbed downstream of β-catenin are largely significant exocrine hypopalsia. We harvested the embry- unidentified. Targets of β-catenin/Tcf transcription have onic pancreas from two wildtype, and four β-catenin KO been demonstrated to be tissue specific [17,18]. Given our mice at E14.5 and E16.5, and extracted total RNA for stud- findings that β-catenin KO inhibits exocrine pancreatic ies using Affymetrix GeneChips and quantitative RT-PCR development, we sought to identify targets of β-catenin/ [QPCR]. Analysis of the transcriptional profiles demon- Tcf transcription that are changed in association with the strated significance differences between wildtype and β- β-catenin KO. We chose to assay the whole pancreas tran- catenin KO pancreata at each timepoint [Figure 9A, Table scriptome at two timepoints, E14.5 and E16.5. These 1]. There was more variability in the E14.5 sample, possi- stages were chosen for two reasons, first there is a marked bly due variability in harvesting these smaller pancreata or Page 8 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 cant decrease in expression of N-myc at both time points [decreased by 2 fold at E14.5]. Consistent with this, N-myc was only recently shown to be a direct target of Wnt sign- aling in the lung [10]. GeneChip studies also revealed a 1.7 fold decrease in the expression of transcripts encoding Fgfr2 at E14.5, consistent with the role of this receptor in exocrine pancreas development [19]. QPCR confirmed decreases in these transcripts in the β-catenin KO mouse [Figure 10A-D]. Other notable genes significantly reduced at E14.5 included musashi homolog 2 (Msi2h) [2 fold], an RNA binding protein implicated in maintaining the identity of progenitor cell fates in the brain [20] and hedgehog-inter- acting protein [Hhip] [1.9 fold] suggesting a potential role for this signaling pathways in exocrine pancreatic devel- opment. A transcription factor of unknown function, the leucine zipper-like transcription factor1 (Lzltf1), was among the most reduced genes at E14.5, with its expres- sion being decreased by an average of 5.9 fold. Hox b4 was significantly increased in E16.5 β-catenin mutant pancreata suggesting that loss of Wnt signaling results in a partial homeotic transformation [21]. This is further sup- ported by the appearance of albumin-expressing cells in the adult pancreas [Figure 2I]. Among the transcripts most down regulated in E16.5 β- NFiagsucreen t5 acini in the β-catenin KO mouse expressβ-catenin catenin KO mutants included acinar cell specific genes Nascent acini in the β-catenin KO mouse expressβ- such as pancreatic elastase (Ela3b), and trypsin (Try4). catenin. Immunofluorescent staining of E12.5 pancreata Interestingly, at E14.5, the transcript for pancreatic demonstrating decreased expression of β-catenin carbox- elastase (Ela3b) was upregulated an average of 11.3 fold, ypeptidase A and amylase in the β-catenin KO [CKO] as and the transcript for pancreatic amylase2 (Amy2) was compared to wildtype. Note that cells expressing carbox- ypeptidase A co-express β-catenin [arrows]. upregulated an average of 2.3 fold. QPCR confirmed the upregulation of transcripts at E14.5 as compared to wildtype, and demonstrated the reversal of this pattern by due to stage variation as the developmental range of an E16.5 [Figure 10B]. Interestingly, immunostaining did E14.5 embryo is significant. Also, this is when the second- not reveal increases in elastase or amylase protein levels at ary transition is occurring and one might normally expect E14.5. Uniformly, however, all exocrine gene transcripts to see many gene expression changes at this stage of pan- were dramatically down regulated by E16.5 compared to creatic development. As a result, we used less stringent ini- wildtype. These data suggest that the tight control tial criteria for filtering transcripts that might be regulated between proliferation and differentiation is perturbed in by β-catenin [see Methods]. Clustering revealed very good β-catenin mutants. Despite the lack of an endocrine phe- consistency, and in all, 770 probe sets that mapped to 645 notype in the β-catenin KO mice, we did observe upregu- non-redundant genes were identified as differentially lation of transcripts for insulin I (Ins1) [4.7 fold], and a expressed between wildtype and either or both of these slight increase in glucagon (Gcg) [1.4 fold] at ED14.5. By time points. The most differentially expressed genes at 16.5, however, none of these genes were differentially each time point are summarized in Tables 1, 2, 3, 4. Gene- expressed compared to wildtype mice. "Raw and normal- Chip and QPCR were congruent with our immunostain- ized microarray data from this study can be obtained from ing findings as Pdx1 transcript levels did not differ the Gene Expression Omnibus (GEO) at the National between wildtype and β-catenin KO. Expression of PTF1 Center for Biotechnology Information (NCBI) database transcript was reduced in the β-catenin KO at E14.5 by [22]. microarray and as early as E12.5 by QRT-PCR [Figure 9B]. We observed no change in expression of the canonical Discussion Wnt target genes Cyclin D1 or C-myc by either RNA assay β-catenin is the central mediator of the canonical Wnt sig- (data not shown). Instead, our studies revealed a signifi- naling pathway and regulates many cell fate decisions dur- Page 9 of 18 (page number not for citation purposes) BMC Developmental Biology 2007, 7:4 http://www.biomedcentral.com/1471-213X/7/4 A PFdigxu1r eex p6ressing progenitors are preserved in β-catenin KO pancreas Pdx1 expressing progenitors are preserved in β-catenin KO pancreas. Panel A demonstrates immunofluorescent staining of E 12.5 pancreas from wildtype and β-catenin KO [CKO] revealing preservation of the Pdx1 expressing cell popula- tion. This suggests that the loss of exocrine pancreas seen later is not due to a loss of Pdx1 expressing progenitors. Panel B depicts E14.5 pancreas from wildtype and β-catenin KO stained for PTF1p48. Note the significant reduction in PTF1 expressing cells is already obvious at this developmental stage. ing normal development in numerous tissues. pathway may be an important mediator of pancreatic Deregulation of β-catenin/Wnt signaling is a sentinel development. Recently, two separate reports were pub- event in colorectal neoplasia and contributes to tumori- lished that examined the effects of genetically deleting β- genesis in many other sites. Mutations in β-catenin have catenin in the developing pancreas, using similar methods been demonstrated in exocrine pancreatic cancers, pan- to those presented in the current study. In addition, a creaticoblastoma and solid-pseudopapillary tumors [23- newly published study by Heiser et al. examined the 25]. Our laboratory has been interested in the role of Wnt effects of stabilized β-catenin on pancreatic development signaling in pancreatic neoplasia. Recent studies have [29]. While these studies utilized similar methods, their demonstrated the reactivation of pathways critical to nor- conclusions had several significant differences. The cur- mal pancreatic development, such as Notch and Hedge- rent study utilizes mouse genetics and in vitro studies of hog, during pancreatic duct carcinogenesis thus further dorsal pancreatic explants, along with gene profiling stud- linking developmental pathways with pancreatic neopla- ies to suggest molecular mechanisms by which β-catenin sia [26-28]. deletion effects mouse embryonic pancreas development. In summary, our studies show that β-catenin expression is Given the apparent role of β-catenin/Wnt signaling in cer- required for development of the exocrine pancreas, but is tain pancreatic neoplasms, we hypothesized that this not required for development of the endocrine pancreas. Page 10 of 18 (page number not for citation purposes)