loading

Logout succeed

Logout succeed. See you again!

ebook img

De novo metagenomic assembly reveals abundant novel major lineage of Archaea in hypersaline ... PDF

pages13 Pages
release year2011
file size1.28 MB
languageEnglish

Preview De novo metagenomic assembly reveals abundant novel major lineage of Archaea in hypersaline ...

TheISMEJournal(2012)6,81–93 &2012InternationalSocietyforMicrobialEcology Allrightsreserved1751-7362/12 www.nature.com/ismej ORIGINAL ARTICLE De novo metagenomic assembly reveals abundant novel major lineage of Archaea in hypersaline microbial communities Priya Narasingarao1,8, Sheila Podell1,8, Juan A Ugalde1, Ce´line Brochier-Armanet2, Joanne B Emerson3, Jochen J Brocks4, Karla B Heidelberg5, Jillian F Banfield3,6 and Eric E Allen1,7 1MarineBiologyResearchDivision,ScrippsInstitutionofOceanography,UniversityofCalifornia,SanDiego, La Jolla, CA, USA; 2Universite´ de Provence, Aix-Marseille Universite´, CNRS, UPR 9043, Laboratoire de Chimie Bacte´rienne, Institut de Microbiologie de la Me´diterrane´e (IFR88), Marseille, France; 3Department of Earth and Planetary Sciences, University of California, Berkeley, Berkeley, CA, USA; 4Research School of Earth Sciences, The Australian National University, Canberra, ACT, Australia; 5Department of Biological Sciences, University of Southern California, Los Angeles, CA, USA; 6Department of Environmental Science, Policy, and Management, University of California, Berkeley, Berkeley, CA, USA and 7Division of Biological Sciences, University of California, San Diego, La Jolla, CA, USA This study describes reconstruction of two highly unusual archaeal genomes by de novo metagenomicassemblyofmultiple,deeplysequencedlibrariesfromsurfacewatersofLakeTyrrell(LT), a hypersaline lake in NW Victoria, Australia. Lineage-specific probes were designed using the assembledgenomestovisualizethesenovelarchaea,whichwerehighlyabundantinthe0.1–0.8lm size fraction of lake water samples. Gene content and inferred metabolic capabilities were highly dissimilar to all previously identified hypersaline microbial species. Distinctive characteristics included unique amino acid composition, absence of Gvp gas vesicle proteins, atypical archaeal metabolic pathways and unusually small cell size (approximately 0.6lm diameter). Multi-locus phylogenetic analyses demonstrated that these organisms belong to a new major euryarchaeal lineage,distantlyrelatedtohalophilicarchaeaofclassHalobacteria.Consistentwiththesefindings, weproposecreationofanewarchaealclass,provisionallynamed‘Nanohaloarchaea’.Inadditionto their high abundance in LT surface waters, we report the prevalence of Nanohaloarchaea in other hypersaline environments worldwide. The simultaneous discovery and genome sequencing of a novel yet ubiquitous lineage of uncultivated microorganisms demonstrates that even historically well-characterizedenvironmentscanrevealunexpecteddiversitywhenanalyzedbymetagenomics, andadvancesourunderstandingoftheecologyofhypersalineenvironmentsandtheevolutionary historyof the archaea. TheISME Journal(2012)6, 81–93; doi:10.1038/ismej.2011.78; published online30June 2011 SubjectCategory: integrated genomics and post-genomics approaches in microbial ecology Keywords: assembly; halophile; hypersaline; metagenome; Nanohaloarchaea Introduction cingisanappealingrouteforinvestigatingmicrobial community composition because it provides simul- Cultivation-independent molecular ecology techni- taneous insight into phylogenetic composition and ques currently used tosurvey environmental micro- metabolic capabilities of uncultivated populations biotaincludeanalysisofphylogeneticmarkergenes, (Allen and Banfield, 2005; Wilmes et al., 2009). targeted functional gene inventories and direct Gene fragments from individual sequencing reads sequencing of DNA recovered from environmental and small assembled contigs can be annotated and samples (reviewed in Hugenholtz and Tyson, 2008; assignedtoapproximatephylogeneticbinsbasedon Wooley et al., 2010). Direct metagenomic sequen- comparison with databases of known reference genomes (Mavromatis et al., 2007). However, culti- Correspondence: EE Allen, Marine Biology Research Division, vation biases limit the phylogenetic and physio- Scripps Institution of Oceanography, University of California, logical breadth of available reference genomes (Wu SanDiego,LaJolla,CA92093-0202,USA. et al., 2009). Single cell genomics can potentially E-mail:[email protected] broaden genomic databases, but often provides 8Theseauthorscontributedequallytothiswork. highly fragmented data because of amplification Received13January2011;revised10May2011;accepted14May 2011;publishedonline30June2011 biases(Lasken,2007;Woykeetal.,2009).Asaresult DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 82 ofskewedgenomicrepresentationsinreferencedata extreme hypersaline habitats are dominated by sets, metagenome analysis methods that rely on halophilic archaea belonging to the monophyletic previouslydescribedsequenceexamples(forexample, class Halobacteria (phylum Euryarchaeota), includ- fragmentrecruitment approaches) share an inherent ing members of the genera Haloquadratum, potential bias against novel findings. This anti- Halobacterium, Halorubrum and Haloarcula (Oren, novelty bias can be overcome by de novo sequence 2008). Pure isolates of halophilic archaea currently assembly, which does not rely on external reference include 496 species distributed among 27 genera, sequences, and can facilitate resolution of phylo- with genome sequence information available for geny-to-function linkagesforindividualcommunity more than a dozen species (Oren et al., 2009). members. Yet de novo sequence assembly techni- Numerous cultivation-independent biodiversity ques are rarely applied to metagenomic sequences surveys have been performed in hypersaline envir- because of sampling deficiencies and/or computa- onments using PCR amplification of archaeal and tional challenges (Allen and Banfield, 2005; Baker bacterial16SribosomalRNA(rRNA)genes,aswellas et al., 2010). direct metagenomic sequencing of community DNA Habitats characterized by low diversity microbial (Grantetal.,1999;Benllochetal.,2001;Ochsenreiter communities have proven useful for validating et al., 2002; Burns et al., 2004; Demergasso et al., molecular (eco-)systems biology approaches to ex- 2004;Jiangetal.,2006;Maturranoetal.,2006;Mutlu amine the genetic and functional organization of et al., 2008; Pagaling et al., 2009; Sabet et al., 2009; native microbial consortia (Tyson et al., 2004; Allen Oh et al., 2010; Rodriguez-Brito et al., 2010). These andBanfield,2005;Rametal.,2005;Loetal.,2007; studies confirm high abundance of a few dominant Raes and Bork, 2008; Wilmes et al., 2009). High species with widespread geographical distribution, salt-impacted habitats are distributed globally in the but the intermittent recovery of atypical, uncon- form of hypersaline lakes, salt ponds and solar firmed sequence fragments hints at additional, (marine)salterns,whereevaporativeprocessesresult unrecognized diversity among halophilic archaea in salt concentrations close to and exceeding satura- (Grantetal.,1999;Lopez-Garciaetal.,2001;Pagaling tion. These environments contain microbial commu- etal.,2009;Ohetal.,2010;Sime-Ngandoetal.,2010). nities of intermediate complexity (Oren, 2008), The lure of uncovering biological novelty is a providing excellent model systems for developing major incentive driving metagenomic investigations scalable analytical techniques applicable to environ- in many habitats worldwide. This study demon- ments with greater species richness and evenness. strates that even historically well-characterized The biochemical and physiological challenges habitats like extreme hypersaline lakes and solar faced by extremely halophilic organisms have salterns can reveal unexpected genes, metabolic resulted in unique adaptations to maintain osmotic features and entire lineages overlooked previously. balance,overcomereducedwateractivitybecauseof The ‘assembly-driven’ community metagenomic the hygroscopic effects of saturating salt concentra- approach applied in the current study has led to tions, and deter DNA damage induced by intense the discovery and reconstruction of near-complete solar irradiation (Bolhuis et al., 2006; Hallsworth genomes for two new archaeal genera representing et al., 2007). The most extreme halophiles maintain the first members of a previously undescribed osmoticbalanceusinga‘highsalt-in’strategy,which taxonomic class of halophilic archaea. We demon- allows intracellular salt concentrations to reach strate that members of this new archaeal class are levels approximately isosmotic with the external present in high abundance and broadly distributed environment (Oren, 2008). Microorganisms using in other hypersaline habitats worldwide. the salt-in strategy not only endure extreme ionic strength,theyrequireitforgrowth.Althoughsalt-in adaptation can be energetically more favorable than Materials and methods transporting salt out and the accumulation of compatible solutes (Oren, 1999), it requires signifi- Sample collection cant modifications to the intracellular machinery, Surface water samples (0.3m depth) were collected including specialized protein amino acid composi- fromLakeTyrrell(LT),Victoria,Australiaandahigh tions to maintain solubility, structural flexibility, salinity crystallizer pond at South Bay Salt Works, and water availability necessary for enzyme func- Chula Vista (CV) California. Detailed locations, tion (Fukuchi et al., 2003; Bolhuis et al., 2008; sampling dates, and physical characteristics of the Paul et al., 2008; Rhodes et al., 2010). collection sites are provided in Supplementary The study of microbial populations in extreme Figure S1. hypersaline environments is well established; the Water samples of 20l each were passed through a first cultivated halophilic microorganism appeared 20mm Nytex prefilter, followed by sequential filtra- inBergey’smanualoveracenturyago(Oren,2002a). tion through a series of polyethersulfone, 142mm Despite the extreme conditions in salt-saturated diameter membrane filters (Pall Corporation, Port habitats, microbial cell densities often exceed Washington, NY, USA) of decreasing porosities 107cellsml–1 (Oren, 2002b). Although salt-adapted (3mm40.8mm40.1mm) using a peristaltic pump. organismsderivefromallthreedomainsoflife,most After each stage of filtration, filters were frozen for TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 83 future DNA extraction, 16S rRNA gene analysis and Genome annotation metagenomic sequencing. Aliquots of filtered water J07AB43 and J07AB56 draft genomes were anno- werefixedwithformaldehyde(7%finalconcentration) tated using the Integrated Microbial Genome Expert overnight at 41C. Fixed water samples were collected Review service of the Joint Genome Institute on 0.2mm polycarbonate GTTP filters (Millipore, (Markowitz et al., 2009b). Genome completeness Billerica,MA,USA)forfluorescenceinsituhybridiza- wasestimatedfortheJ07AB56andJ07AB43scaffold tion (FISH) and direct count microscopy. groups by comparing genes involved in transcrip- tion, translation and replication to those identified Library construction and assembly as highly conserved in previously sequenced Genomic DNA was extracted from individual, archaeal genomes (Ciccarelli et al., 2006; Wu and bar-coded 0.8 and 0.1mm filters. Filter-specific Eisen, 2008; Puigbo et al., 2009). Orthologs shared DNA libraries were constructed with insert sizes of between the J07AB43 and J07AB56 proteomes were 8–10kbpand/or40kb(fosmids)attheJCraigVenter detected using the reciprocal smallest distance Institute, as described previously (Goldberg et al., algorithm (threshold e-value¼1e-05; sequence 2006). Details of genomic DNA sequence libraries divergence¼0.4) (Wall and Deluca, 2007). are provided in Supplementary Table S1. 16S rRNA gene clone libraries were constructed by amplification of LT metagenomic DNA using Amino acid composition analysis universal archaeal primer sequences Arc21F and Amino acid frequencies in predicted proteins from Arc529R (Table 1), as previously described (Bik J07AB56, J07AB43 and 1455 archaeal and bacterial et al., 2010). A group-specific primer for Nanoha- genomes were compared using the Primer 6 software loarchaea (LT_1215R) was designed using the NCBI program (Clarke and Gorley, 2006) to perform primerdesigntool,andusedtogetherwithuniversal Non-Metric Multidimensional Scaling (NM-MDS) archaeal primer Arc21F to amplify both LTand CV analysis (Ramette, 2007). For each genome, the community DNA. Amplification products were frequencyofeachaminoacidforallpredictedproteins cloned using the TOPO TA cloning kit (Invitrogen, was calculated using a custom perl script. These Carlsbad, CA, USA) and sequenced bi-directionally values were standardized by Z-score, then used to with M13F and M13R primers. calculate a Euclidean distance similarity matrix. Sanger and pyrosequencing read libraries were NM-MDS analysis was performed using default assembled both individually and in various combina- program parameters (25 random starts, Krustal fit tions, using Celera Assembler software version 5.4 scheme of 1 and a minimum stress value of 0.01). (Myers et al., 2000), in a series of iterative assemblies In addition to NM-MDS analysis, a cluster analysis guided by phylogenetic binning. Detailed genome was performed to define groups within the NM-MDS assembly procedures are provided in Supplementary plot using a multidimensional distance parameter Information. of 4%. Table1 Primersandprobesfordetecting16SrRNAsequences Use Target Name Sequence(50 to30) Reference PCR NHA LT_1215R ggccgcgtgtatcccagagc Thisstudy A Arc21F ttcCggttgatccygccCga DeLong(1992) A Arc529R accgcggckgctggc DasSarmaandFleischman(1995) PCRa A ArcF1 attcCggttgatcctgc Iharaetal.(1997) A Arc27Fa tcyggttgatcctgscGg RaesandBork(2008) U Univ515F tgccagcAgccgcggtaa Lane(1991) A Arc751F CcGAcggtgAgRgrygaa Bakeretal.(2003) A Arc958R yCcGgcgttGAmtcCaatt DeLong(1992) U Univ1390R acGggcGgtgtgtrcaa BrunkandEis(1998) A UA1406R acGggcGgtgwgtrcaa Bakeretal.(2003) A Arc1492R ACGGhTACCttgTtaCgactt Grantetal.(1999) U Univ1492R GGTTACCttgTtaCgactt Lane(1991) FISH A Arc915 gtgctcccccgccaattcct Amannetal.(1995) NHA Narc_1214 ccgcgtgtatcccagagc Thisstudy NHA LT_1198h1 attcgggccatactgacct Thisstudy NHA LT_976-h2 ggctctggtagrgtrc Thisstudy NHA LT_1237h3 tytstttgthccggccattg Thisstudy B Eub338 gctgcctcccgtaggagt Amannetal.(1990) B Eub338plus gcwgccacccgtaggtgt Daimsetal.(1999) Target specificity abbreviations: A, archaea; B, bacteria; NHA, nanohaloarchaea; U, universal. aPCR primer mismatches are capitalized. Bold indicatesprimermismatchestoJ07AB43only,underlinetoJ07AB56only,andboxedtobothJ07AB43andJ07AB56. Lowercaseitaliclettersindicateexactmatchestotheorganismsdescribedinthetext.Uppercasenon-italiclettersindicatemismatchesofthree differenttypes(bold,underline,orboxed). aTheseprimerswerenotusedinthisstudy;sequencesareshownforcomparisononly. TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 84 Phylogenetic analysis Genome Shotgun projects under accession numbers 16S rRNA sequences and ribosomal proteins from AEIY01000000 (J07AB43) and AEIX01000000 euryarchaeal genomes in the JGI-IMG database (J07AB56). (Markowitz et al., 2009a) and GenBank were compared with metagenomic gene sequences Results obtained by (i) extraction from assembled scaffolds and (ii) amplification and sequencing of 16S rRNA Metagenomic assembly genes from LT and CV clone libraries. Maximum Seven independent DNA sequencing libraries were likelihood trees were constructed using TreeFinder constructed from size-fractionated surface water v.10.08(Jobbetal.,2004)andPhyMLv.3.0(Guindon samples collected at LT, Australia (Supplementary and Gascuel, 2003). The robustness of each Figure S1 and Supplementary Table S1). Initial maximum likelihood tree was estimated using assembly of the combined 632903 Sanger sequen- non-parametric bootstrap analysis. Details of align- cing reads produced 15008 scaffolds (maximum mentcurationandtree constructionareprovided in length¼2764168bp; scaffold N50¼29346bp). Supplementary Information. These scaffolds included at least six different Predicted proteins in assembled genomes were relatively abundant microbial populations, each evaluated for phylogenetic relatedness to known with a distinct nucleotide percent GþC composi- sequencesinNCBIGenBanknrusingtheDarkHorse tion. A length-weighted histogram of percent GþC program, version 1.3, with a threshold filter setting versus total assembled scaffold nucleotides showed of 0.05 (Podell and Gaasterland, 2007; Podell et al., peakscorrespondingtothesepopulations(Figure1). 2008). Minimum quality criteria for match inclusion The largest peak in this histogram, at 48% GþC, in the DarkHorse analysis were that BLASTP align- included scaffolds containing 16S rRNA sequences mentstoGenBanknrsequencescoveratleast70%of from multiple strains of Haloquadratum walsbyi, total query length and have e-value scores of 1e-5 or consistent with previous observations noting the better. dominance of this species in similar hypersaline environments (Cuadros-Orellana et al., 2007; Oh Fluorescence in situ hybridization etal.,2010).Threeadditionalpeaksat60%GþCor Fluorophore-conjugated custom 16S rRNA probes higherincludedscaffoldscontaining16SrRNAgenes (Table 1) were designed using ARB (Ludwig et al., with 89–99% identity to clone sequences annotated 2004), screened for specificity in silico using as uncharacterized halophilic archaea (class Halo- ProbeCheck (Loy et al., 2008) and synthesized by bacteria).Microbialpopulationsassociatedwiththese Integrated DNA Technologies Inc. (San Diego, CA, peaks are currently under investigation, but fall USA). FISH was performed on CV and LT water outside the scope of the present report. samples collected on 0.2mm polycarbonate GTTP Two groups of scaffolds, with peaks at 43% and filters (Millipore) at every stage of filtration (post 56% GþC, shared an intriguing pattern of unusual 20mm, post 3mm and post 0.8mm). The Nanoha- characteristics. In addition to distinctive GþC loarchaea-specificprobeNarc_1214conjugatedwith content, 490% of the reads that co-assembled in Cy3alongwithunlabeledhelperprobesLT_1198h1, LT_976h2 and LT_127h3 (Fuchs et al., 2000) were 7,000,000 Assembled scaffolds used for FISH analysis. Universal probes Arc915 HQ HA (archaeal) and EubMix (a bacterial probe consisting n 6,000,000 SR ofanequimolarmixtureofEub338andEub338plus) es/bi 5,000,000 HHRS were also used for the purpose of cell counts. otid Hybridization conditions were optimized at 461C cle 4,000,000 u for 2h, as previously described (Pernthaler et al., n m 3,000,000 2001). Filters were mounted with Vectashield u n medium (Vector Laboratories, Burlingame, CA, otal 2,000,000 43% 56% USA), and imaged at 1000(cid:2) with a Nikon Eclipse T 1,000,000 TE-2000U inverted microscope (Nikon Instruments Inc., Irvine, CA, USA). Cell counts were performed 0 40 45 50 55 60 65 70 onmultiplefieldsperslide,normalizing16SrRNA- Percent GC (bin width = 1%) specificprobecountstototalnumberofcellsstained with the DNA-binding dye 40,6-diamidino-2-pheny- Figure 1 Length-weighted histogram of percent GþC for all scaffolds assembled from the LTcommunity, binned in 1% GC lindole. increments.Symbolsrepresentreferencecontrolpoints,indicat- ing where five previously sequenced halophile genomes would havefallen,iftheyhadbeenpresentinthisdataset.Datapoints Accession numbers areplottedbasedontotalnumberofnucleotidesineachscaffold 16S rRNA gene sequences have been deposited to (yaxis)versusaveragepercentGCfortheentirescaffold(xaxis). HA, Haloarcula marismortui; HQ, Haloquadratum walsbyi; HR, DDBJ/EMBL/GenBank under accession numbers Halorubrumlacusprofundi;HS,HalobacteriumsalinarumR1;SR, HQ197754 to HQ197794. Assembled genomes Salinibacter ruber. Peaks labeled at 43% and 56% GC are the with annotations have been deposited as Whole focusofthisstudy. TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 85 Table 2 General features of the J07AB43 and J07AB56 draft proteins, amino acid tRNA synthetases, translation genomes initiation and elongation factors, molecular chaper- onesandproteinsessentialforDNAreplicationand J07AB43 J07AB56 repair. All 53 of the universal archaeal housekeeping proteins were identified in J07AB56 while 44/53 Genomesize,bp 1227157 1215802 (83%) were found in the J07AB43 draft genome G+Cpercentage 44% 56% Scaffoldnumber 7 3 (SupplementaryTableS3).Thepresenceofthesecore rRNAoperons 1 1 proteins, a single rRNA operon and transfer RNAs tRNAs 59 38 enabling translation of all 20 amino acids, suggests PredictedCDSs 1678 1411 that both draft genomes are nearly complete. CDSsw/func.Pred. 773 719 Abbreviations:CDS,codingsequence;rRNA,ribosomalRNA;tRNA, transferRNA. Community abundance Community abundance of J07AB43 and J07AB56 these scaffolds were obtained from microorganisms wasinitiallyassessedbysequencing16SrRNAgene that had passed through a 0.8mm filter, but were clone libraries, constructed by amplifying LT com- retainedona0.1mmfilter,suggestingsmallcellsize. munity DNA with universal archaeal primers The 16S rRNA gene sequences contained in these Arc21FandArc529R(Table1).Amplifiedsequences scaffolds were o78% identical to any previously with 491% identity to the J07AB43 and J07AB56 known cultured isolate, although they did resemble draft genomes were found in 124/315 (39%) of 16S rRNA gene fragments periodically recovered in archaealclonesobtainedfromorganismsretainedon culture-independent surveys of microbial diversity 0.1mm pore filters, but only 24/254 (9%) of clones in hypersaline waters (Grant et al., 1999; Oh et al., retained on 0.8mm pore filters. These results are 2010; Sime-Ngando et al., 2010). consistentwiththeobservedenrichmentofJ07AB43 Tooptimizeassemblyefficiencyfortheseunusual and J07AB56 reads specifically derived from 0.1mm populations, the full set of metagenomic reads were filter fractions in the assembled data set. subjected to a series of iterative assemblies guided As a second, independent test of community by phylogenetic binning. The 43% GþC peak was abundance, new lineage-specific 16S rRNA probes thereby consolidated into seven major scaffolds were designed to visualize J07AB43 and J07AB56 (J07AB43) and the 56% GþC peak into three major cells in environmental samples by FISH (Table 1). scaffolds (J07AB56) (Supplementary Table S2). The These probes were used in combination with the J07AB43 and J07AB56 scaffold groups were subse- DNA-binding dye 40,6-diamidino-2-phenylindole quently analyzed as draft genomes, each represent- and universal bacterial and archaeal probes to ing the consensus sequence of an individual obtaindirectcellcountsinLTandCVwatersamples microbial population. Overall properties of these (Figure 2). Cells approximately 0.6mm in diameter draft genomes are summarized in Table 2. These werelabeledwithlineage-specificprobeNArc_1214 properties differ substantially from previously se- in samples from both locations. These results are quenced extreme halophiles in both nucleotide consistent with size estimates of o0.8mm but composition, expressed as percent GþC, and total 40.1mm based on filter-specific composition for genome size (Markowitz et al., 2009a). With the both amplified 16S rRNA clones and metagenomic exception of H. walsbyi, at 48% GþC, all other reads. Direct counts of fluorescently labeled cells previously described halophilic archaea, as well as indicated that the combined abundance of strains the halophilic bacterium Salinibacter ruber, have matching the new, lineage-specific probes was nucleotide compositions of 60% or greater GþC, approximately 14% of all 40,6-diamidino-2-pheny- compared with 43% and 56% for these new lindole-labeled cells in water samples from LT, organisms. Estimated total genome size and pre- and 8–11% in samples from CV (Supplementary dicted number of coding sequences for J07AB43 Table S4). and J07AB56 (Table 2) were also considerably Community abundance of the organisms respon- smaller than other known extreme halophiles, sible for the J07AB43 and J07AB56 draft genomes which currently range from 2.7 to 5.4Mbp. was further examined using statistical properties of the assembled metagenomic sequence data. The number of reads that co-assembled to create each Genome completeness compositepopulationscaffoldgroupwasdividedby To estimate the extent of genome completeness of the total number of reads available and normalized J07AB43andJ07AB56,functionalannotationsforall for estimated genome size. Assuming the two new predicted proteins were searched against a set of 53 genomesareapproximately1.2Mbpeach,andother housekeeping genes, previously identified as uni- microbial species sampled from LT have an average versally present in all archaeal genomes sequenced genome size of 3Mbp, J07AB43 was estimated to as of 2009 (Puigbo et al., 2009). These highly represent at least 6.7% of the LT sampled commu- conserved genes are physically dispersed throughout nity (17066 reads) and J07AB56 at least 3.4% (8652 the genome (non-clustered) and include ribosomal reads), totaling approximately 10% for the two TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 86 Figure3 Unrootedmaximum-likelihood16SrRNAgenephylo- genetictreeoftheEuryarchaeota.Treeisbasedon48sequences, 1275positions.Numbersofsequencesineachcollapsednodeare indicated in parentheses. Numbers at nodes represent bootstrap values inferred by TreeFinder/PhyML. Bootstrap values o50% areindicatedbya‘–’sign.Scalebarrepresents0.1substitutions per site. A full, uncollapsed version of this tree is presented in SupplementaryFigureS2a. Concatenated ribosomal protein data sets have been shown to be particularly useful for resolving deep evolutionary relationships (Brochier et al., 2002; Matte-Tailliez et al., 2002; Rokas et al., 2003; Figure 2 FISH micrographs. (a) LT (0.1 to 3mm filter fraction), Rannala and Yang, 2008). Phylogenetic analysis of (b)CVSouthBaySaltWorks(0.1to0.8mmfilterfraction).Allcells 57 ribosomal proteins from the J07AB43 and are stained with 40,6-diamidino-2-phenylindole (blue). Nanoha- J07AB56 draft genomes showed, like the 16S rRNA loarchaeacellsshownarestainedwithlineage-specificCy3probe tree, robust placement of these genomes as a deeply Narc_1214(red).Scalebar¼2mm. branching sister group of class Halobacteria, with populations combined (3.0/1.2*25718/632903). bootstrap values of 98% (PhyML) and 74% (Tree- Calculations based on metagenomic assembly most Finder). This relationship was corroborated using likely underestimate true population abundance, Dayhoff04recodingofribosomalproteinalignments because they may exclude closely related poly- (Hrdy et al., 2004; Susko and Roger, 2007), to rule morphic strains containing DNA sequence varia- out possible artifacts of biased amino acid composi- tions that were not incorporated into the consensus tionorfast-evolvinglineages(SupplementaryFigure population assembly. S2b). The long branch lengths separating J07AB43 and J07AB56 from members of class Halobacteria indicate that these two sister-lineages are only distantly related, consistent with the average diver- Taxonomic position of J07AB43 and J07AB56 gence of 35% observed between Halobacteria and J07AB43 and J07AB56 16S rRNA shared sequence J07AB43 and J07AB56 16S rRNA gene sequences identities of 68% to 75% with previously sequenced, (Supplementary Table S5). By contrast, 16S rRNA cultured representatives of class Halobacteria (Sup- variability within the Halobacteria is o16%. plementary Table S5). An unrooted maximum like- Nearly60% ofpredictedproteinsinJ07AB43 and lihood phylogenetic tree of euryarchaeotal 16S rRNA J07AB56 had no GenBank database matches close gene sequences placed J07AB43 and J07AB56 as a enough to enable confident phylogenetic assign- deepsistergroupofclassHalobacteria(Figure3),with ment. Of those that could be assigned, fewer than significant bootstrap support. 20% matched proteins from members of class TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 87 Figure4 Phylogeneticdistributionofnon-self-proteinBLASTmatchesforeuryarchaeotalgenomes.SearchesagainsttheGenBanknr databasewereclassifiedbyeuryarchaeotalclass,archaealphylum,domainornomatchusingtheDarkHorsealgorithm,asdescribedin Materialsandmethodssection. Halobacteria (Figure 4). In contrast, 480% of strategy of maintaining osmotic balance, as evi- predicted proteins in the genomes of previously denced by the over-representation of amino acids sequenced Halobacteria had closest non-self with negatively charged side chains (aspartic and matches to other members of their own class, glutamic acid) and the under-representation of leaving fewer than 20% unmatched. Similar pat- residueswithbulkyhydrophobicsidechains(trypto- terns of protein sequence conservation were ob- phan, phenylalanine and isoleucine), to enhance served in organisms with many sequenced database protein structural flexibility and solubility under relatives, including Methanocaldococcus janaschii, intracellular conditions of high ionic strength and Methanospirillum hungatei and Salinibacter ruber, low water availability. Although a similar salt-in but not in sparsely sampled species that are only strategy is employed by other extreme halophiles, distantly related to other known lineages, such as J07AB43 and J07AB56 use their own, distinct NanoarchaeumequitansandMethanopyruskandleri combination of amino acids to achieve this end, (Branciamore et al., 2008). preferring glutamic to aspartic acid, serine to threonine, and reduced frequencies of alanine, proline and histidine (Supplementary Table S6). Genome characteristics of J07AB43 and J07AB56 The large number of proteins annotated with Although the J07AB43 and J07AB56 genomes are ‘hypothetical’ functions in the J07AB43 and more closely related to each other than to any J07AB56 genomes may be at least partially because previously sequenced organisms, gene content ana- of their unusual amino acid compositions, which lysis identified only 480 (30%) shared protein can hinder recognition of database homologs in orthologpairsbetweenthem.Ofthese,143(approxi- sequence-based similarity searches. mately 10% of each genome) were not found in ThepeculiaraminoacidcompositionsofJ07AB43 other halophilic archaea. The majority of these and J07AB56 compared with other halophilic shared lineage-specific sequences were too dissim- archaea are highlighted in a NM-MDS plot of ilar to previously characterized proteins to assign a intergenomic distances based on frequencies for all functional annotation. The remainder was domi- 20standardaminoacids(Figure5).Thedatausedto natedbyhousekeepingproteinsinvolvedintransla- constructthismatrixincludedallproteinsequences tionandribosomalstructure.Eachgenomeincluded from euryarchaeal genomes used to build the onlyonerhodopsin-likegene,comparedwithmulti- phylogenetic tree in Figure 3, supplemented pleparalogspresentinthegenomesofotherextreme with four bacterial species found in high salt halophilic archaea (Ihara et al., 1999), and the environments: Salinibacter ruber (Bacteroidetes), extremely halophilic bacterium Salinibacter ruber Halorhodospira halophila (Gammaproteobacteria), (Mongodin et al., 2005). Notably absent from both Chromohalobacter salexigens (Gammaproteobacter- genomes were homologs to the highly conserved ia) and Halothermothrix orenii (Firmicutes). Gvp family of gas vesicle proteins found in most Although genome percent GþC compositions halophilic archaea, Cyanobacteria and purple were not explicitly included as one of the factors photosynthetic bacteria (Walsby, 1994). in this analysis, there is a trend for microorganisms Both J07AB43 and J07AB56 have highly unusual withlowerGþC(denotedwithlowerlabelnumbers aminoacidcompositionscomparedwithpreviously in Figure 5) to be located further to the right along sequenced archaeal and bacterial genomes. These thehorizontalaxis.Thistrendisconsistentwiththe unusual compositions appear to support a ‘salt-in’ known influence of GþC composition on usage TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 88 Figure5 NM-MDScomparisonofaminoacidcompositions.Euryarchaealgenomesweresupplementedwithfourhalophilicbacteria genomes.Symbolsdenotetaxonomicclassifications.NumbersrankgenomesinincreasingorderofGþCcontent(1–10:29–38%,11–20: 38–43%,21–30:43–50%,31–40:50–60%,41–53:60–67%).Greycirclesindicatehierarchicalclustering,basedona4%distancesetting todefinegroups.AcompletelistofthesegenomesandtheiraminoacidcompositionsispresentedinSupplementaryTableS6. frequency for some amino acids because of codon pathway were observed in both genomes, including bias(Liuetal.,2010).Incontrast,positionalongthe both oxidative and non-oxidative branches. The vertical axis of Figure 5 was unrelated to percent presence of a complete pentose phosphate pathway GþC. Instead, amino acid composition differences has not been demonstrated previously in any other captured along this axis appear to correlate more archaea, by either biochemical or bioinformatic closely with common ancestry and/or shared envir- methods(Verheesetal.,2003).Thekey,rate-limiting onmental adaptations. The outlier positions of enzyme for this pathway is glucose-6-phosphate J07AB43 (#19) and J07AB56 (#39) along the vertical dehydrogenase, which converts glucose-6-phos- axis of Figure 5 clearly demonstrate their unusual phate into 6-phosphoglucono-d-lactone. Although amino acid compositions relative to other archaea. bothJ07AB43andJ07AB56appeartohavecomplete Similar outlierpositions were observed for these two genomic copies of this gene, the closest database genomes when analyzed in the context of a much relativestotheirsequencesareallbacterial,suggest- larger microbial genomic data set, including 1382 ing this functionality may have been acquired by bacterial and 73 archaeal species (data not shown). ancient horizontal gene transfer. The nearest homo- InferredmetaboliccapabilitiesoftheJ07AB43and log of the glucose-6-phosphate dehydrogenases in J07AB56 genomes are consistent with a predomi- J07AB43 and J07AB56 is from the genome of nately aerobic, heterotrophic lifestyle. The absence Salinibacter ruber, a common bacterial inhabitant of identifiable anaerobic terminal reductases of hypersaline environments believed to have suggests they are incapable of anaerobic respiration experiencedfrequenthorizontalgeneexchangewith although the presence of lactate dehydrogenases archaea (Mongodin et al., 2005). suggests possible fermentative metabolism under microaerophilic conditions. Both genomes contain enzymes necessary to support glycolysis, as well as Geographical distribution and diversity operons encoding key enzymes for glycogen synth- Lineage-specific PCR primer, LT_1215R (Table 1) esis and catabolism. Several of these enzymes, and general archaeal primer Arc21F were used to including a glycogen debranching enzyme and construct clone libraries from environmental DNA predicted alpha-1,6-glucosidase activity, are not samples collected from both LTand CV, yielding 43 present in any other known members of class new 16S rRNA gene sequences. Additional 16S Halobacteria. However, these enzyme activities are rRNA gene sequences, with 485% identity to frequently found in archaea from classes Methano- J07AB43 and J07AB56, were identified in public cocci and Thermoplasmata that utilize starch as an databases. These published sequences originated in internal storage molecule (Ko¨nig et al., 1985, 1982). environmentalsamplesfromAfrica,AsiaandSouth This suggests a possible common ancestral origin, America, as well as Australia and North America withsubsequentgenelossintheHalobacterialineage. (Supplementary Table S7). The phylogenetic analysis In addition to the Embden–Meyerhoff pathway, of these 16S rRNA gene sequences reveals at least genes supporting the entire pentose phosphate eight distinct clades with strong bootstrap support TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 89 Figure6 16SrRNAgenemaximumlikelihoodtreeofNanohaloarchaeasequencesrecoveredfromworldwidehypersalinehabitats.Tree isbasedon709nucleicacidpositionsin77sequences.Numbersatnodesrepresentbootstrapvalues(valueso50%notshown).Scalebar showsaveragenumberofsubstitutionspersite. (bootstrapvalues487%,Figure6).Basedondegree using a combination of strategic environmental of sequence divergence, each clade most likely sampling,deepsequencing,anddenovometagenomic represents a new genus or higher taxonomic level. assembly can reveal significant new information. ClassificationofJ07AB43andJ07AB56intoseparate We have discovered and characterized nearly genera is strongly supported by tree topology, complete genomes representing a novel archaeal 16% sequence divergence in the 16S rRNA gene lineage prevalent in hypersaline systems world- (Supplementary Table S5) and a 13% difference in wide, yet very different from all previously genomic GþC content. described members of class Halobacteria. We propose the creation of a new class ‘Nanoha- loarchaea’ within phylum Euryarchaeota to Discussion accommodate this new lineage. We further propose partitioning class Nanohaloarchaea to place This study has demonstrated that re-examination of J07AB43 and J07AB56 into distinct genera, Candi- a fairly simple, well studied environmental habitat datus ‘Nanosalina sp. J07AB43’ and ‘Candidatus TheISMEJournal DenovometagenomicassemblyofNanohaloarchaea PNarasingaraoetal 90 Nanosalinarum sp. J07AB56’. Evidence supporting et al., 2006). If extremely high environmental these proposals includes: (i) comprehensive eur- magnesium cannot be adequately excluded from yarchaeotal phylogenetic analyses based on 16S the cell, lower genomic GþC helps maintain DNA rRNA genes and ribosomal proteins; (ii) lineage- structuralflexibilityandavoidsdifficultiesinstrand specificfeatures,includingnumerousgeneswithout separationcausedbyelevatedmeltingtemperatures. previously described close relatives; and (iii) These same principles could apply to J07AB43, significant intra-lineage diversity and abundance providingapossible selectiveadvantage underhigh within geographically distinct hypersaline habitats magnesiumconditionsexpectedinevaporativehigh worldwide. Evolutionary distinctness of J07AB43 salt environments. and J07AB56 from other halophilic archaea is Nanohaloarchaea are estimated to represent at reinforced by taxonomic patterns of BLASTP least 10–25% of the total archaeal community in matches for their predicted proteomes against surface water samples from LT, Australia and CV, GenBank nr, as well as amino acid composition- California,USA.Webelievethese valuesarerobust, based clustering. The sister-grouping of class based on agreement of three independent analysis Halobacteria and class Nanohaloarchaea reflects techniques: amplification of environmental 16S probable derivation from an ancient common rRNA gene sequences; statistical analysis of meta- halophilic ancestor with a ‘high salt-in’ osmotic genomic sequencing reads assembled into near- regulation strategy, followed by subsequent complete draft genomes; and quantitative FISH of divergence along separate evolutionary paths. cells from natural water samples labeled with Lineage-specific characteristics that distinguish lineage-specific probes. Microscopic counts reveal ‘CandidatusNanosalinasp.’and‘CandidatusNano- that Nanohaloarchaea are present at cell concentra- salinarum sp.’ from most other extreme halophiles tions exceeding 106cellsml–1 in hypersaline habitats includetheirsmallphysicalsize,compactgenomes, of Australia and North America. The sporadic single-copy rRNA operon, low GþC composition, identification of Nanohaloarchaea in other surveys unique proteome amino acid composition, absence of hypersaline communities worldwide suggests that of conserved gas vesicle genes and atypical Nanohaloarchaearepresentasignificantyetneglected predicted pathways associated with carbohydrate fractionofthebiomassanddiversityinthesehabitats. metabolism. Small compact genomes, as well as The inability of earlier studies to recognize the single-copy rRNA operons, have been proposed to significant contribution of Nanohaloarchaea to minimize metabolic costs in habitats where neither hypersaline community composition is likely due broad metabolic repertoire nor high numbers of to limitations of the tools routinely used to assess paralogous proteins are needed to accommodate environmentalmicrobialdiversity,includinglabora- rapid growth under fluctuating environmental toryculture,microscopy,amplificationof16SrRNA conditions (Klappenbach et al., 2000). Small cell gene fragments, and sequence database similarity size, which increases surface to volume ratio, could searches for unassembled metagenomic reads. The be an adaptation for optimizing nutrient uptake isolation of cultured strains from environmental capacity. Alternatively it is possible that small habitats is known to exclude many organisms that physical size allows Nanohaloarchaea to remain are highly successful in their native habitats. It is suspended in oxygenated surface waters to support therefore not surprising the 96 hypersaline archaeal aerobic metabolism, thus eliminating the need for isolates described to date do not include any gas vesicles to provide buoyancy. Nanohaloarchaea. Repeated efforts to culture these The low GþC compositions of the two Nanoha- microorganisms in our own laboratory have also loarchaea genomes, especially J07AB43 (43%), are been unsuccessful. Furthermore, cultivation-inde- surprisingconsideringtheirprevalenceinhighlight pendent microbial diversity studies based on 16S habitats. In the absence of compensatory mechan- rRNA gene amplification are known to suffer from isms, lower GþC would be expected to increase primerbias(Siposetal.,2007).Mismatchesbetween susceptibility to ultraviolet-induced DNA damage. Nanohaloarchaea and many commonly used One possible explanation is that the low GþC universal primers may have impeded detection in composition of J07AB43 is related to ecological earlier studies. Primers likely to have been particu- lifestyle. Low GþC composition and genomic larlyproblematicarehighlightedinTable1(Amann streamlining have been associated with decreased et al., 1990, 1995; Lane, 1991; DeLong, 1992; nitrogen requirements and a slow-growing, energy- DasSarma and Fleischman, 1995; Ihara et al., 1997; conservativelifestyleinmarinebacteria(Giovannoni BrunkandEis,1998;Daimsetal.,1999;Grantetal., etal.,2005).However,thehabitatsfromwhichthese 1999; Baker et al., 2003; Raes and Bork, 2008). Nanohaloarchaea were isolated are not generally The exceptionally small size of Nanohaloarchaea considered to be nutrient-limited (Oren, 2002b). compared with other halophilic microorganisms Alternatively, it has been proposed that the low makes them difficult to visualize by microscopy in GþC composition of H. walsbyi (48%) compared the absence of selective enrichment techniques or with other halophiles is a specific adaptation to group-specific probes, and can prevent recovery counteract the over-stabilizing effect of high magne- during sample concentration procedures targeting sium concentrations on DNA structure (Bolhuis largermicroorganismsorsmaller viruses(Rodriguez- TheISMEJournal

See more

The list of books you might like