loading

Logout succeed

Logout succeed. See you again!

ebook img

Diversity and abundance of ammonia-oxidizing archaea in hydrothermal vent chim PDF

pages13 Pages
release year2009
file size0.77 MB
languageEnglish

Preview Diversity and abundance of ammonia-oxidizing archaea in hydrothermal vent chim

AEM Accepts, published online ahead of print on 24 April 2009 Appl. Environ. Microbiol. doi:10.1128/AEM.01761-08 Copyright © 2009, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 Section: Microbial Ecology/Geomicrobiology 2 Title: Diversity and abundance of ammonia-oxidizing archaea in hydrothermal vent 3 chimneys, Juan de Fuca Ridge 4 Running title: Ammonia-oxidizing archaea in hydrothermal vent chimneys 5 Authors: Shufang Wang1, 2, Xiang Xiao2, 3, Lijing Jiang2, Xiaotong Peng4, Huaiyang D o w 6 Zhou4, Jun Meng2, Fengping Wang2, 3* n lo a 7 Ocean University of China, Qingdao, 266003, P. R. China1; Key Laboratory of de d f r 8 Marine Biogenetic Resources, Third Institute of Oceanography, State Oceanic o m h 9 Administration, Xiamen, 361005, P. R. China2; School of Life Sciences and tt p : / / 10 Biotechnology, Shanghai Jiaotong University, Shanghai, 200240, P.R.China3; ae m . a 11 Department of Marine and Earth Sciences, Tongji University, Shanghai, 200092, P. R. s m . 12 China4 or g / o 13 Corresponding author:Fengping Wang2, 3* n J a n 14 Tel : +86 (592) 2195349 u a r y 15 Fax: +86 (592) 2085376 1 0 , 2 16 E-mail : [email protected] 0 1 9 b y g u e s t 17 Abstract 18 The abundance and diversity of archaeal ammonia monooxygenase subunit A 19 (amoA) genes from hydrothermal vent chimneys at the Juan de Fuca Ridge were 20 investigated. Majority of the retrieved archaeal amoA sequences had sequence 21 identities of less than 95% with those in the GenBank. Novel ammonia-oxidizing D o w 22 archaea may exist in the hydrothermal vent environments. n lo a d e d f r o m h t t p : / / a e m . a s m . o r g / o n J a n u a r y 1 0 , 2 0 1 9 b y g u e s t 2 23 Ammonia-oxidizing archaea (AOA) may play important roles in carbon and 24 nitrogen cycles in various temperate environments (5, 7, 10, 12, 16). The frequent 25 detection (23, 24) and successful enrichment (2, 6) of thermophilic AOA from 26 terrestrial hot springs suggested the wide distribution of thermophilic AOA in 27 geothermal environments. High concentrations of NH4+ (1, 9, 11) and high rates of D o w 28 ammonia oxidation (9, 22) have been observed at the Juan de Fuca Ridge (JDFR). n lo a d 29 However, AOA have not been reported in this deep-sea hydrothermal system. Here, e d f r 30 the abundance and diversity of AOA in three hydrothermal vent chimneys in the o m h 31 Endeavour segment of JDFR were investigated by targeting the conserved amoA tt p : / / a 32 genes. This is also the first report on AOA from deep-sea hydrothermal vent e m . a 33 chimneys. s m . o 34 These vent chimneys were sulfide structures obtained in the fall of 2005 using r g / o 35 the submersible Alvin on board the R/V Atlantis (dive numbers: 4143, 4136 and n J a n 36 4148). Chimney 4148 was an active black smoker venting at around 310°C in the u a r y 37 Main Endeavour field (47°56.876′N, 129°5.915′W; depth = 2192 m). Chimney 1 0 , 2 38 4143-1 was an active black smoker venting at 316°C in the Mothra field (47°55.424′N, 0 1 9 39 129°6.533′W; depth = 2267 m). The out layers (4148-1A and 4143-1A, respectively) b y g u 40 of these chimneys were used in this study. Chimney 4136-1 was from a diffusive field e s t 41 (Clambed field; 47°57.909′N, 129°5.443′W; depth = 2200 m), where in-situ 42 temperature was measured as 29.2°C. The chimney samples were stored at -20°C on 43 board, transported to the home laboratory on dry ice, and stored at -80°C until 44 analyses were performed. 3 45 Chimney samples were frozen in liquid nitrogen and milled upon thawing. This 46 procedure was repeated three times to break down the solid sample into small 47 particles, which were then mixed with DNA extraction buffer for DNA isolation as 48 described before (25). The obtained crude DNA was purified by an E.Z.N.A.® cycle 49 pure kit (Omega Ltd., Norcross, GA, USA). PCR amplifications for the archaeal 16S D o w 50 rRNA gene, the crenarchaeal marine group I (MGI) 16S rRNA gene, the archaeal n lo a d 51 amoA gene, and the bacterial amoA gene followed procedures as previously described e d f r 52 (Table 1; 3, 5, 10, 14). Quantitative (Q) PCR was performed using a 7500 Real-time o m h 53 System (Applied Biosystems, UK) in a 20-µl reaction mixture that consisted of 1 µl tt p : / / 54 (1-10 ng) of DNA as template, 0.15 µM of each primer, and 10 µl of Power SYBR® ae m . a 55 Green PCR Master Mix (Applied Biosystems, UK) with ROX and SybrGreen I. The s m . o 56 inserted PCR fregments of clone 4143-1A-71 (from amoA gene library) and 4136-1-4 r g / o 57 (from archaeal 16S rRNA gene library) were amplified and purified to generate n J a n 58 standard DNAs for amoA or archaeal 16S rRNA gene quantification. A serial dilution u a r y 59 of standard DNAs was performed to generate calibration curves for sample 1 0 , 2 60 quantification. A melting curve analysis was performed after amplification and the 0 1 9 61 cycle threshold was set automatically using the 7500 system software, version 1.3. b y g u 62 Triplicate PCR products were pooled and clone libraries were constructed e s t 63 following manufacturer’s instructions (Takara Inc., Dalian, China). PCR clones from 64 the libraries were randomly selected for sequencing (Sangon Inc., China). 65 Phylogenetic trees were generated with phylip package (4) using methods of 66 Maximum-likelihood, Neighbor-Joining and Maximum Parsimony. Bootstrap analysis 4 67 was used to estimate the reliability of phylogenetic tree constructions (200 replicates). 68 Trees were created using the program Treeview (version 1.6.6). 69 Positive and specific PCR bands were obtained for the archaeal amoA genes 70 from all the three samples, while no PCR band was obtained for the bacterial amoA 71 gene (Primers and procedures used see Table 1). In addition, sample 4136-1 was D o w 72 found to contain the highest number of archaeal-amoA gene with 7.36±0.37×104 n lo a 73 copies per g of chimney, followed by 4143-1A with 1.88±0.08×104 copies per g, and de d f 74 4148-1A with 1.37±0.07×102 copies per g of chimney by Q-PCR analysis. ro m h 75 Clone libraries of archaeal amoA from the three samples were constructed. A tt p : / / a 76 total of 93 clones (33 from 4136-1, 30 from 4143-1A, and 30 from 4148-1A) were e m . a 77 sequenced and could be divided into 33 OTUs based on 99% nucleotide identity. The s m . o 78 majority (81.7%) of the retrieved archaeal amoA OTU sequences had relatively low r g / o 79 sequence identity (≤ 94.56%) with other archaeal amoA sequences deposited in the n J a n 80 GenBank. The Phylogenetic relationships among the retrieved amoA and some u a r y 81 published amoA sequences are shown in Fig. 1. The chimney archaeal amoA 1 0 , 2 82 sequences fell into five clusters (Chimney Group I, Chimney Group II, sediment A-1, 0 1 9 83 water column A and B clusters) except clone 4143-1A-10, which did not fall into any b y g u 84 cluster and had the highest identity (90%) with clone HB_B_0805A06 derived from e s t 85 coastal sediment (18). Chimney Group I contained 52 sequences (30 from 4148-1A, 86 11 from 4143-1A, and 11 from 4136-1); Chimney Group II contained 23 sequences 87 (20 from 4136-1 and 3 from 4143-1A). Fourteen sequences from 4143-1A fell into 88 water column A and B clusters (5); and one sequence from 4143-1A fell in sediment 5 89 A-1 cluster (13). The sequences from Chimney Group I had highest identity (94%) 90 with clone CR-G3N006, derived from a cold seep of Japan Sea (13). Sequences in 91 Chimney Group II had the highest identity with clone OA-MA-122 from a water 92 column of a coastal aquarium biofilter with 84% nucleotide identity (21). The 93 sequences of Chimney Group II did not cluster with any other sequences. Although D o w 94 having low bootstrap values (<50%), the Chimney Group II sequences always n lo a d 95 clustered into a separate group (Fig. 1) using different calculation methods including e d f r 96 Maximum-likelihood, Neighbor-Joining, and Maximum Parsimony. o m h 97 Sample 4136-1 contained the highest number of archaeal amoA gene copies. Q- tt p : / / 98 PCR using primers 344F and 518R (15) showed that 4136-1 contained 1.10±0.05×106 ae m . a 99 copies archaeal 16S rRNA genes per g of chimney. Assuming that each crenarchaeal s m . o 100 cell possesses only one copy of the amoA gene (8), the AOA constituted at least 6.1% r g / o 101 of the archaeal community in 4136-1. To explore the potential sources of these amoA n J a n 102 sequences in 4136-1,an archaeal 16S rRNA clone library was constructed and a total u a r y 103 of 82 clones were sequenced. These sequences could be divided into 20 OTUs based 1 0 , 2 104 on 98% nucleotide identity. Fifteen OTUs (accounting 76.8% of the total sequences) 0 1 9 105 belonged to hyperthermophilic Desulfurococcales and two OTUs (accounting 15.9% b y g u 106 of total sequences) belonged to hyperthermophilic Thermoproteales, of e s t 107 Crenarchaeota. While three OTUs (accounting 7.32% of total sequences) belonged to 108 Thermococcales of Euyarchaeota (Fig. 2). MGI crenarchaeota, which were thought as 109 the source of nonthermophilic AOA (6, 8), were not detected in this library. Therefore, 110 PCR using MGI specific primers was performed to further detect MGI (PCR primers 6 111 and conditions see Table 1, 14). MGI was easily detected in 4143-1A, but not in 112 4136-1 and 4148-1A by direct PCR amplification. A nested PCR method with generic 113 archaeal 16S rRNA gene primers was then performed for the first round of PCR 114 followed by MGI-selective PCR primers for the second round of PCR. This procedure 115 created a PCR band of the correct size for MGI from 4136-1, and later proved to be D o w 116 MGI 16S rRNA gene fragment by cloning and sequencing (see Supplementary Fig. n lo a d 117 S1). The data implied that some of the amoA genes detected in the chimney samples e d f r 118 may come from MGI; however, to determine the origin of the amoA genes, especially o m h 119 those in the Chimney Groups I and II, isolation or enrichment of the organisms are tt p : / / a 120 needed. e m . a 121 Nucleotide sequence accession numbers. s m . o 122 Different phylotypes of archaeal 16S rRNA, MGI 16S rRNA, and archaeal amoA r g / o 123 gene sequences reported in this study have been deposited in the GenBank. Accession n J a n 124 numbers are EU427996-EU428005, FJ461663-FJ461672 for the archaeal 16S rRNA u a r y 125 gene; FJ906778-906787 for MGI 16S rRNA gene and EU427937-EU427995, 1 0 , 2 126 EU864272-EU864305 for archaeal amoA gene. 0 1 9 127 The authors thank the crews of R/V Atlantis/Alvin for their help in collecting the b y g u 128 chimney samples. We also thank Dr Chuanlun Zhang from University of Georgia for e s t 129 his help in editing the paper. This work was supported by the Natural Science 130 Foundation of China (NSFC grant 40532011, 40625016); COMRA grant 131 (DYLY0202-01); and the National High-Tech Program (2007AA091904). 7 132 References: 133 1. Cowen, J. P., M. A. Bertram, E. T. Baker, R. A. Feely, G. J. Massoth, and M. Summit. 134 1998. Geomicrobial transformation of manganese in Gorda Ridge event plumes. Deep-Sea 135 Res II 45:2713-2737. 136 2. de la Torre, J. R., C. B. Walker, A. E. Ingalls, M. Konneke, and D. A. Stahl. 2008. 137 Cultivation of a thermophilic ammonia oxidizing archaeon synthesizing crenarchaeol. Environ 138 Microbiol 10:810-818. 139 3. DeLong, E. F. 1992. Archaea in coastal marine environments. Proc Natl Acad Sci U S A D 140 89:5685-9. o 141 4. Felsenstein, J. 2002. Phylip, phylogeny inference package, version 3.6a3. July 2002. w n 142 Department of Genome Sciences, University of Washington, Seattle. lo a 143 5. Francis, C. A., K. J. Roberts, J. M. Beman, A. E. Santoro, and B. B. Oakley. 2005. d e 144 Ubiquity and diversity of ammonia-oxidizing archaea in water columns and sediments of the d 145 ocean. Proc Natl Acad Sci U S A 102:14683-14688. fr o 146 6. Hatzenpichler, R., E. V. Lebedeva, E. Spieck, K. Stoecker, A. Richter, H. Daims, and M. m 147 Wagner. 2008. A moderately thermophilic ammonia-oxidizing crenarchaeote from a hot h t t 148 spring. Proc Natl Acad Sci U S A 105:2134-2139. p : / 149 7. He, J. Z., J. P. Shen, L. M. Zhang, Y. G. Zhu, Y. M. Zheng, M. G. Xu, and H. Di. 2007. /a e 150 Quantitative analyses of the abundance and composition of ammonia-oxidizing bacteria and m 151 ammonia-oxidizing archaea of a Chinese upland red soil under long-term fertilization .a s 152 practices. Environ Microbiol 9:2364-2374. m 153 8. Ko¨nneke, M., A. E. Bernhard, J. R. de la Torre, C. B. Walker, J. B. Waterbury, and D. A. .o r 154 Stahl. 2005. Isolation of an autotrophic ammonia-oxidizing marine archaeon. Nature g / 155 437:543-546. o n 156 9. Lam, P., J. P. Cowen, and R. D. Jones. 2004. Autotrophic ammonia oxidation in a deep-sea J a 157 hydrothermal plume. Fems Microbiology Ecology 47:191-206. n u 158 10. Leininger, S., T. Urich, M. Schloter, L. Schwark, J. Qi, G. W. Nicol, J. I. Prosser, S. C. a r 159 Schuster, and C. Schleper. 2006. Archaea predominate among ammonia-oxidizing y 1 160 prokaryotes in soils. Nature 442:806-809. 0 , 161 11. Lilley, M. D., D. A. Butterfield, E. J. Olson, J. E. Lupton, S. A. Macko, and R. E. Mcduff. 2 0 162 1993. Anomalous CH4 and NH4+concentrations at an unsedimented mid-ocean-ridge 1 9 163 hydrothermal system. Nature 364:45-47. b 164 12. Mincer, T. J., M. J. Church, L. T. Taylor, C. Preston, D. M. Karl, and E. F. DeLong. 2007. y g 165 Quantitative distribution of presumptive archaeal and bacterial nitrifiers in Monterey Bay and u e 166 the North Pacific Subtropical Gyre. Environ Microbiol 9:1162-1175. s t 167 13. Nakagawa, T., K. Mori, C. Kato, R. Takahashi, and T. Tokuyama. 2007. Distribution of 168 cold-adapted ammonia-oxidizing microorganisms in the deep-ocean of the northeastern Japan 169 Sea. Microbes and Environments 22:365-372. 170 14. Ochsenreiter, T., D. Selezi, A. Quaiser, L. Bonch-Osmolovskaya, and C. Schleper. 2003. 171 Diversity and abundance of Crenarchaeota in terrestrial habitats studied by 16S RNA surveys 172 and real time PCR. Environ Microbiol 5:787-797. 173 15. Øvreås, L., S. Jensen, F. L. Daae, and V. Torsvik. 1998. Microbial community changes in a 174 perturbed agricultural soil investigated by molecular and physiological approaches. Appl 8 175 Environ Microbiol 64:2739-2742. 176 16. Park, H. D., G. F. Wells, H. Bae, C. S. Criddle, and C. A. Francis. 2006. Occurrence of 177 ammonia-oxidizing archaea in wastewater treatment plant bioreactors. Appl Environ 178 Microbiol 72:5643-5647. 179 17. Rotthauwe, J. H., K. P. Witzel, and W. Liesack. 1997. The ammonia monooxygenase 180 structural gene amoA as a functional marker: molecular fine-scale analysis of natural 181 ammonia-oxidizing populations. Appl Environ Microbiol 63:4704-4712. 182 18. Santoro, A. E., C. A. Francis, N. R. de Sieyes, and A. B. Boehm. 2008. Shifts in the relative 183 abundance of ammonia-oxidizing bacteria and archaea across physicochemical gradients in a D 184 subterranean estuary. Environ Microbiol 10:1068-1079. o 185 19. Stephen, J. R., G. A. Kowalchuk, M. A. V. Bruns, A. E. McCaig, C. J. Phillips, T. M. w n 186 Embley, and J. I. Prosser. 1998. Analysis of beta-subgroup proteobacterial ammonia oxidizer lo a 187 populations in soil by denaturing gradient gel electrophoresis analysis and hierarchical d e 188 phylogenetic probing. Appl Environ Microbiol 64:2958-2965. d 189 20. Treusch, A. H., S. Leininger, A. Kletzin, S. C. Schuster, H. P. Klenk, and C. Schleper. fr o 190 2005. Novel genes for nitrite reductase and Amo-related proteins indicate a role of m 191 uncultivated mesophilic crenarchaeota in nitrogen cycling. Environ Microbiol 7:1985-1995. h t t 192 21. Urakawa, H., Y. Tajima, Y. Numata, and S. Tsuneda. 2008. Low temperature decreases the p : / 193 phylogenetic diversity of ammonia-oxidizing archaea and bacteria in aquarium biofiltration /a e 194 systems. Appl Environ Microbiol 74:894-900. m 195 22. Ward, B. B., and O. C. Zafiriou. 1988. Nitrification and nitric oxide in the oxygen minimum .a s 196 of the wastern tropical North Pacific. Deep-Sea Res 35:1127-1142. m 197 23. Weidler, G. W., M. Dornmayr-Pfaffenhuemer, F. W. Gerbl, W. Heinen, and H. .o r 198 Stan-Lotter. 2007. Communities of archaea and bacteria in a subsurface radioactive thermal g / 199 spring in the Austrian Central Alps, and evidence of ammonia-oxidizing Crenarchaeota. Appl o n 200 Environ Microbiol 73:259-270. J a 201 24. Zhang, C. L., Q. Ye, Z. Huang, W. Li, J. Chen, Z. Song, W. Zhao, C. Bagwell, W. P. n u 202 Inskeep, C. Ross, L. Gao, J. Wiegel, C. S. Romanek, E. L. Shock, and B. P. Hedlund. a r 203 2008. Global occurrence of archaeal amoA genes in terrestrial hot springs. Appl Environ y 1 204 Microbiol 74:6417-6426. 0 , 205 25. Zhou, J., M. A. Bruns, and J. M. Tiedje. 1996. DNA recovery from soils of diverse 2 0 206 composition. Appl Environ Microbiol 62:316-322. 1 9 207 b y g u e s t 9 D o w n lo a d e 208 Table1 PCR primers and procedures used in this study d f r Target gene Primer set Sequences (5′- 3′) PCR cycle conditions Reference o Arch-amoAF STAATGGTCTGGCTTAGACG 5 min 95°C; 30 cycles consisting of 45 s 94°C, Francis et al. m archaeal amoA Arch-amoAR GCGGCCATCCATCTGTATGT 1min 53°C, and 1 min 72°C; and 15min 72°C (2005) (5) h 21F TTCCGGTTGATCCYGCCRG 5 min 95°C; 30 cycles consisting of 30 s 94°C, DeLong et al. tt Archaeal 16S rRNA p 958R YCCGGCGTTGAMTCCAATT 1min 54°C, and 1min 72°C; and 10min 72°C (1992) (3) : / 344F ACGGGGCGCAGCAGGCGCGA 10 min 50°C, 2 min 95°C; 40 cycles consisting /a Archaeal 16S rRNA of 15 s 95°C, 1min 60°C.Then 15 s 95°C, 1min Øvreås et e (for Q-PCR) 518R ATTACCGCGGCTGCTGG al.(1998) (15) m 60°C and 15 s 95°C to make melting curve. . amo196F GGWGTKCCRGGRACWGCMAC 10 min 50°C, 2 min 95°C; 40 cycles consisting a archaeal amoA Treusch et al. s of 15 s 95°C, 1min 60°C.Then 15 s 95°C, 1min m (for Q-PCR) amo277R CRATGAAGTCRTAHGGRTADCC (2005) (20) 60°C and 15 s 95°C to make melting curve. . o Stephen et r AmoA-1F GGGGTTTCTACTGGTGGT g 5 min 95°C; 30 cycles consisting of 30 s 94°C, al.(1998) (19) / Bacterial amoA 45 sec 54°C-50°C, and 45sec 72°C; and 10min 72°C Rotthauwe et o AmoA-2R CCCCTCKGSAAAGCCTTCTTC n al.(1997) (17) J Crenarchaeal marine 771F ACGGTGAGGGATGAAAGCT 5 min 95°C; 30 cycles consisting of 30 s 95°C, Ochsenreiter et a group I 16S rRNA 957R CGGCGTTGACTCCAATTG 30 s 54°C, 30 s 72°C al. (2003) (14) n u a r y 1 0 , 2 0 1 9 b 10 y g u e s t

See more

The list of books you might like