Logout succeed
Logout succeed. See you again!

Department of Veterinary Parasitology Veterinary College, AAU, Anand PDF
Preview Department of Veterinary Parasitology Veterinary College, AAU, Anand
Format for Dept Information for AAU Web Site for Up Grading: June 2016 Department of Veterinary Parasitology Veterinary College, AAU, Anand Profile (In Brief): Department of Veterinary Parasitology is actively engaged in both Under-Graduate and Post-Graduate Teaching, Research and Extension activities from its inception in 1965. In the five year degree programme as per VCI, the subject of Veterinary Parasitology is divided into (1) VPA-211(3+1): General Veterinary Parasitology and Helminthology(Semester lll) ; (2) VPA-221(1+1): Veterinary Entomology and Acarology (Semester lV); (3) VPA- 222(2+1): Veterinary Protozoology(Semester lV). A practical course VLD 411 (0+1) Semester VII : Veterinary Clinical Biochemistry and Laboratory Diagnosis-I is taught in association with Biochemistry and Biotechnology and Pathology as per New VCI pattern. Efforts have been made to make the course more practical oriented and of diagnostic utility. The department is recognized to teach both at M.V.Sc. and Ph.D. at Post Graduate level. Till the date 29 scholars have obtained their Master‟s degree and 7 have obtained Ph.D degree. A scheme entitled „Scheme for the control of parasitic infestation in livestock especially in liverfluke and nasal granuloma‟ was attached with the department from 1965. Under the scheme survey of parasitic disease in livestock was carried out with particular reference to incidences of Liverfluke and Schistosomiasis. In addition to these studies on the tick fauna of livestock was also undertaken in detail especially on bionomics and control of some important species. The scheme was renamed as “Central Disease Research Station (Parasitic Control)” from 1972. Faculties: Sr. Name with Designation Phone Cell No Inter E-Mail No. photograph (O) Com No. 1 Dr.J.J.Hasnani Professor & Head 02692- 9099565295 913 [email protected] 225913 2 Dr.P.V.Patel Professor 02692- 9825239373 914 [email protected] 225914 3 Dr.N.D.Hirani Associate 02692- 9408789575 927 [email protected] Professor 225927 4 Shri H.L.Rabari Jr. Clerk - 9727491621 - [email protected] Major Activities: I. Teaching A. UG Courses (1) VPA-211(3+1):General Veterinary Parasitology and Helminthology(Semester lll) (2) VPA-221(1+1): Veterinary Entomology and Acarology (Semester lV) (3) VPA-222(2+1): Veterinary Protozoology(Semester lV). (4) VLD 411 (0+1) Semester VII : Veterinary Clinical Biochemistry and Laboratory Diagnosis-I is taught in association with Biochemistry and Biotechnology and Pathology as per New VCI pattern. B. PG Courses CODE COURSE TITLE CREDITS M.V.Sc. VPA 601 VETERINARY HELMINTHOLO GY-I 2+1 VPA 602 VETERINARY HELMINTHOLOGY-II 2+1 VPA 603 VETERINARY ENTOMOLOGY AND ACAROLOGY 2+1 VPA 604 VETERINARY PROTOZOOLOGY 2+1 VPA 605 PARASITOLOGICAL TECHNIQUES 0+2 VPA 606 CLINICAL PARASITOLOGY 1+1 VPA 607 TRENDS IN CONTROL OF LIVESTOCK AND 1+1 POULTRY PARASITES VPA 608 IMMUNOPARASITOLOGY 2+1 VPA 609 PARASITIC ZOONOSES 2+0 VPA 610 PARASITES OF ZOO AND WILD ANIMALS 2+1 VPA 611 MALACOLOGY 1+1 VPA 691 MASTER‟S SEMINAR 1+0 VPA 699 MASTER‟S RESEARCH 20 Ph.D. VPA 701 APPLICATIONS OF REMOTE SENSING AND 1+2 GEOGRAPHIC INFORMATION SYSTEM IN PARASITOLOGY VPA 702 MOLECULAR DIAGNOSTICS AND 2+1 VACCINE DEVELOPMENT IN PARASITOLOGY VPA 703 HOST PARASITE INTERACTIONS 2+0 VPA 704 ADVANCES IN PROTOZOOLOGY 2+1 VPA 705 ADVANCES IN HELMINTHOLOGY-I 2+1 VPA 706 ADVANCES IN HELMINTHOLOGY-II 2+1 VPA 707 ADVANCES IN ENTOMOLOGY AND ACAROLOGY 2+1 VPA 708 IN VITRO CULTIVATION OF PARASITES 1+2 VPA 709 EMERGING AND RE-EMERGING PARASITIC 2+0 DISEASES VPA 710 BIONOMICS OF PARASITES 3+0 VPA 711 ENVIRONMENTAL PARASITOLOGY 1+1 VPA 790 SPECIAL PROBLEM 0+2 VPA 791 DOCTORAL SEMINAR I 1+0 VPA 792 DOCTORAL SEMINAR II 1+0 VPA 799 DOCTORAL RESEARCH 45 Research II. A. Research Projects Completed (No., Title, Agency, Period, Budget Outlay, PI/Co-I) NIL B. Research Projects On going (No., Title, Agency, Period, Budget Outlay, PI/Co- Central Disease Research Station ( C.D.R.S.-Parasitic Control ), C.D.R.S.- B.H. 5301 Objectives : To know the important parasitic diseases prevalent in the State and to find out suitable control measures. To provide diagnostic services to Field Veterinarians, Livestock Owners, Organized and Private farms, etc. To assess various chemotherapeutic drugs against common parasitic diseases of livestock. Scheme – Plan/ Non- plan/ ICAR/DBT/GOG/GOI/Other Agencies etc.: Non - Plan Scheme. Details of Budget i.e. B.H. No. ,Grant Sanctioned and Expense:C.D.R.S. – B.H.5301 Sanction No. & Date : 1st August, 1964, Continuous Non-Plan Scheme. Staff Position: Sanctioned: Veterinary Officer/Senior Research Assistant Laboratory Technician Helpers Filled/Vacant: Veterinary Officer/Senior Research Assistant : NIL Laboratory Technician : NIL Helpers : NIL RF/TA/RA etc : NIL Name and Designation of Officer Incharge Dr.J.J.Hasnani (P.I) Professor & Head Dr.P.V.Pate (Co. P.I) Professor Dr.N.D.Hirani (Co. P.I) Associate Proffesor The following areas of research has been completed ; keeping in view the prevalence of parasitic fauna in Gujarat State. 1. Survey of incidence of helminths in Cattle , Buffaloes, Sheep and Goat in Gujarat. 2. “Hump sore” in cattle in Bhavnagar area. 3. Anaplasmosis in buffaloes in Kaira District. 4. Studies on incidence and control of parasitic diseases in cattle in Gaushalas of Gujarat. 5. Incidence of Fascioliasis amongst Sheep and Goats in the farm animals and migrating animals 6. Treatment of Surra with Berenil. 7. Survey of ticks of domestic animals of Gujarat State with study of Bionomics of some of its common species. 8. Study on skin nodular complex in calves. 9. Study on parasitic diseases of poultry. 10. On the Incidence of Coccidiosis in buffalo- calves in Gujarat. 11. Incidence of Babesiosis and Theileriosis in crossbred cattle. 12. Parasitic gastro-enteritis in cattle and buffaloes. 13. Incidence of nasal Schistosomiasis in goats. 14. Incidence of mange in buffaloes. 15. Record of Hematomyxus elephantis in an Indian elephant. 16. Record of Paragonimus westermanii from a clouded leopard in India. 17. Incidence of Spirometra mansoni from a dog. 18. Incidence of microfilaria in horses. 19. Incidence of Opisthiorchis sinensis in cat. 20. Sarcocystis infection in Cattle, buffaloes, sheep and goat. 21. Infection of cross-bred animals with Theileria annulata through infected Hyaloma anatolicum anatolicum. 22. Incidence of Entamoeba bovis infection in cattle. 23. Evaluation of common diagnostic procedures in experimental Trypanosoma evansi infection in buffalo- calves. 24. Experimental infection of common species of snails with the miracidium of G.explanatum. 25. Breeding habits of Hyalomma anatolicum anatolicum. 26. Epidemiology and ecology of Haemonochosis in sheep and goats. 27. Trials to test the efficacy of certain chemotherapeutic agents against different parasitic infections in sheep. 28. Certain immunodiagnostic tests for the detection of hepatic amphistomiasis. 29. Coccidial infection in buffalo calves of Livestock Research Station, Navsari. 30. Vaccine trials using parent stock vaccine viz, CoxAbic against Eimeria spp. in collaboration with Dept. of Pathology, 31. Studies on poultry parasites of Anand District. 32. Comparative efficacy of coccidiostats on coccidial prevalence and body weight of chicks and growers. 33. Studies on parasites of Goat in Anand District. 34. Transcriptome analysis of Paramphistomum cervi of Water Buffalo(Bubalus bubalis) using next generation sequencing. 35. Transcriptome analysis of Paramphistomum cervi in Goat (Capra hircus) using next generation sequencing. 36. Transcriptome analysis of Paramphistomum cervi in Sheep (Ovis aries) using next generation sequencing. 37. Diagnosis of Tropical Theileriosis in cattle and buffaloes using advanced molecular tools. 38. Comparative efficacy of coccidiostats on experimentally induced Eimeria tenella infection along with effects on growth, haemoto-biochemistry and pathology in broilers. 39. Abattoir studies on Amphistomosis of buffaloes. 40. Abattoir studies on Fasciolosis of buffaloes. 41. Studies on Prevalence, Haemato – Biochemical and Histopathological Aspects of Fasciolosis in Slaughtered Buffaloes. 42. Studies on Prevalence, Haemato – Biochemical and Histopathological Aspects of Amphistomosis in Slaughtered Buffaloes. 43. Studies on Clinico-Biochemical aspects of Ancylostomosis in Dogs 44. *Studies on prevalence, haemato-biochemical alterations and diagnostic aspects of Trypanosomaevansi using blood smear examination and polymerase chain reaction (PCR) in cattle and buffaloes. 45. *Studies on helminthic infection in equines *Research work is in progress. The department has also undertaken trials with various drugs: 1. Nilverm (Tetramisole) against nematodes in sheep. 2. Samorin (Isometamedium chloride) against Trypanosomiasis in buffaloes and donkeys. 3. Berenil (Diminazene aceturate) against Babesiosis and Typanosomiasis in cattle and buffaloes. 4. Pauryl (Carbryl 5% wettable powder) against ectoparasites in cattle and dogs. 5. Panacur (Fenbendazole ) against nematodes in sheep. 6. Metronidazole against Entamoeba bovis in cattle. 7. Comparative study of SRC 4402 and Niclosamide against cestodiasis in Poulrty and Sheep. 8. Malathion against Hyalomma anatolicum anatolicum and Haemaphysalis bispinosa infestation in buffaloes. 9. Butox (Deltamethrine 12.5 gram per litter) against cattle tick Boophilus microplus and Hyalomma anatolicum anatolicum. 10. Ivermectin ( Ivomac-MSD) against Sacroptic mange and nematodes in camel. 11. Ivermectin against lice infestation in goats. 12. Ivermectin against Sarcoptic mange in goats. 13. Fasinex (Triclabendazole) against fascioliasis in buffaloes and cattle. 14. Efficacy trial of ESb3 ( 30% Sulfaclozine sodium salt monohydrate) against Eimeria necatrix in experimentally infected broiler chicks 15. Efficacy trial of ESb3 (30% Sulfaclozine sodium salt monohydrate) against Eimeria tenella in experimentally infected broiler chicks 16. Clinical trial with Banminth Forte (Morantel citrate) against Gastrointestinal nematodiasis in Sheep and Goats. 17. Testing of the drug Banminth Forte (Morantel citrate) against Gastrointestinal nematodes in naturally infected cattle. 18. Field trial of Distodin (Oxyclozanide) against Fasciola gigantica infestation in cattle and buffaloes. C. Number of M.V.Sc. & Ph.D. degrees awarded Sr. Name of Degre Title of Research Work (Thesis) no Candidate e M.Sc/M.V.Sc 1 B. L. Avsatthi M.Sc Bionomics of Hyalomma anatolicum anatolicum,Koch,1844. a common tick of cattle in Gujarat State. 2 D. K. Pethkar M.Sc Studies on Mecistocirrus digitatus, a common nematode of cattle in Gujarat State 3 K.S.Rao M.Sc Studies on ticks of Sagar district of Mysore State. 4 R. B. Prajapati M.V.Sc Studies on Psoroptic mange, mites of buffaloes in Kaira District Of Gujarat State 5 P. C. Patnaik M.V.Sc Bionomics of Ornithodorus savignii with a note on some ticks of Orissa 6 B. V. Upadhyay M.Sc Studies on internal anatomy of Hyaloma merginatum issaci. 7 S. V. Pachlag M.V.Sc Bionomics of most common nematodes of sheep 8 C.R. Tandel M.Sc Bionomics of Hippoboscid flies of Livestock in Gujarat State 9 D.D. Nagpal M.V.Sc Immunodiagnosis of Trypanosomiasis in Livestock. 10 K. N. Raval M.Sc Studies on Myasis producing flies in Gujarat State 11 L.G. Kathiria M.V.Sc Evaluation of some common diagnostic procedures in experimental Trypanosoma evansi infection in buffalo calves 12 R.R Momin M.V.Sc Studies on Gastro-intestinal nematodiasis in Sheep under farm and field condition in Palanpur District of North Gujarat 13 J.J. Hasnani M.V.Sc Helminthic infestation in domestic ruminants in Gujarat State 14 M.H. Kikani M.V.Sc Studies on ectoparasites of Buffaloes (Bubalus bubalis) in Junagadh and Kaira Districts of Gujarat State 15 P.V. Patel M.V.Sc Internal parasites of Goats and Sheep with particular reference to hematological and biochemical studies. 16 A.S. Nayee M.V.Sc Studies on hematological values, skin lesions and total protein profile in Camels naturally infected with Sarcoptes scabiei and nematodes before and after treatment with Ivermactin. 17 D.G. Sthanki M.V.Sc Study on the Schistosoma nasale infestation in cattle with particular reference to Histopathological, biochemical and haematological aspects 18 J.B.Solanki M.V.Sc Clinico-biochemical aspects of Canine Demodecosis 19 N.D.Hirani M.V.Sc Studies on Prevalence, Haematology, Biochemical and Histopathological changes in Fowl Coccidiosis 20 H. C. Patel M.V.Sc A study on Helminth Parasites of buffaloes brought to Ahmedabad slaughter house 21 Yogesh Kumar M.V.Sc Studies on Gastro-intestinal parasites of poultry in Anand Gupta district 22 Subhash Sharma M.V.Sc Studies on prevalence, clinico-biochemical and histopathological aspects of helminth parasites of Goats in Anand District. 23 Sweta Garg M.V.Sc Transcriptome analysis of Paramphistomum cervi in Goat (Capra hircus) using next generation sequencing 24 Vijayata M.V.Sc Transcriptome analysis of Paramphistomum cervi in Sheep (Ovis aries) using next generation sequencing 25 Reetika Chourasia M.V. Transcriptome analysis of Paramphistomum cervi of Sc Water Buffalo(Bubalus bubalis) using next generation sequencing 26 V. R. Kundave M.V.Sc Diagnosis of Tropical Theileriosis in Cattle and Buffaloes using Advanced Molecular Tools 27 S. S. Pandya M.V.Sc Studies on Prevalence, Haemato – Biochemical and . Histopathological Aspects of Fasciolosis in Slaughtered Buffaloes. 28 V.D. Chauhan M.V.Sc Studies on Prevalence, Haemato – Biochemical and . Histopathological Aspects of Amphistomosis in Slaughtered Buffaloes. 29 Brahmbhatt N.N. M.V.Sc Studies On Clinico-Biochemical Aspects of . Ancylostomosis In Dogs Ph.D 1 V.O.Shah Ph.D. Effect of Physical and Chemical agents on the Ionic concentration, cuticular secretion and rate of mortality in the different stages of tick Hyaloma anatolicum anatolicum, Koch, 1844 2 A.I. Patel Ph.D. Ectoparasites of Camel (Camelus dromedarius) with particular reference to tick fauna 3 J.J.Hasnani Ph.D. Comparative studies on the Immunological, Histopathological, Histochemical and Biochemical aspects of Fasciola gigantica and Gigantocotyle explanatum infestation in buffaloes. 4 P.V.Patel Ph.D. Parasitic fauna of wild animals in Gujarat State. 5 G.C.Puttalakshma Ph.D. Morphology, Pathology and Molecular characterization of mma Adults and Free living developmental stages of Amphistomes of water buffalo(Bubalus bubalis) 6 J.B.Solanki Ph.D. Epidemiological, Haematobiochemical and Histopathological aspects of Helminth parasites of Camels. 7 N.D.Hirani Ph.D. Comparative Efficacy of Coccidiostats on Experimentally Induced Eimeria tenella Infection Along with Effects on Growth, Haemato - Biochemistry and Pathology in Broilers D. Research Publications (No.) : (After 2010) National : 37 International : 16 E. Research Recommendations: Total = 5 (Five) Recommendation for Scientific Community : 4 (Four) In House designed primer F-5‟ AGCCGAGCTGAATGAGAAACA3‟ R-5‟ AACCCCACCGAACATATACAC3‟ can be used for specific detection of Gastrothylax indicus by PCR. It is advisable to have prophylactic deworming during pre-monsoon and post-winter seasons for Nematodes (Trichostrongylus spp.; Trichuris spp.) and Cestode (Moniezia spp.) infections in Goats of Anand District. It is advisable to have prophylactic antitrematodal treatment during pre-winter and pre-monsoon seasons for Paramphistomum cervi, Cotylophoron cotylophorum and Gigantocotyle explanatum infections in buffaloes of Anand and Ahmedabad districts. It is advisable to have prophylactic flukicidal treatment during pre-winter and pre- monsoon seasons for Fasciola gigantica infection in buffaloes of Anand and Ahmedabad districts. Recommendation for Farmers’ Community : 1 (One) 1) Recommendation (Approved) (for pet dog keepers) “The prevalence of Ancylostomosis (14-37%) has been observed round the year in pet dogs of Anand district, hence the pet owners are advised to follow the prescribed deworming schedule”. પાલતું કતૂ રાના માલકોને ભામણ “ આણદું જિલ્ામાું કતૂ રાું પાલતાું માલકોને ભામણ કરળામાું આળે છે કે તેઓએ ળવષપયંત ( - %) ( ) ૧૪ ૩૭ િોળા મલે અંક કૃમમ એંકાયોસ્ટોમોમશશ ના રોગના અટકાળ માટે મનયત , ” કૃમમનાક દળા મનર્ાષરરત શમયાતું રે આપળી િોઇએ . Extension III A. Refresher Training Courses / Summer-Winter Schools conducted