Logout succeed
Logout succeed. See you again!

Development and Characterization of 14 Microsatellite Markers for the Antarctic Midge Parochlus steinenii (Diptera, Chironomidae) in Maritime Antarctic PDF
Preview Development and Characterization of 14 Microsatellite Markers for the Antarctic Midge Parochlus steinenii (Diptera, Chironomidae) in Maritime Antarctic
Anim. Syst. Evol. Divers. Vol. 33, No. 2: 140-143, April 2017 https://doi.org/10.5635/ASED.2017.33.2.010 Short communication Development and Characterization of 14 Microsatellite Markers for the Antarctic Midge Parochlus steinenii (Diptera, Chironomidae) in Maritime Antarctic Hanna Kim1,#, Seunghyun Kang2,#, Hanul Kim1, Sanghee Kim3, Jongwoo Jung1,4,* 1The Division of EcoCreative, Ewha Womans University, Seoul 03760, Korea 2Unit of Polar Genomics, Korea Polar Research Institute, Incheon 21900, Korea 3Division of Polar Life Sciences, Korea Polar Research Institute, Incheon 21900, Korea 4Department of Science Education, Ewha Womans University, Seoul 03760, Korea #These authors contributed equally to this work. ABSTRACT A winged midge species, Parochlus steinenii is one of the most abundant species in Antarctica, which is distributed over a wide area from the South American continent to the South Shetland Islands in Antarctica. It was dispersed into islands in the South Shetland Islands from the South American continent, and it adapted to a variety of environ- ments and settled. This species, therefore, is a good model organism to explain the evolutionary process of Antarctic terrestrial fauna. Nevertheless, there are few genetic studies on this species, which are necessary for understanding the genetic diversity, population structure, etc. Here, we developed and characterized 14 polymorphic microsatellite markers. The number of alleles per locus ranged from 2 to 5. The observed and expected heterozygosities were in the range of 0.024 to 0.561 and 0.024 to 0.535, respectively. Identifying genetic differences between populations, they are suitable markers for researches investigating genetic diversity and population structure of P. steinenii, which provide us with clues to dispersion, evolution and ecology of this species. Keywords: Parochlus steinenii, Antarctica winged midge, microsatellite marker, next generation sequencing, evolution, population genetics INTRODUCTION which adapted to various environmental conditions may be considerable (Sublette and Wirth, 1980; Edwards and Usher, Compared with the Arctic that has more than 1,650 species 1985). This species, therefore, can be a good model to ex- of insects, Antarctica has no insects except two dipteran spe- plain the distribution and evolution of Antarctic insects. cies, winged midge Parochlus steinenii (Gerke) and wing- But previous studies on P. steinenii have focused mainly on less midge Belgica antarctica Jacobs (Convey and Block, morphology and ecology (Wirth and Gressitt, 1967; Edwards 1996). Of these, P. steinenii is distributed from the South and Usher, 1985; Shimada et al., 1991; Convey and Block, Shetland Islands on the west coast of the Antarctic Peninsula 1996; Hahn and Reinhardt, 2006; Rico and Quesada, 2013). to the Tierra del Fuego on the South American continent and No suitable genetic markers have been developed for this it is known as one of the most abundant species in Antarctica species as well as research to understand the population ge- (Brundin, 1970; Convey, 1996). netic structure in order to investigate the evolution of this Unlike B. antarctica, which lives only in Maritime Ant- species. arctica, P. steinenii was dispersed and settled in several is- Population genetics studies are needed to understand the lands in the South Shetland Islands as well as continent of adaptation, evolution and dispersion process of organisms. South America (Usher and Edwards, 1984; Edwards and One of the most popular genetic markers for population ge- Usher, 1985; Convey and Block, 1996). Several researchers netics is a microsatellite due to its high polymorphism, co- have suggested that the speciation potential of this species dominant property, etc. (Tautz, 1989). Information obtained This is an Open Access article distributed under the terms of the Creative *To whom correspondence should be addressed Commons Attribution Non-Commercial License (http://creativecommons.org/ Tel: 82-2-3277-2616, Fax: 82-2-6937-0733 licenses/by-nc/3.0/) which permits unrestricted non-commercial use, distribution, E-mail: [email protected] and reproduction in any medium, provided the original work is properly cited. eISSN 2234-8190 Copyright The Korean Society of Systematic Zoology Fourteen Microsatellite Markers for Antarctic Midge King George Antarctica Nelson Barton peninsula Robert Greenwich Livingston A Snow B Smith Deception Low Fig. 1. Map showing the collection sites of Parochlus steinenii in Antarctica. using microsatellites is useful for establishing conservation ysis, multiplex PCR amplification was performed in 16 μL measures as well as for investigating the population struc- PCR mixture composed of 5 μL of 2 QIAGEN Multiplex ture, evolution, dispersal and ecological properties (Chistia- PCR master mix (Qiagen), 0.08 μL of M13-tailed forward × kov et al., 2006; Selkoe and Toonen, 2006). Here, we firstly primer (10 μM), 0.8 μL of pig tailed reverse primer (10 μM), developed 14 microsatellite markers for P. steinenii. 0.3 μL of template DNA, and 0.16 μL of each fluorescence Samples of P. steinenii were collected from King George primer (FAM/PET/NED) (10 μM). PCR cycle conditions Island, West Antarctica (62°14S, 58°47W) in 2015 (Fig. 1, were as follows: initial denaturation at 95°C for 15 min, site A). Genomic DNAs were extracted using the DNeasy 90 sec of annealing at a specific temperature (14 cycles at Tissue Kit (Qiagen, Valencia, CA, USA). Of these, 41 indi- 63°C, 7 cycles at 58°C, 20 cycles at 55°C), each cycle elon- viduals were used in this study. gation at 72°C for 30 sec, and final elongation at 72°C for Next generation sequencing was performed with the MiSeq 20 min. Genotyping was performed using ABI 3730xl DNA platform (Illumina, San Diego, CA, USA) and shotgun li- analyzer (Applied Biosystems, Foster City, CA, USA) and braries were prepared and sequenced according to the man- GeneMapper software v.3.7 (Applied Biosystems). ufacturer’s instructions. The number of observed alleles at each locus (A), observ- Microsatellite candidates were selected from genomic ed heterozygosity (HO) and expected heterozygosity (HE) for data using the QDD software (Meglécz et al., 2014). A total each locus were calculated using the program ARLEQUIN of 504 microsatellite loci were obtained, and for these loci 3.5 (Excoffier and Lischer, 2010). Hardy-Weinberg equilib- 56 primers were designed using Primer3 program (http:// rium (HWE) and linkage disequilibrium (LD) were tested bioinfo.ut.ee/primer3, Untergasser et al., 2012). PCR am- using GENEPOP 4.2.1 (Raymond and Rousset, 1995; Rous- plifications were performed in a total solution of 25 μL con- set, 2008). Program Micro-Checker v2.2.3 was used to taining 1.0 μL of template DNA, 2.5 μL of 10 buffer, 0.7 confirm the existence of null alleles (Van Oosterhout et al., μL of dNTP (10 mM), 1.5 μL of MgCl2 (25 mM), 0.5 μL of 2004). × each primer (10 μM), and 0.3 μL of Taq polymerase (Takara, Otsu, Japan). Cycling program conditions were follows: ini- tial denaturation at 95°C for 5 min, followed by 35 cycles of RESULTS AND DISCUSSION denaturation at 94°C for 60 sec, annealing at 45-60°C for 60 sec, elongation at 72°C for 90 sec, and final elongation at A total of 56 primer sets were selected from 504 candidates 72°C for 7 min. and we successfully developed 14 polymorphic markers M13 tail (FAM: TTT CCC AGT CAC GAC GTT G, PET: (Table 1). The number of alleles per locus ranged from 2 to GCG GAT AAC AAT TTC ACA CAG G, NED: TAA AAC 5. HO and HE varied from 0.024 to 0.561 and 0.024 to 0.535, GAC GGC CAG TGC) was attached to the 5ʹ end of each respectively. All loci, except 3 loci, showed significant de- forward primers, and pig tail (GTT TCT T) was attached to viation from HWE after Bonferroni correction (p 0.0035). the 5ʹ end of all reverse primers. For genetic diversity anal- Evidence of null allele was confirmed in 5 loci, which was = Anim. Syst. Evol. Divers. 33(2), 140-143 141 Hanna Kim, Seunghyun Kang, Hanul Kim, Sanghee Kim, Jongwoo Jung Table 1. Fourteen microsatellite loci developed from Parochlus steinenii Repeat Fluorescent Size range Locus motif Primer sequence (5ʹ-3ʹ) dye (bp) A HO HE HWE A-10 AAC F: TTTCCCAGTCACGACGTTGGCCTTATTTAAAGAATTTAGCAATCG 6FAM 120-123 2 0.079 0.169 0.018 R: GTTTCTTGTCATGATGGCCTGACCAA A-11 AAC F: TTTCCCAGTCACGACGTTGTTGTTGGTTAGTGACAACGTCC 6FAM 118-124 2 0.488 0.506 1.000 R: GTTTCTTAAATTCATAGATGGCTCGAATATC A-16 AG F: TTTCCCAGTCACGACGTTGGGTTCCACCGCACTAACACT 6FAM 119-127 2 0.195 0.287 0.069 R: GTTTCTTGGGCGGAGCCTAAATTTGTA B-06 AAC F: TAAAACGACGGCCAGTGCGAGGTGGATTTGTGGCATTC NED 276-279 3 0.075 0.074 1.000 R: GTTTCTTTCATAGCCGGTGATTTATTCG B-11 AAC F: TAAAACGACGGCCAGTGCAACTAACCTGAATTTCGCTAACCA NED 265-268 2 0.244 0.506 0.001a R: GTTTCTTGCGCTCAGTTGCCTCAGT B-13 AT F: TAAAACGACGGCCAGTGCAAATAAGATGGTGGAGGCGA NED 259-270 5 0.300 0.357 0.372 R: GTTTCTTGTAAGAAATGTGTATCGGCGG B-15 ACCT F: TAAAACGACGGCCAGTGCTGGTGACATTGCTGGAGTTG NED 284-292 3 0.561 0.527 0.603 R: GTTTCTTCCAACAATATTTGGGCGATT B-16 AAG F: TAAAACGACGGCCAGTGCGGCCGTTGTATGACGAAAGT NED 173-183 4 0.128 0.535 0.000a R: GTTTCTTTTCATTTCCTTTAATCTTTGAACCA C-03 AAC F: GCGGATAACAATTTCACACAGGGGAGAAGTGAGTATTTCGCAGG PET 315-318 2 0.450 0.444 1.000 R: GTTTCTTCTGTTTGAGTGGTGAAGCTTGT C-07 AAG F: GCGGATAACAATTTCACACAGGCAACACCAAATCTTCCTTTGC PET 330-336 4 0.300 0.531 0.001a R: GTTTCTTTGCAAATGAATGGCAGAAAG C-10 AAT F: GCGGATAACAATTTCACACAGGACCGTTTGAGGATAAAGGAAGA PET 375-378 2 0.289 0.321 0.610 R: GTTTCTTTTATCCGCTTGCCAATACG C-11 AAC F: GCGGATAACAATTTCACACAGGAAATAAATACAGTATCAAGCAGGCA PET 422-423 2 0.024 0.024 1.000 R: GTTTCTTAGCCCGCCAAGTACTCATT C-12 AAG F: GCGGATAACAATTTCACACAGGAGACGCAAATGCTGTGAAAGT PET 429 3 0.024 0.048 0.012 R: GTTTCTTATCTCACGCCATCACACTGA C-13 AAT F: GCGGATAACAATTTCACACAGGGGAAATAGGAGTAGTGCAGTTGG PET 437-439 2 0.171 0.270 0.042 R: GTTTCTTTCATCTGATCTGGTCAAGGAA A, number of allele; HO, observed heterozygosity; HE, expected heterozygosity; HWE, Hardy-Weinberg equilibrium. aSignificant after Bonferroni correction (p<0.0035). presumably due to excess of homozygotes or scoring error. REFERENCES The LD of each pair of loci was not significant after Bonfer- Brundin L, 1970. Diptera: Chironomidae of South Georgia. Pa- roni correction. cific Insects Monographs, 23:276. The 14 newly developed markers showed low genetic di- Chistiakov DA, Hellemans B, Volckaert FAM, 2006. Microsat- versity, but it was probably because the samples used for the ellites and their genomic distribution, evolution, function analyses were collected from an isolated area. Although not and applications: a review with special reference to fish presented in this paper, we performed Bayesian clustering of genetics. Aquaculture, 255:1-29. http://doi.org/10.1016/ this population with the population of Deception Island (Fig. j.aquaculture.2005.11.031 1, site B) in the South Shetland Islands using the STRUC- Convey P, 1996. The influence of environmental characteris- TURE program (Pritchard et al., 2000). As a result, we con- tics on life history attributes of Antarctic terrestrial biota. firmed that the two populations had a genetically distinct Biological Reviews, 71:191-225. https://doi.org/10.1111/ structure. These results confirmed that the newly developed j.1469-185X.1996.tb00747.x markers show discernment to investigate the genetic struc- Convey P, Block W, 1996. Antarctic Diptera: ecology, physi- ology and distribution. European Journal of Entomology, ture of populations. These new markers could be useful for 93:1-13. establishing a conservation management plan of indigenous Edwards M, Usher MB, 1985. The winged Antarctic midge species in Maritime Antarctica. Parochlus steinenii (Gerke) (Diptera: Chironomidae) in the South Shetland Islands. Biological Journal of the Linnean Society, 26:83-93. https://doi.org/10.1111/j.1095-8312.1985. ACKNOWLEDGMENTS tb01553.x Excoffier L, Lischer HEL, 2010. Arlequin suite ver 3.5: a new This study was supported by the Korea Polar Research In- series of programs to perform population genetics analyses stitute (research grants PE17090). under Linux and Windows. Molecular Ecology Resources, 142 Anim. Syst. Evol. Divers. 33(2), 140-143 Fourteen Microsatellite Markers for Antarctic Midge 10:564-567. https://doi.org/10.1111/j.1755-0998.2010. Antarctic winged midge Parochlus steinenii during the ac- 02847.x tive season at King George Island. Polar Biology, 11:311- Hahn S, Reinhardt K, 2006. Habitat preference and reproduc- 314. https://doi.org/10.1007/BF00239023 tive traits in the Antarctic midge Parochlus steinenii (Dip- Sublette JE, Wirth WW, 1980. The Chironomidae and Cera- tera: Chironomidae). Antarctic Science, 18:175-181. https:// topogonidae (Diptera) of New Zealand’s subantarctic is- doi.org/10.1017/S0954102006000204 lands. New Zealand Journal of Zoology, 7:299-378. https:// Meglécz E, Pech N, Gilles A, Dubut V, Hingamp P, Trilles A, doi.org/10.1080/03014223.1980.10423791 Grenier R, Martin JF, 2014. QDD version 3.1: a user-friend- Tautz D, 1989. Hypervariability of simple sequences as a gen- ly computer program for microsatellite selection and prim- eral source for polymorphic DNA markers. Nucleic Acids er design revisited: experimental validation of variables Research, 17:6463-6471. https://doi.org/10.1093/nar/17.16. determining genotyping success rate. Molecular Ecology 6463 Resources, 14:1302-1313. https://doi.org/10.1111/1755- Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, 0998.12271 Remm M, Rozen SG, 2012. Primer3-new capabilities and Pritchard JK, Stephens M, Donnelly P, 2000. Inference of pop- interfaces. Nucleic Acids Research, 40:e115. https://doi. ulation structure using multilocus genotype data. Genetics, org/10.1093/nar/gks596 155:945-959. Usher MB, Edwards M, 1984. A dipteran from south of the Raymond M, Rousset F, 1995. GENEPOP (version 1.2): pop- Antarctic Circle: Belgica antarctica (Chironomidae) with ulation genetics software for exact tests and ecumenicism. a description of its larva. Biological Journal of the Linne- Journal of Heredity, 86:248-249. https://doi.org/10.1093/ an Society, 23:19-31. https://doi.org/10.1111/j.1095-8312. oxfordjournals.jhered.a111573 1984.tb00803.x Rico E, Quesada A, 2013. Distribution and ecology of chiron- Van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P, omids (Diptera, Chironomidae) on Byers Peninsula, Mari- 2004. MICRO-CHECKER: software for identifying and time Antarctica. Antarctic Science, 25:288-291. https://doi. correcting genotyping errors in microsatellite data. Mo- org/10.1017/S095410201200096X lecular Ecology Notes, 4:535-538. https://doi.org/10.1111/ Rousset F, 2008. GENEPOP’007: a complete re-implementa- j.1471-8286.2004.00684.x tion of the GENEPOP software for Windows and Linux. Wirth WW, Gressitt JL, 1967. Diptera: Chironomidae (Midges) Molecular Ecology Resources, 8:103-106. https://doi.org/ 1. In: Entomology of Antarctica (Ed., Gressitt JL). American 10.1111/j.1471-8286.2007.01931.x Geophysical Union, Washington, DC, pp. 197-203. Selkoe KA, Toonen RJ, 2006. Microsatellites for ecologists: a practical guide to using and evaluating microsatellite mark- ers. Ecology Letters, 9:615-629. https://doi.org/10.1111/j. 1461-0248.2006.00889.x Received April 3, 2017 Shimada K, Ohyama Y, Pan CX, 1991. Cold-hardiness of the Accepted April 24, 2017 Anim. Syst. Evol. Divers. 33(2), 140-143 143