Logout succeed
Logout succeed. See you again!

Description of a New Mangrove Hercostomus Loew (Diptera: Dolichopodidae: Dolichopodinae) from Bohol, Philippines PDF
Preview Description of a New Mangrove Hercostomus Loew (Diptera: Dolichopodidae: Dolichopodinae) from Bohol, Philippines
Tropical Natural History 18(1): 24–31, April 2018 2018 by Chulalongkorn University Description of a New Mangrove Hercostomus Loew (Diptera: Dolichopodidae: Dolichopodinae) from Bohol, Philippines KAY PIOCNACIA RAMOS1 AND PATRICK GROOTAERT2,3* 1Western Mindanao State University, College of Science and Mathematics, Department of Biological Sciences, Zamboanga City, PHILIPPINES 2National Biodiversity Centre, National Parks, Singapore; Lee Kong Chian Natural History Museum, National University of Singapore, SINGAPORE 3Royal Belgian Institute of Natural Sciences, Vautierstreet 29, 1000 Brussels, BELGIUM * Corresponding author. Patrick Grootaert ([email protected]) Received: 14 December 2017; Accepted: 9 February 2018 ABSTRACT.– A new dolichopodid fly species, Hercostomus pachynervis sp. nov. is reported from mangrove forest in Bohol, Philippines. The species is described based on its uniqueness of the thickened veins R2+3 and R4+5 and lacking a stigma as in other related Hercostomus species in the Oriental region. This new species is the first Hercostomus species ever recorded in Bohol, Philippines. A key is given for the Oriental mangrove Hercostomus species with thickened veins and a stigma. KEY WORDS: Hercostomus, new species, mangrove, Bohol, Philippines INTRODUCTION was found in mangroves. Hercostomus zygolipes (Grootaert and Meuffels, 2001) The Dolichopodidae: Dolichopodinae of described from Dalton Pass in central Luzon Bohol Island in the Philippines have never is also a terrestrial species that was been dealt with in any comprehensive way. originally described in the genus Steleopyga The world catalogue of Yang et al., (2006) Grootaert and Meuffels, 2001. includes species occurring in the Philippines Here, we report on a new and also the on Mt Makiling, Los Banos and Palawan first record of a Hercostomus species that but none are reported in the other parts of was found in mangroves on Bohol, the Philippines. Philippines. Hercostomus species have The genus Hercostomus is one of the adapted well to mangrove conditions. Zhang most diverse genera of Dolichopodidae with et al. 2007, 2008 described eight species no less than 270 species in the Oriental from marine habitats in Singapore and Pulau region (Yang et al. 2006). However, only Tioman (Malaysia): one species from the four Hercostomus species are recorded until sandy beach along a creek in a mangrove on now from the Philippines: Hercostomus Pulau Tioman and seven species from bakeri Frey, 1928, a terrestrial species found Singapore’s mangrove. The adult flies are on Mt Makiling, Hercostomus gymnopygus active on the mud flats where they can be Frey, 1925 described from Los Banos seen foraging for prey. Luzon, a site at the foot of Mt Makiling, As more intensive collecting for Hercostomus humeralis Frey, 1925 from dolichopodids is conducted, it is expected Binaluan North Palawan. Since this site is that the number of dolichopodids in the on the coast it is possible that H. humeralis Philippines will increase a lot. The new RAMOS AND GROOTAERT — NEW MANGROVE HERCOSTOMUS FROM PHILIPPINES 25 FIGURE 1. Map of Bohol, Philippines: the grey lines indicate the Malaise trap stations at (SAVIMA Mangrove) and the green line demarks the zone where terrestrial reference Malaise traps were placed. Hercostomus species is remarkable in (Fig 2 A, B) in three sites: MT1 set in a very having thickened veins R and R wet mangrove area far from the dry land 2+3 4+5. Hercostomus lanceolatus Zhang et al., 2008 (9.730240°N, 123.853148°E); MT2 on the and H. limosus Zhang et al., 2008 have only edge of a mangrove area western island vein R thickened and a short part of apical side at high-tide edge (9.727924°N, 4+5 section of vein M The latter species both 123.849759°E), and MT3 at the edge of the 1+2. possess a large stigma which is absent in the back mangrove forest on the western side of new species described here. a concrete bridge at the SAVIMA mangrove area (9.727948°N, 123.849691°E). All individuals were preserved in a 70% un- MATERIALS AND METHODS methylated ethanol in Sarstedt tubes and stored at 20°C. Sorting of individuals to Collecting and pre-sorting samples major taxa (>family-level) was carried out Dolichopodid specimens were collected in at the Lee Kong Chian Natural History the mangrove area of San Vicente Mangrove Museum (LKCNHM), National University Forest Association (SAVIMA) Bohol, of Singapore, Singapore and the results were Philippines and in a terrestrial forest as verified by parataxonomists. reference for non-mangrove species (Fig. 1). The flies were collected using Malaise traps 26 TROPICAL NATURAL HISTORY 18(1), April 2018 FIGURE 2. A. Malaise Trap 1; B. Malaise Trap 2 Imaging of the specimens taken, stacked into a fully resolved image Photos were taken using the Dun Inc. using Zerene Stacker, and then digitally Passport II imaging system (using a 65mm processed for publication using Photoshop MPE lens) and processed via Adobe light CS5. room. Images at different focal lengths were RAMOS AND GROOTAERT — NEW MANGROVE HERCOSTOMUS FROM PHILIPPINES 27 TABLE 1. GenBank accession numbers of Hercostomus pachynervis sp. nov. specimens used for NGS COI barcoding. Haplotype Life Taxon Sex Accession Number Code Stage Hercostomus pachynervis sp. nov. F32_R66* ♂ Adult kp_COI_PHI_BohSW1T5_M_P1_25Jun16 F32_R86 ♂ Adult kp_COI_PHI_BohSW4T1_M_P1_30Jun16 F32_R63 ♀ Adult kp_COI_PHI_BohSW1T4_M_P1_25Jun16 F32_R88 ♀ Adult kp_COI_PHI_BohSW11T5_M_P1_3Sep16 F32_R76 ♀ Adult kp_COI_PHI_BohSW1T3_M_P1_25Jun16 F32_R74 ♀ Adult kp_COI_PHI_BohSW5T4_M_P1_23Jun16 *holotype Direct PCR Grootaert et Meuffels, 2001 (original Twenty-four mangrove Dolichopodidae designation). specimens without presorting to morpho- species were processed for NGS barcoding Hercostomus pachynervis sp. nov. using direct-PCR (Wong et al., 2014). All Figs 3–5 procedures were as described in Meier et al., (2016). Preparation of the specimens for Type material. DNA extraction was done as described in Holotype ♂. Philippine Islands, Bohol, Ramos et al. (in press) for other dolichol- SAVIMA Mangrove. (PHI, 9.727738°N, podids. (Table 1) 123.849755°E; 25 June 2016, (reference number in zoological collection PHI 00066). (in LKCNHM). RESULTS Paratypes. 1 ♂, 4 ♀♀ with the same provenance as holotype but collected on Class Insecta Linnaeus, 1758 different dates: 1♂, 30 July 2016 (PHI Order Diptera Linnaeus, 1758 00086); 1♀, 25 June 2016 (PHI 00063); 1♀, Superfamily Empidoidea Latreille, 1804 3 September 2016 (PHI 00088); 1♀, 25 Family Dolichopodidae Latreille, 1809 June 2016, (PHI00076); 1♀, 23 June 2016, Subfamily Dolichopodinae Loew, 1857 (PHI 00074). (all in LKCNHM). Etymology. The name pachynervis alludes Hercostomus Loew, 1857 to the thickened veins R and R . 2+3 4+5 Hercostomus Loew, 1857: 9. Type-species: Description. Sybistroma longiventris Loew, 1857 (original Male designation). Small species (body 3 mm, wing 2.7 Microhercostomus Stackelberg, 1949: 687 mm). Antenna yellow. Postpedicel heart- (as subgenus). Type species: Hercostomus shaped, rather pointed, brown above. (Microhercostomus) dilatitarsis Stackelberg, Postocular bristles black and uniseriate 1949 (original designation). throughout. Propleurals minute above, Steleopyga Grootaert et Meuffels, 2001: below 1 long black bristle. 208. Type species: Steleopyga dactylocera 28 TROPICAL NATURAL HISTORY 18(1), April 2018 FIGURE 3. Hercostomus pachynervis sp. nov. holotype ♂ lateral view. Legs yellow, including all tarsomeres, plumatus-group). Cercus yellow with short except for posterior four coxae that are yellowish bristles. black. Femora lack distinct ventral bristles. Male terminalia as in Fig. 5. Aedeagus Wing brownish tinged with brown veins. yellow, with a dorsal tooth near base and Basal half of veins R and R thickened larger lateral tooth at base. Tip of surstylus 2+3 4+5 (Fig. 3) in male. No stigma present. Squama with a plumiform appendage (see inset Fig. 5). white with long black cilia. Haltere white. Sternite 5 with a pale protuberance Female (probably concealing a pair of white similar to male but lacking thickened veins. vermiform extensions typical for the RAMOS AND GROOTAERT — NEW MANGROVE HERCOSTOMUS FROM PHILIPPINES 29 FIGURE 4. Hercostomus pachynervis sp. nov. holotype ♂ dorsal view. NGS COI barcodes for Hercostomus pachynervis sp. nov. >kp_doli_COI_PHI_BohSW1T5_000066_Mangrove_P1_25Jun16_F32_R66 holotype TTTCTGCAGGTATTGCTCATGGAGGAGCTTCTGTAGATCTAGCAATTTTTTCATTACATTTA GCAGGTATTTCATCTATTTTAGGAGCAGTAAATTTTATTACAACAGTTATTAATATACGATC AACAGGAATTACATTTGACCGAATACCTTTATTTGTATGATCAGTTGTTATTACTGCTATTT TATTACTATTATCTTTACCAGTGCTTGCTGGAGCTATCACAATACTATTAACAGATCGAAAT TTAAATACCTCATTTTTTGACCCTGCGGGAGGAGGAGATCCAATTCTATATCAACACTTATT T >kp_doli_COI_PHI_BohSW6T1_000086_Mangrove_P1_30Jul16_F32_R86 TTTCTGCAGGCATTGCCCATGGAGGAGCTTCTGTAGATCTAGCAATTTTTTCATTACATTTA GCAGGTATTTCCTCTATTTTAGGGGCAGTAAATTTTATTACAACAGTTATTAATATACGATC AACAGGAATTACATTTGACCGAATACCTTTATTTGTATGATCAGTTGTTATTACTGCTATTT TATTACTATTATCTTTACCAGTACTTGCTGGAGCTATTACAATACTATTAACAGATCGAAAT TTAAATACCTCATTTTTTGACCCTGCGGGAGGAGGAGACCCAATTCTATATCAACACTTATT T 30 TROPICAL NATURAL HISTORY 18(1), April 2018 FIGURE 5. Hercostomus pachynervis sp. nov. holotype ♂ male terminalia. ae: aedeagus; cer: cercus; d1, d2 teeth on aedeagus; el: epandrial lobe; hyp: hypandrium; inset: sur: surstylus. Scale 0.1mm. >kp_doli_COI_PHI_BohSW1T4_000063_Mangrove_P1_25Jun16_F32_R63 TTTCTGCAGGTATTGCTCATGGAGGAGCTTCTGTAGATCTAGCAATTTTTTCATTACATTTA GCAGGTATTTCATCTATTTTAGGAGCAGTAAATTTTATTACAACAGTTATTAATATACGATC AACAGGAATTACATTTGACCGAATACCTTTATTTGTATGATCAGTTGTTATTACTGCTATTT TATTACTATTATCTTTACCAGTGCTTGCTGGAGCTATTACAATACTATTAACAGATCGAAAT TTAAATACCTCATTTTTTGACCCTGCGGGAGGAGGAGACCCAATTCTATATCAACACTTATT T >kp_doli_COI_PHI_BohSW11T5_000088_Mangrove_P1_03Sep16_F32_R88 TTTCTGCAGGTATTGCTCATGGAGGAGCTTCTGTAGATCTAGCAATTTTTTCATTACATTTA GCAGGTATTTCATCTATTTTAGGAGCAGTAAATTTTATTACAACAGTTATTAATATACGATC AACAGGAATTACATTTGACCGAATGCCTTTATTTGTATGATCAGTTGTTATTACTGCTATTT TATTACTATTATCTTTACCAGTGCTTGCTGGAGCTATTACAATACTATTAACAGATCGAAAT TTAAATACCTCATTTTTTGACCCTGCGGGAGGAGGAGACCCAATTCTATATCAACACTTATT T >kp_doli_COI_PHI_BohSW1T3_000076_Mangrove_P1_25Jun16_F32_R76 CTTTCTGCAGGTATTGCTCATGGAGGAGCTTCTGTAGATCTAGCAATTTTTTCATTACACTT AGCAGGTATTTCATCTATTTTAGGAGCAGTAAATTTTATTACAACAGTTATTAATATACGAT CAACAGGAATTACATTTGACCGAATACCTTTATTTGTATGATCAGTTGTTATTACTGCTATT TTATTACTATTATCTTTACCAGTGCTTGCTGGAGCTATCACAATACTATTAACAGATCGAAA TTTAAATACCTCATTTTTTGACCCTGCGGGAGGAGGAGATCCAATTCTATATCAACACTTAT TT >kp_doli_COI_PHI_BohSW5T4_000074_Mangrove_P1_23Jul16_F32_R74 CCTTTCTGCAGGTATTGCTCATGGAGGAGCTTCTGTAGATCTAGCAATTTTTTCATTACATT TAGCAGGTATTTCATCTATTTTAGGAGCAGTAAATTTTATTACAACAGTTATTAATATACGA TCAACAGGAATTACATTTGACCGAATACCTTTATTTGTATGATCAGTTGTTATTACTGCTAT TTTATTACTATTATCTTTACCAGTGCTTGCTGGAGCTATCACAATACTATTAACAGATCGAA ATTTAAATACCTCATTTTTTGACCCTGCGGGAGGAGGAGATCCAATTCTATATCAACACTTA TTT RAMOS AND GROOTAERT — NEW MANGROVE HERCOSTOMUS FROM PHILIPPINES 31 Differential diagnosis. – Hercostomus thickened but vein R is not thickened. In 2+3 pachynervis sp. nov. is unique in having the addition both species have a stigma beyond basal half of both veins R and R the apex of R and a small part of the apical 2+3 4+5 1 thickened. Hercostomus lanceolatus Zhang section of vein M is also thickened. That 1+2 et al.,2014 and H. limosus Zhang et al, 2014 is not so in H. pachynervis sp. nov. have also a large section of vein R 4+5 Key to the Oriental marine Hercostomus with thickened veins 1. - Stigma (large yellow to brown coloured spot beyond tip of R ) present; apical 2/3 of 1 vein R thickened; a short part of apical section of vein M thickened …………… 2 4+5 1+2 - Stigma lacking; basal half of both veins R and R thickened; no thickening of the 2+3 4+5 apical section of vein M (Philippines) ………………………... pachynervis sp. nov. 1+2 2. - Stigma long, reaching beyond base of the swelling of vein R ; tip of hind femur with 4+5 a small brown anterodorsal spot (Singapore, Thailand, Brunei) ……………………….. ……………………………………………………………….. lanceolatus Zhang et al. - Stigma short, not reaching the base of the swelling of R ; tip of hind femur without 4+5 black spot (Singapore, Thailand, Brunei) …………………...…... limosus Zhang et al. genus (Diptera, Dolichopodidae). Studia ACKNOWLEDGEMENTS dipterologica 8: 207-216. Meier R., Wong W., Srivathsan A., & Foo M. 2016. We thank Dr. Reizl Jose of Bohol Island $1 DNA barcodes for reconstructing complex State University (BISU), Mr Maosheng Foo phenomes and finding rare species in specimen- rich samples. Cladistics, 32: 100-110. and Dr Yuchen Ang of the Lee Kong Chian Ramos K., Nuneza O., Meier R. & Grootaert P. Natural History Museum (LKCNHM), (submitted). Description of Two New Species of National University of Singapore, for their Mangrove Dolichopodidae from Bohol Island in help in many ways. The first author also the Philippines (Insecta: Diptera). Raffles Bulletin of Zoology. expresses her gratitude to the CHED –FDP Wong W. H., Tay Y. C., Puniamoorthy J., Balke M., II and Sandwich Program under CHED K to Cranston P. S., & Meier R. 2014. “Direct PCR” 12 Transition Program for the approval of optimization yields a rapid, cost-effective, the Grant to NUS, Singapore. Prof Rudolf nondestructive and efficient method for obtaining Meier hosted us at the National University DNA barcodes without DNA extraction. Molecular Ecology Resources, 14(6), 1271-1280. of Singapore and provided all the facilities Yang D., Zhu Y.J., Wang M.Q. & Zhang L.L. 2006. for the genetic work. World Catalog of Dolichopodidae (Insecta: Diptera). Agricultural University Press, Beijing, 704 pp. LITERATURE CITED Zhang L., Yang D. & Grootaert P. 2007. New Dolichopodinae (Diptera: Dolichopodidae) from Frey R. 1925. Philippinische Dipteren II. Fam. Pulau Tioman, Malaysia with description of four Dolichopodidae. Notulae Entomologicae 4: 115- new species. Bulletin van het Koninklijk Belgisch 123. Instituut voor Natuurwetenschappen 77: 243-249. Frey R. 1928. Beiträge zur Kenntnis der exotischen Zhang L., Yang D. & Grootaert P. 2008. Mangrove Dolichopodiden. Notulae Entomologicae 8: 17-23. Hercostomus sensu lato (Diptera: Dolichopodidae) Grootaert P. & Meuffels H. 2001. Three new of Singapore. The Raffles Bulletin of Zoology 56: Southeast Asian Dolichopodinae from the 17-28. Hercostomus complex, with long stalked hypopygia, and with the description of a new