loading

Logout succeed

Logout succeed. See you again!

ebook img

Bubble Statistics and Dynamics in Double-Stranded DNA PDF

file size0.45 MB
languageEnglish

Preview Bubble Statistics and Dynamics in Double-Stranded DNA

Bubble Statistics and Dynamics in Double-Stranded DNA B. S. Alexandrov,1,2 L.T. Wille,2 K.Ø. Rasmussen,1 A.R. Bishop,1 and K.B. Blagoev1 1Theoretical Division, Los Alamos National Laboratory, Los Alamos, New Mexico 87544 2Physics Department, Florida Atlantic University, Boca Raton, Florida 33433 The dynamical properties of double-stranded DNAare studied in theframework of thePeyrard- Bishop-Dauxois model using Langevin dynamics. Our simulations are analyzed in terms of two 6 probability functions describing coherently localized separations (’bubbles’) of the double strand. 0 We find that the resulting bubble distributions are more sharply peaked at the active sites than 0 found in thermodynamically obtained distributions. Our analysis ascribes this to the fact that 2 the bubble life-times significantly affects the distribution function. We find that certain base-pair n sequences promote long-lived bubbles and we argue that this is due to a length scale competition a between the nonlinearity and disorder present in thesystem. J 4 2 The role of dynamics in biological function is becom- (G-C) base-pairs, respectively, and ii) two specific het- ing increasingly clear [1, 2, 3]. Whereas protein action erogeneous sequence: Adeno Associate Viral (AAV) P5 ] andbindinghavetraditionallybeendiscussedintermsof promoter and a mutated (AAV) P5 promoter obtained t f staticstructures,itisnowevidentthatmanyfunctionali- from the wild AAV promoter by replacing two specific o s ties are consequencesofdynamics. Becauseofits biolog- neighboringA-Tbase-pairswithG-Cbase-pairs(seeRef. . ical importance and structural clarity DNA constitutes [4] for details). Finally, iii) we investigate two periodic t a an appropriate system in which to begin to understand sequences each containing 35 (T-A) base-pairs and 34 m how structure and thermal motion can work together to (G-C) base-pairsthat have differentperiodicities - G A 1 1 - determine function. In particular, the identification of - with a period of 2 base pairs and G A with a period d 5 5 n biological processes that are regulated by the dynami- of 10 base pairs. We compare our results to thermody- o cal properties of DNA is fundamentally important for namicresultsfortheinter-strandDNAopeningobtained c understanding its interaction with other molecules. Key with the same model and observe several important dif- [ mechanismsarecontrolledbyentropicallydriventhermal ferences. We emphasize that the Langevin dynamics of 1 fluctuations, which cause local dynamical changes in the the PBD model’s principal degrees-of-freedom for DNA v inter-strand separation (’bubbles’) in double-stranded base pairs is necessarily a phenomenological representa- 5 DNA molecules. Recent theoretical and experimental tionofDNA’s full complexity: microscopicfine scalesof, 5 studies [4] suggest that the base pair sequence (struc- e.g., water motions are not explicitly modeled. 5 1 ture) determines specific regions in the double-strand In the framework of the PBD model, the thermal dy- 0 that are more prone to such thermally induced strand namics of the n’th base-pair is obtained through: 6 separation. Mostimportantly,thesestudieshavedemon- 0 strateda strongcorrelationbetweenthe specific location my¨n = − V′(yn)−W′(yn+1,yn)−W′(yn,yn−1) / t of large, coherent openings, in DNA and transcription- − mγy˙ +ξ (t), (1) a n n m promoting regions of the DNA sequence for severalwell- characterized viral sequences. It has also be found [5] where d- that the DNA dynamics in the presence of UV induced V(y)=Dn(e−any−1)2, n dimersbetweentwoadjacentthyminebases(TT-dimers) is an on-site Morse potential modeling the hydrogen o isdramaticallyalteredintheneighborhoodofthedimer, bonding of complementary bases, and representing the c suggesting an enhancing role for the large fluctuations exact sequence [10], and : v present at the dimer site in the dimer recognition path- W(x,y)= k(1+ρe−β(x+y))(x−y)2 i 2 X way. In both cases the theoretical characterization has represents the nonlinear stacking interactions. Here r been provided by the Peyrard-Bishop-Dauxois (PBD) prime denotes differentiation with respect to yn, γ is the a model [6, 7]. However, recently it was argued [8, 9] that friction constant, and the random force ξ (t) is Gaus- n thermodynamic characterization of the thermal fluctua- sian distributed white noise. With the parameter values tionsmaydifferfromadynamicalcharacterization,which used (see Refs. [11, 12], the success of the model in de- points to the need for a thorough understanding of the scribing the base-pair openings of double-stranded DNA dynamicaleffectsinthishighlynonlinearandcooperative hasbeendemonstratedbydirectcomparisonwithvarious material. experiments on the melting transition [12], S1 nuclease Here, we use finite temperature Langevin simulations digestion [4], pre-denaturation bubbles [13], and forced to probe the impact of sequence heterogeneity on bub- unzipping [14]. ble dynamics in six different sequences all composed of Here we simulate the dynamics of double-stranded 69 base pairs: i) two homogeneous sequences composed DNAatT =300Kbynumericallyintegratingthesystem purely of thymine-adenine (T-A) and guanine-cytosine of stochastic equations (1), applying periodic boundary 2 conditions. In the presence of the thermal bath, mod- shortperiodicity - only asingleG−C base pairbetween eled by the random forces, the creation of a bubble is thetwoA−T basepairs. Theimportantobservationfrom a stochastic process[15] mostappropriatelydescribed in these results is that not only the length of the hot spots termsofaprobability. Wedefinetheprobabilityforbub- (the T −A areas) but also the length of the “barriers” ble existence as: (theG−C intervals)playcrucialrolesfortheprobability ofthebubbleexistencebyrestricting,throughimpedance 1 qnkmax(l,tr) mismatch, the energy flow from the A−T rich regions. P (l,tr)= ∆t[qk(l,tr)] (2) n t n Clearlybubblesofalllengthhavethermodynamicweight, * s qXnk=1 +M increasing with temperature and decreasing with bubble where h...i denotes averaging over M(∼ 1000) simula- size. However,thebasepairinhomogeneitypreferentially M tions. The integer index, qk(l,tr), enumerates the bub- selects long-lived bubbles of specific sizes at specific lo- n bles defined as a double-strand separation of amplitude cations. This is a result of length scale competitions in- tr ≥ 0.5˚A, spanning l ≥ 3 consecutive base-pairs begin- herent in nonlinear, disordered systems [16]. ning at the nth base-pair in the kth simulation. In prac- tice we bin P (l,tr) using bin sizes l =1 and tr =0.5˚A. n The quantity ∆t[qk(l,tr)] is the existence time of the n qk(l,tr)’th bubble. t ∼ 1 − 2nsec is the duration of a n s singlesimulation(bubble life-times areinthepicosecond range and are much smaller see Fig. 4 ). Probabilities for bubble existence at a given site, for all lengths and amplitudes defined in this way are obviously normalized sinceallpossibleopeningsateverystepofthesimulation ∞ are counted. The plot of P (l,tr) as obtained ˚ n tr=1.5A P ∞ FIG. 2: Bubble probability, ˚Pn(l,tr), for the 69 tr=1.5A base-pair AAV P5 promoter (sPee Ref. [4]), with ts = 2nsec and M =800 simulations. ∞ In Fig. 2 we show P (l,tr) for the 69 base- ˚ n tr=1.5A pair adeno associate viral (AAV) P5 promoter (see Ref. P [4]). Tworegionsareprominentintermsoflargestprob- abilities for bubbles existence. These regions are located around base-pairs +1 and −30, which have previously been identified as the transcriptionstart site (TSS), and FIG. 1: Bubble probability, ∞ ˚Pn(l,tr), for the 69 thebindingsitefortheTATA-bindingprotein(TBP),re- base-pair homogeneous A−T setqru=e1n.5cAe (upper) and for the spectively. Itisnoteworthythattheprobabilitybecomes P periodic G5A5 sequence(lower). more localized around the identified sites as increasingly longer(in terms ofconsecutive sites)bubbles are consid- from Eq. (2) given in Fig. 1 demonstrates two clear ered. This result is in agreementwith findings in similar results: simulations investigating the frequency of the base pair 1) The probabilities for bubble formation in a homo- opening [4]. There is alsogoodagreementwith the ther- geneous T − A sequence ( or for a G-C sequence; not modynamic results [8, 9] derived from the PBD model, shown) do not depend on the base pair index because of however the active regions are much more sharply iden- the translation invariance. tified here than in the case of the thermodynamic treat- 2) For the periodic sequence G A , the probabilities ment. 5 5 are periodic with the period of the sequence. We can Our results confirm that the bubble localized at the clearly identify the sources of the bubbles to be situated transcriptionpromotersite canaidthe RNA polymerase in the AT-rich half-period of the sequence. In contrast, and the associatedproteins in the formationof the tran- we observed for a G A sequence (not shown) the prob- scription bubble 1 1 abilities to be almost spatially uniform because of the Ithasbeenargued[8]thatthe resultsobtainedinRef. 3 [4]areflawedby insufficient statistics inthe simulations. where the denominator is the total number of bubbles, We therefore present in Fig. 2 the result of M = 800 with strand-separation tr, in the kth simulation, span- simulations of t = 2nsec duration. Similar results were ning l base pairs beginning at the n’th base-pair. It is s obtained from simulations of t = 1nsec duration (not important to emphasize that the information contained s shown) suggesting that the statistics is indeed sufficient in the ABD can not be accessed through any thermody- even in a 1 nsec simulation. It is important to note that namic considerations. In Fig. 4 we show the quantity even for the 2 nsec simulations we never observed com- plete melting of all the 69 base pairs indicating that we 3.5 are exclusively sampling the premelting regime. 15 3.0 2.5 c] e 2.0 s 10 p 1.5 [ n 1.0 o Bubble length 1−5546GTGGCCATTTAGGGTATATATG−G2CC1GAGTGAGCGAGCAGGATCTCC1ATTTTGACCGCGAAATTTGAAC2G3 0033....0505 bubble durati e 2.5 ag r 10 12..50 Ave 1.0 5 0.5 0.0 −46 −21 1 23 GTGGCCATTTAGGGTATATATGGCCGAGTGAGCGAGCAGGATCTCCGCTTTGACCGCGAAATTTGAACG FIG. 4: Average bubble duration time, ∞ ABD(n,l,tr), for AAV P5 (upper) and for ˚ tr=4.5A mutated AVV P5 (lower) sequences. ∞ P FIG.3: Bubbleprobability, ˚Pn(l,tr),foramutated tr=1.5A AVV P5 sequence(see text)P. ∞ ˚ABD(n,l,tr) for the AAV P5 sequence as well tr=4.5A asforthemutatedAAVP5sequence. Theimmediateob- ∞ P In Fig. 3 we similarly show ˚Pn(l,tr) for a servationisthatthewildversionoftheAVVP5sequence tr=1.5A mutated AVV P5. The mutation, which has severe con- overall supports bubbles of significantly longer duration P sequences for the promoter’s ability to induce transcrip- than the mutated version. This is particularly true for tion (see Ref. [4]), consists of changing base-pairs +1 bubbles of large strand separation. As documented by and +2 to G−C pairs. From Fig. 3 we observe that Fig. 3, the mutated AAV P5 certainly supports a num- this mutation indeed severely inhibits the formation of ber of large bubbles but their duration is significantly largebubbles aroundthe +1base-pair. ComparingFigs. shorter. Also, Fig. 4 shows that the region aroundbase- 2and3,weseethatchangingjusttwobasepairsisasuf- pair +1 in the wild sequence supports large amplitude, ficientincreaseofthe G−C “barrier”torestricttheflow longlivedbubbles, afeature thatis completely absentin of thermal energy to be exclusively downstream in the the mutated sequence. sequence. This is the mechanism by which the mutation To compare the probability for bubble existence can induce rather long-range effect, such as the change for all simulated sequences, we show in Fig. 5 in the probability around base pair −30, although this the quantities 23 ∞ P (l,tr) (upper) and n=−46 tr=1.5˚A n effect may be specific to periodic boundary conditions. 23 ∞ P (l,tr) (lower). In the two plots we n=−46 l=3bpPn P Fromthese simulationswe confirmthat, for these het- showresultsforhomogeneousA−T andG−C sequences, erogeneous sequences, the maxima of the PDFs corre- P P together with AAV P5 and its mutated version. Also spondtobiologicallyimportantsitesinthesequence,and shown are results for the two periodic sequences (G A ) 1 1 that even small changes of the sequence can lead to sig- and (G A ). All probabilities decrease exponentially 5 5 nificant changes in the spatio-temporal probabilities. with size (amplitude and length) rendering large bub- In order to shed more light on the role of the life-time blesraredynamicalevents. Asisnaturalgiventhesofter of the bubbles, we calculate a distribution function for A−T potential,theprobabilityforanybubblesisalways the average bubble duration (ABD): largestinahomogeneousA−T sequenceandlowestina homogeneousG−C sequence. Comparingtheresultsfor qnkmax(l,tr)∆t[qk(l,tr)] homogeneous,periodicandheterogeneoussequences,itis ABD (n,l,tr) = qnk=1 n (3) clear that the bubble probability depends very little on *P qqnnkkm=a1x(l,tr)qnk(l,tr) +M sequence,butmainlyontheATandGCcontent[17]. Fi- P 4 stration [18] of melting temperatures being sensitive to intra-sequence correlation rather than being simply de- termined by AT and GC content. The insets of Fig. 5 compare the results of the 1 nsec and 2 nsec simulations for the AAV P5 sequence. Since the results are equivalent up to amplitudes larger that 6˚A and bubble lengths larger than 14 base-pairs, we conclude that in this sequence the finite time effects in Langevin simulations exists only beyond these ampli- tudes and lengths. In summary we have performed Langevin simulations of the PBD model of DNA and confirmed earlier results regarding the sequence dependence of bubble formation in agreement with results obtained on a purely thermo- dynamicbasis. However,wefindthatthedynamicsmore sharply delineates the regions active for thermal strand separation because the life-times of bubbles are directly accounted for. We find that the probability for larger bubbles (lengths and amplitudes) is higher for hetero- geneous than for periodic sequences with the same A-T content. The important role of the length of the G−C “barriers” for bubble existence was identified. We find that the bubbles with maximum duration begin their existence at biologically significant sites, and that these bubble initiation sites are different for bubbles with dif- ferent amplitudes. Finally, we found a striking sensi- tivity of the bubble life-time on sequence. Therefore we suggestthatDNA’sabilitytosustainbubblesinsomere- gionsisaresultofcompetitionbetweenlengthscalesaris- ingfromthenonlinearityandthesequenceheterogeneity, FIG. 5: Bubble length probability (log scale), andthat this competitionsensitivelycontrolsthe bubble 2n3=−46 ∞tr=1.5˚APn(l,tr) (upper), and bubble ampli- life-times. Since specific biological function are likely to PtudeprobPability(logscale), 2n3=−46 ∞l=3bpPn(l,tr)(lower). be aided by long-lived openings of specific sizes, this in- The insets compare these for AAV P5 at 1 nsec and 2 nsec formationregardingsize-lifetime relationships is directly P P simulation times. relevant. B.S.A. wouldlike to thank ProfessorPeter Littlewood for the useful discussions. Research at Los Alamos Na- nally, we observe that the periodic (G A ) sequence has 5 5 tionalLaboratoryis performedunder the auspicesofthe lessprobabilityforlongerbubblesincomparisonwiththe USDepartmentofEnergyunder contractW-7405-ENG- sequence with smaller period (G A ) and with the het- 1 1 36. erogeneous AAV P5 sequence, confirming that the GC “barriers” and their impedance role is restricting energy flow in the sequence. In the case of the bubble amplitude probability, there [1] B.F. Volkman, et al. Science 291, 2429 (2001). is a strong dependence on the actual sequence. The het- [2] E.Z. Eisenmesser, et al.,Science, 295, 1520 (2002). erogeneous AAV P5 sequence sustains high amplitude [3] M. Tomschik, et al. Proc. Nat’l. Acad. Sci. USA, 102, bubbles significantly better than the periodic sequences 3278 (2005) (G1A1)and(G5A5)withthesameATcontent. Eventhe [4] C.H. Choi et al. Nucl. Acids Res. 32 1584 (2004); G. mutatedAAVP5sequenceswithslightlylessATcontent Kalosakas, et al. Europhys.Lett., 68, 127 (2004) than the periodic sequences (G A ) and (G A ) is more [5] K.B. Blagoev et al. (submitted). 1 1 5 5 probable to sustain bubbles with amplitudes over 4˚A. [6] M. Peyrard M. and A. R. Bishop, Phys. Rev. Lett., 62 2755 (1989) Therefore the amplitude of the bubbles is is sensitive to [7] DauxoisT.,PeyrardM.andBishopA.R.,Phys.Rev.E, the exact sequence. In the heterogeneous sequences the 47 R44 (1993) probabilityforbubblewithhighamplitudesislargerthan [8] T.S. van Erp et al., Phys. Rev. Lett. 95, 218104 (2005). in the periodic sequences with the same or even a little See also http://xxx.lanl.gov/physics/0512077. less AT content. This is consistent with recent demon- [9] http://xxx.lanl.gov/abs/cond-mat/0511128 5 [10] A A-T (G-C) base pair is modeled by the parameters, dinates indicating the existence of at least one posi- DAT = 0.05eV, and aAT = 4.2˚A−1 (DGC = 0.075eV, tive Liapunov exponent consistent with the analytical and aGC =6.9˚A−1). calculation in: H. Qasmi, J.Barre, and T. Dauxois, [11] γ =0.05 (γ =0.005) during(after) preheating. http://arXiv:cond-mat/0407662 v1,(2004). [12] A. Campa, and A. Giansanti, Phys. Rev. E. 58, 3585 [16] A. Sanches, A.Bishop, SIAMReview 40, 579,(1988). (1998). [17] In general, the coefficients, γsequence of the exponential [13] S.Ares et al. Phys. Rev.Lett. 94, 035504 (2005) decrease are well approximated by a mean field consid- [14] N.K. Voulgarakis et al. eration: γsequence = nATnγAATT++nnGGCCγGC,wherenAT (nGC) http://xxx.lanl.gov/cond-mat/0512487 (submitted). is the number of AT (GC) base pairs. γA−T (γG−C) is [15] Comparing the trajectories resulting from two al- the coefficient for thepureA−T (G−C) sequences. most equal initial conditions we observed exponen- [18] G. Weber et al. NaturePhysics 2, 55 (2006). tial growth of the differences between all the coor-

See more

The list of books you might like