Logout succeed
Logout succeed. See you again!

Discus fishes: mitochondrial DNA evidence for a phylogeographic barrier in the Amazonian genus ... PDF
Preview Discus fishes: mitochondrial DNA evidence for a phylogeographic barrier in the Amazonian genus ...
Journal of Fish Biology (2006) 69 (Supplement B), 200–211 doi:10.1111/j.1095-8649.2006.01232.x,availableonlineathttp://www.blackwell-synergy.com Discus fishes: mitochondrial DNA evidence for a phylogeographic barrier in the Amazonian genus Symphysodon (Teleostei: Cichlidae) J. S. READY*†, E. J. G. FERREIRA‡ AND S. O. KULLANDER* *Department ofVertebrateZoology, SwedishMuseum ofNaturalHistory, P.O. Box 50007, 10405Stockholm,Sweden and ‡Instituto Nacionalde Pesquisas da Amazoˆnia– INPA, Manaus,AM,69011-970, Brazil (Received 10February 2005,Accepted 16January 2006) Geneticrelationshipsandvariationinmeristiccounts,bodyshapeandcolourwereexaminedin alargesampleofSymphysodoncollectedfromseverallocationsinfloodplainhabitatsalongthe lengthoftheAmazonRiver.Surprisingly,mitochondrialDNAindicatesnodifferencebetween thetwohistoricallydescribedspecies,SymphysodondiscusandSymphysodonaequifasciatus,but showsthatnon-clinalvariationexistswithadistinctlineagefoundinthewesternAmazon.This lineageisconsistentwithacolourformthatisdistinctfromotherSymphysodonlineages.This formhasaparapatricdistributionandisrecognizedasadistinctspecies,Symphysodontarzoo. Adaptation to floodwater habitats supportsgenetic cohesionacross a large range preventing fine scale regional diversification of the genus. Possible explanations for the unusual set of distributionsforgeneticandcolourcharactersrelatetothehistoryoftheAmazonbasinandthe probable division of lowland species when submerged geologic arches influence surface topology. #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles Keywords:Amazon;colour;discus;geographicalvariation;mitochondrialDNA;morphology. INTRODUCTION The discus fishes, genus Symphysodon Heckel, 1840, are one of the most intrigu- ing and distinctive groups among the South American Cichlidae. At present, there are two recognized species within the genus, Symphysodon discus Heckel, 1840, and Symphysodon aequifasciatus, Pellegrin, 1904, which differ in the pat- tern of melanic bars and in some meristic characters. The first species is found in the central Amazon in the Rio Negro, Abacaxis and Trombetas drainages, while the latter is found along almost the entire length of the Amazon from 49° to 70° west longitude (Fig. 1). Species of Symphysodon are restricted to areas where seasonal flooding occurs and are therefore found only near the mainstem of the Amazon River itself and in the lower reaches of tributaries †Authortowhomcorrespondenceshouldbeaddressed.Tel.:þ46(0)851954123;fax:þ46(0)85195 4212;email:[email protected] 200 #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles DISCUS FISHES DEMONSTRATE AMAZONIAN BARRIER 201 FIG.1. GeographicaldistributionofSymphysodon(afterKullander1996,modified)andsamplelocations. on the Amazonian floodplain (Kullander, 1996). The combined distribution of the genus forms one large continuous range in which many environmental and historical factors could have been involved in isolating populations and driving speciation. Symphysodon are part of the Heroini, a Neotropical clade of cichlid fishes (Kullander, 1998; Farias et al., 2001). The exact relationship of Symphysodon within the Heroini is partially contentious, though morphological analysis apparently provides stronger support than molecular evidence, placing Symphy- sodon as sister taxon to a clade containing Heros, Uaru, Mesonauta and Ptero- phyllum (Kullander, 1998). These are all high-bodied, lowland fishes known mainly from the Amazon basin. Colour patterns on living fish vary considerably in Symphysodon. There are normally nine dark bars on the sides. These are of equal width and intensity in S. aequifasciatus, but bars 1, 5 and 9 are intensified and wider in S. discus. Although the general colour of S. aequifasciatus is brown with some blue and red markings on the forehead and near the anal fin, some individuals in all populations have brighter colours, often including greater coverage or strength of bright red and blue stripes, spots or reticulations (pers. obs.). This colour variation enhances the value of these species in the ornamental pet trade where they are highly regarded and priced. Studies of colour variation have resulted in the descriptions of several sub- species based on the purported prevalence of variants in different geographic regions and include Symphysodon a. aequifasciatus, Symphysodon a. haraldi Schultz, 1960, Symphysodon a. axelrodi Schultz, 1960, and S. discus willischwartzi Burgess, 1981. Unfortunately, descriptions are based on only a few samples, #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 202 J. S. READY ET AL. often of uncertain origin (Schultz, 1960; Burgess, 1981), and Kullander (1986; 1996; 2003) recognized only two diagnosable species, S. aequifasciatus and S. discus. The present study includes a new larger set of specimens, with both colour photos and tissue samples for DNA analysis, to determine whether variation in colour, morphology or genetics is correlated with geography or environmen- tal variation. Despite the confusion over the precise origins of colour forms obtained from ornamental fish importers, some populations are relatively easy to identify from preliminary inspection of photographs of recently collected material. For example, fish from Tefe´, in the Western Amazon, can be recog- nised by very light coloured anterior sides with red spots on the anal fin and sides of the body. Symphysodon aequifasciatus is one of very few cichlid species with an almost linear distribution along the entire lowland course of the Amazon River mainstream. The Amazon River has a dramatic history, being diverted from a Pacific out- let to a northern outlet about 67 million years ago (MYA) and finally to an Atlantic outlet about 8 MYA (Lundberg et al., 1998). Symphysodon aequifasciatus was selected to test for clinal variation in morphology and genetic characteris- tics along the Amazon River, as a possible explanation of phenotypic variation, and at the same time for possible breaks in continuity that could be correlated with hypotheses about the historical development of the Amazon River. MATERIALS AND METHODS Sampleswerecollectedatseverallocalities(Fig. 1)in1998.Specimensweredeposited in the collections of INPA, Manaus, Brazil (INPA 14334–14345, INPA 14386 and INPA 25960). Samples from further east in the overall distribution could not be ob- tained as the area is less frequently visited by discus fishermen whose assistance was required to obtain samples. Additional material examined included the type series of S. aequifasciatus from the Muse´um National d’Histoire Naturelle, Paris, France (MNHN 1902–130, MNHN 1902–134and MNHN 1902–135). Analysisof variation in- cludes molecular data (from 23 individuals), characters of colour pattern and body shape (assessed from 263 photographs of live fish) and morphological characteristics (meristics and rhomboid measures for 94 individuals). Tissuesampleswerestoredinethanolbeforepreservationofwholefishinformalin(except forRioBauanaspecimens).GenomicDNAwasextractedusingDNeasyextractionprotocols andKits(QIAGEN,throughVWRInternationalAB,Stockholm,Sweden).The sequences were then amplified using puReTaq Ready-To-Go PCR beads (Amersham Biosciences Europe,Uppsala,Sweden)andpolymerasechainreactioncyclesasfollows:1denaturation cycleat94°Cfor4min,30cycleswithadenaturationtemperatureof94°Cfor30s,anan- nealingtemperatureof54°C(forallcytochromebprimers)or62°C(forrhodopsinprimers), andextensionat72°Cfor30s,allfollowedby1extensioncycleat72°Cfor7min.Forcyto- chromeb,preliminaryamplificationusedtheprimersFISCYTB-F(59ACCACCGTTGTT ATT CAA CTA CAA GAA C 39) and TRUCCYTB-R (59 CCG ACT TCC GGA TTA CAAGACCG39),andasecondarynestedamplificationusedthesewiththeinternalprimers CYTBi3-R (59 GGG GTA AAG TTG TCT GGG TCT CC 39) and CYTB1-F (59 CGA TTCTTCGCATTCCACTTCCT39),respectively,toobtainsequencesoftwooverlap- pingfragments.AmplificationofrhodopsinusedtheprimersRodF2w(59AGCAACTTC CGCTTCGGTGAGAA39)andRodR4n(59 GGAACTGCTTGTTCATGCAGA TGTAGAT39).AllprimersarefromtheEuropeanUnionprojectFishTrace(M.Nore´n, pers. comm.). Reactions included negative controls. Sequencing was performed using the #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 DISCUS FISHES DEMONSTRATE AMAZONIAN BARRIER 203 BigDyeTerminatorcyclesequencingreadyreactionkit(AppliedBiosystemsInc.,through Applera Sweden, Stockholm, Sweden) on an automated DNA sequencer (Applied Bio- systems377)followingmanufacturer’sinstructions.Nucleotidesequencesweredeposited in GenBank under accession numbers DQ533587–DQ533606. Sequences were aligned by eye using BioEdit v. 5(cid:1)0(cid:1)9 software (Hall, 1999). Cyto- chrome b gene sequences for several genera, which are potentially close relatives of Symphysodon (Kullander, 1998), were obtained from GenBank to root the phylogenies produced. These included Acaronia sp. Myers, 1940 (AF370666) and all available se- quences for the genera of the Heroini: Pterophyllum scalare (Lichtenstein, 1823) (AF370676), Hoplarchus psittacus Kaup, 1860 (AF370673), Hypselecara coryphaenoides (Heckel, 1840) and Hypselecara temporalis (Gu¨nther, 1862) (AF370674 and AY050612, respectively), Caquetaia kraussi (Steindachner, 1878) and Caquetaia spectabilis (Steindachner, 1875) (AF009938 and AF370671, respectively), Theraps maculicauda (Regan, 1905)—now Vieja maculicauda (Regan, 1905) (U97165), Mesonauta insignis (Heckel, 1840) (AF370675), Uaru amphiacanthoides Heckel, 1840 (AF370678 and AY050622) and Heros sp. Heckel, 1840 and H. appendiculatus (Castelnau, 1855)—now Heros efasciatus Heckel, 1840 (AF370672 and AF009951). Also included was the cytochrome b sequence submitted for Symphysodon aequifasciatus (AF370677). MODELTEST software (Posada & Crandall, 1998) was used to determine the best modelofmolecularevolutionforthecytochromebsequences.Thegeneraltimereversible modelwithproportionofinvariantsites¼ 0(cid:1)5491andgammashapeof1(cid:1)4368(GTRþ I þ G) was chosen under both heirarchical likelihood test criteria and Akaike Information Criteria (AIC) and used for subsequent analysis. Phylogenetic analysis using parsimony (PAUP*) (Swofford, 1998) was used to construct trees using the sequence of Acaronia as an outgroup. Sequences were then analysed with 1000 bootstrap replicates under par- simony (options: ACCTRAN, TBR, MULTREES, Gaps ¼ missing, random addition, transition to transversion (ti/tv) weighting as estimated in MODELTEST), 100 heuristic bootstrapreplicatesusingthemaximumlikelihoodsettingdescribedunderMODELTEST and 1000 bootstrap replicates for neighbour joining (weighted least squares and parame- ters described by MODELTEST). Bayesian support was obtained using MrModeltest software (Nylander, 2002) to determine the model (also GTR þ I þ G) and MrBayes (Huelsenbeck&Ronquist,2001).Thesupportwasobtainedusing2000000MCMCiter- ations, sampling every 100 iterations with a burn in where the first 10% of trees sampled werediscarded(likelihoodvalueswerestableafterthispoint).Aconsensusoftheremain- ing trees was then obtained in PAUP* (Swofford, 1998). Six colour pattern characters and two body shape characters were classed for each photograph using the characters and character states outlined in Table I. The eight characters were each classed into at most five states, with the first state being the most common in the outgroup (Table I). Morphological distance measurements were made using digital callipers accurate to 0(cid:1)01 mm. Methods for taking meristic counts follow Kullander (1983; 1986). Measure- ments and counts were made on the left side of the specimen when possible. Specimen lengths are standard length (SL). Vertebrae, pterygiophore, fin spine and soft ray counts and the measurement of SL were taken from radiographs made on Kodak X-Omat V plates, with a Philips MGC 30 low voltage X-ray unit. Distances between landmarkpointsonspecimens weredeterminedfromradiographsusingadoublerhom- boid system (Fig. 2). Statistical analyses and graphs were made using the SYSTAT package (Wilkinson et al., 1992). Log transformations of body distances relative to SL, square root trans- formedmeristiccountsandrawdataforclassedcharacterswereusedincorrelationand principal component analyses (PCA). RESULTS The aligned mitochondrial cytochome b gene sequence was 1134 bp long, and thenuclear rhodopsin partial sequence obtained was 514 bp long. Rhodopsin sequences showed no variation within Symphysodon. A blast search of sequences #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 204 J. S. READY ET AL. TABLE I. Coding of characters used for analysis of shape and colour in Symphysodon. State 1 is most common character states in photographs of related taxa (Heros, Mesonauta, Uaru) Character State 1 State 2 State 3 State 4 State 5 1 Analfin Absent Little Medium Much redcolour 2 Continuation Absent Slight Extended of colourfrom analfinto body 3 Analfin None Redspots Thin redlines Thick red Thick redlines pattern orsmall onbluebase lines on reticulating streaks on (linesthinner bluebase over blue bluebase thanbase) (lines and base basecolour equalwidth) 4 Forehead Flat Slightly Mainly Completely shape slope rounded rounded rounded 5 Bodybase Light Brown Green/brown Grey green colour brown 6 Forehead Absent Few blue Moderate Many blue marking stripes numberof stripes bluestripes continuing to dorsalfin 7 Bodyshape Elongate Intermediate Discoid 8 Redspots Absent Present onbody in GenBank indicated that Symphysodon sequences were most similar to rho- dopsin sequences of African cichlids. No Neotropical cichlid rhodopsin sequen- ces were found in GenBank. Unambiguous alignment of the deduced amino acid sequence in Symphysodon with sequences from GenBank confirmed the sin- gle open reading frame. Analysis of mitochondrial DNA (mt DNA) (cytochrome b gene) indicates distinct lineages of Symphysodon that do not conform to previous taxonomic classifications (Fig. 3). One lineage comprises western populations that under the existing classifica- tion would have been identified as S. aequifasciatus. However, a second large lineage included not only sequences from central and eastern populations con- forming to S. aequifasciatus but also sequences of S. discus from Manaus and the Rio Abacaxis. There is one notable exception. An individual from the Madeira River, which is central in the geographical distribution of samples, possesses both the phenotype and the mtDNA haplotype typical of western populations. Additionally, a far eastern genetic lineage may also exist from which only two samples were collected, Boı´m samples 2 and 3. However, their divergence from the central and the eastern lineage of Symphysodon aequifasciatus is small. When compared with those of published Maximum Likelihood-based trees of mitochondrial sequences including African rift lake cichlids (Farias et al., 2001; #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 DISCUS FISHES DEMONSTRATE AMAZONIAN BARRIER 205 FIG.2. RhomboidmeasurementsofshapeinSymphysodon.R1–R6andSL. Klett & Meyer, 2002) the branch lengths between Symphysodon species (0(cid:1)02 substitutions/site, Fig. 3) are comparable in some cases to branch lengths between genera of rift lake cichlids. The resolution of the position of Symphysodon within the Heroini is weak. This is not surprising as many of the sequences used are those obtained from previous investigations (Farias et al., 2001). Principal Component Analysis (PCA) of colour pattern and body shape pla- ces specimens from the same population in the same cluster, but with many populations the overall pattern becomes ambiguous. Groups of specimens defined by environmental differences between sites, or by sex, did not lead to any distinct clusters in the PCA. However, when specimens were classified by region (western v. central/eastern groups), two weakly overlapping groups ap- peared in the PCA (Fig. 4). A re-examination of photographs of four individ- uals from the central/eastern group that lie within or close to the western group show that these individual fish possess the red spots typical for fish in the west- ern group, even though these four fish were collected from a central population dominated by fish lacking red spots. The main western and central/eastern groupings in Fig. 4 were largely defined by Factor 1 that had high loadings for the presence or the absence of red spots and for anal fin red colouration. Even under very close inspection, darker bodied fish from central and eastern populations always lack red-pigmented spots on the anal fin and body and re- mains distinct from western fish. Two sub-groups appear to be present in the central/eastern cluster, though the current data do not support the recognition of a far eastern Boı´m genetic lineage. #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 206 J. S. READY ET AL. FIG.3. MaximumLikelihoodphylogramofSymphysodonsequences(includingGenBanksequenceofS. aequifasctiatus)andoutgrouptaxa.Supportvalues:Abovelineleftindicatespercentsupportfrom 1000parsimonybootstrapreplicates;abovelinerightindicatesBayesianposteriorprobabilityasper cent;belowlineleftindicatespercentsupportfrom1000NeighbourJoiningbootstrapreplicates; below line right indicates per cent support from 100 Maximum Likelihood bootstrap replicates. ConsistencyIndex(CI),0(cid:1)4637;RetentionIndex(RI),0(cid:1)5363andRescaledConsistencyIndex(RC), 0(cid:1)34forconsensusparsimonytree. PCA of morphology (meristic counts and rhomboid measurements) on all populations indicated no clear population groupings. Within-population varia- tion is greater than between-population variation. #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 DISCUS FISHES DEMONSTRATE AMAZONIAN BARRIER 207 FIG.4. PCAforgeographicvariationinthecolourpatternandbodyshapeofSymphysodon.Factor1is determinedbyacombinationofcharacters‘Analfinpattern’‘Presenceofredspots’and‘Analfin red colour’ while Factor 2 is determined by the combination of characters ‘Forehead markings’ ‘Bodycolour’and‘Continuationofanalfinpatternontothebody’.Factors1and2accountfor 57(cid:1)3%ofallvarianceintheanalysis(32(cid:1)3%and24(cid:1)0%,respectively).Specimenshavebeenassigned towesternphenotype(indicatesS.tarzoo)andcentral/easternphenotype(indicatesS.aequifasciatus). WPcentralindicatesfishwithwesternphenotypefromtheMadeiraRiver(filledcircles). DISCUSSION The analysis of mitochondrial DNA haplotypes, colour pattern and mor- phology indicates that the western Amazonian Symphysodon are a distinct spe- cies. This is supported by the distinct mitochondrial lineage and by the diagnostic phenotypic character of red spots on the sides of the body. Schultz (1960) described several sub-species of S. aequifasciatus based on the colour slides of individuals obtained through the ornamental fish industry. Among those, S. a. haraldi, is described from Benjamin Constant in the Western Amazon. However, this locality is unlikely to be correct as the specimen illus- trated and described has a colour pattern conforming to eastern populations. The type series of S. aequifasciatus includes specimens from Tefe´ (MNHN 1902–134 and 1902–135) and Santare´m (MNHN 1902–130) that would represent the distribution of the western and eastern species, respectively. No attempts were made to extract DNA from these specimens, and the live colour patterns of preserved specimens could not be determined. Therefore, MNHN 1902–130 from Santare´m is selected as lectotype of S. aequifasciatus, thus restricting the name to the central-eastern species. The specimen is 107 mm SL and has the following meristic data: Dorsal fin, IX.31; anal fin, XIII.30; vertebrae, 13 abdominal, 18 caudal; scales,56 on row E1, 20 in anterior lateral line, 14 in pos- terior lateral line. Symphysodon aequifasciatus is distinguished from S. discus by having a melanic colour pattern of lateral bars of equal intensity and width. Symphysodon aequifasciatus does not possess distinct red spots on the anal fin and body, although it may have red reticulated pigmentation primarily on the anal fin. Symphysodon haraldi and S. axelrodi are synonyms of this species. The western species is S. tarzoo Lyons, 1959, that was described as having distinct red spots on its anal fin and body. The description was based on live #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 208 J. S. READY ET AL. aquarium specimens from Leticia, Colombia, and no type specimens were apparently preserved (Kullander, 1996; 2003). The availability of the name tar- zoowasrejectedby Schultz(1960) basedonthesupposedabsenceofadiagnosis in Lyons (1959). However, several statements in the latter study clearly describe the new species. Kullander (1996) discusses the availability of names for Sym- physodon species and recognized that the epithet tarzoo was available under the International Code of Zoological Nomeclature. Because of the nomenclatural and taxonomic problems in Symphysodon, a neotype for S. tarzoo was selected. INPA 25960 from Brazil, Est. Amazonas, Rio Jutaı´. 1998, S.O. Kullander and E.F.J.G. Ferreira. It is an adult male of 132(cid:1)4 mm SL and has the following meristic data: Dorsal fin, X.30; anal fin, XIII.31; vertebrae, 14 abdominal, 17 caudal; scales, 58 on row E1, 20 in anterior lateral line, 14 in posterior lateral line. The red spots on the anal fin and in the body distinguishes S. tarzoo from all other Symphysodon species that have reticulations. Symphysodon aequifasciatus and S. tarzoo overlap in distribution slightly as shown by individuals from the Madeira River that are phenotypically and genetically S. tarzoo. Traditional morphometric characters do not easily distinguish species, although average lateral line scale counts and melanic pigmentation still distin- guish S. discus and S. aequifasciatus (Kullander, 1996). However, the mtDNA sequence shared between S. discus and S. aequifasciatus from the eastern and the central part of the distribution of the genus must be explained. This appears to be the only case of a Neotropical cichlid genus with a distri- bution that, although marked and extensive, is limited to lowland Amazonian habitats and that includes a geographic boundary thought to restrict an endemic species to the western lowland region. The Amazon historically flowed in the opposite direction from east to west. Evidence documenting this change is summarized by Lundberg et al. (1998). The current distribution of Symphysodon probably developed due to the changes in drainage pattern caused by tectonic processes. Species of Symphyso- don are restricted to areas experiencing floods, and it is likely that their unusual body shape is an adaptation to this biotope. Under the proposed history of Lundberg et al. (1998), large-scale flood habitats [e.g. Lago Santa Lucı´a (60– 42 MYA), Lago Pozo (43–30 MYA) and Lago Pebas (20–11(cid:1)8 MYA)] occurred first in western regions of present day Amazonia, caused by the initial uplift of the Andes and the diversion of drainages to the north. Such habitats would have extended eastward when the northern drainage route was cut off and when the Amazon began to drain eastwards into the Atlantic as it does now. Given the sample locations, the ranges of S. aequifasciatus and S. tarzoo are roughly divided by the Purus arch (located between Manaus and Rio Bauana in Fig. 1) with only a few S. tarzoo specimens from the Madeira river down- stream of the arch, and no S. aequifasciatus specimens from locations upstream of the arch. This arch was formed during one of the last phases of Andean uplift (C. 3 MYA) and was probably breached when the Amazon changed direction (Lundberg et al., 1998). Arguably, these subterranean arches may have affected organisms in the Amazonian floodplain (Lougheed et al., 1999), although the extent of its influence on surface topology at that time can- not be known. Two scenarios have been suggested: 1) the arch may have forced #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211 DISCUS FISHES DEMONSTRATE AMAZONIAN BARRIER 209 the overlying sediments to form a temporary barrier that isolated ancestral populations of S. tarzoo from other Symphysodon that subsequently have come into secondary contact, 2) alternatively, arch dynamics may have led to a nar- rowing of the floodplain that reduced gene flow enough to allow divergence between upstream and downstream forms. This latter scenario is embodied in a parapatric model of divergence between S. tarzoo and other Symphysodon species. The latter case is supported by geological analyses of the Amazon River today, which showed that where the river flows over arches, such as the Purus arch, water flow becomes slow and entrenched. The valley narrows to <20 km compared to an average breadth of nearly 45 km, the water-surface gradient decreases, sediment is deposited and water flow through the channel is negligible (Mertes et al., 1996). The shared mtDNA sequences of S. discus and S. aequifasciatus and the lack of any variation among rhodpsin sequences supports at least two possible ex- planations for the observed phenotypic variation. 1) Branch lengths in the phy- logram (Fig. 3) are consistent with an ancient divergence between upper (above Purus arch) and lower (below Purus arch) Amazonian fishes, and a divergence between the two species in the lower Amazon that is so recent that mtDNA dif- ferences between these species could not be found. 2) The genomes of all three species have diverged significantly, but the similarity of the mtDNA of S. aequi- fasciatus and S. discus results from introgressive hybridization. Under this sce- nario, the observed mtDNA sequence probably originally belonged to S. aequifasciatus because of the smaller number of sequences obtained for S. discus. However, it also possible that an mtDNA sweep may have occurred if there is any bias in the direction of crosses,e.g., duetoHaldane’s rule.As such,the pos- sibility of the sequences having orginated from S. discus should not be ruled out. The distribution of Symphysodon is unusual in consisting of a very large tran- sect across equatorial lowland South America. The habitat consists of major river channels, tributaries and the associated flooded forest, across which con- tinuity should be sufficiently high to maintain gene flow between populations. This adaptation to a narrow ecological niche and the absence of competition from sympatric species may explain why morphology is so relatively constant over such a large range. The different colour forms that have evolved may indi- cate that mate choice plays a role in the evolution of Symphysodon. The importance of colour vision and the light spectrum in water have been used to explain differentiation through, and subsequent breakdown of, the reproductive isolation between colour forms of African lake cichlids (Seehausen et al., 1997), and colour pattern has been shown to be important for species identity in South American cichlids (Ready et al., 2006). Discus fishes breed in flooded forests, therefore, the different light conditions produced by black- water, whitewater and clearwater flooded forest habitats (Furch & Junk, 1997) could provide a mechanism for differentiation of populations. Symphysodon tar- zoo and S. aequifasciatus distributions are generally consistent with the distribu- tion of whitewater and clearwater tributaries of the Amazon, while the distribution of S. discus is generally consistent with the distribution of blackwa- ter tributaries. Water colour is influenced by the geographical origins of the water, with whitewater originating from the Andes, clearwater from the south banktributaries (Brazilianshield)andblackwater from thenorth bank tributaries #2006TheAuthors Journalcompilation#2006TheFisheriesSocietyoftheBritishIsles,JournalofFishBiology2006,69(SupplementB),200–211