Logout succeed
Logout succeed. See you again!

DNA, recombination, interactions, and repair : proceedings of the FEBS Symposium on DNA, Liblice, 1979 PDF
Preview DNA, recombination, interactions, and repair : proceedings of the FEBS Symposium on DNA, Liblice, 1979
FederaotfEi uorno peBaino chemSioccaile ties (FEBvSo)l umpeusb libsyhP eedr gamPorne ss Proceedionftg hse 1 1thF EBSM eeting RegulatMoercyh anisomfCs a rbohydrate Metabolism Volume4 2 GeneE xpression Volume4 3 BiochemiAcsaple cotfsN ewP roteFiono d Volume4 4 MembranPer oteins Volume4 5 RegulatoifFo ant tAyc iadn dG lycerolMieptiadb olism Volume4 6 Regulatory PrEontzeyomleyastn idtc h eiIrn hibitors Volume4 7 GrowtFha ctors Volume4 8 FunctioofnA sl ternaTteirvmei nal Oxidases Volume4 9 Albumi-Snt ructuBrieo,s ynthFeusnicst,i on Volume5 0 Proceedionftg hse 1 2thF EBSM eeting GeneF unction Volume5 1 ProteSitnr:u ctuFruen,c tiaonndI ndustArpipalli cations Volume5 2 ProcessainndTg u rnovoefPr r oteainndsO rganelilnte hse C ell Volume5 3 CyclNiucc leotainddeP sr otePihno sphorylianCt eiolRnle gulation Volume5 4 RegulatoifSo enc ondaPrryo duacntd P lanHto rmonMee tabolism Volume5 5 MolecuDliasre ases Volume5 6 AntimetaboilnBi itoecsh emisBtiroyl,oa gnyd M edicine Volume5 7 TrendisnE nzymoloPgryo:c eedionftg hse F EBSS peciMaele tinogn Enzymes 60 EnzymRee gulatainodMn e chaniosfmA ction Volume IndustarnidaC ll iniEcnazly mology Volume6 1 Forf urthdeert aipllse aswer itteoy ounre arePsetr gamoonffi ce. DNA - RECOMBINATION INTERACTIONASN D REPAIR Proceedionfgt sh eF EBSS ymposiuomn D NA Libli1c9e7,9 Editors S.Z ADRAZIL J.S PONAR PERGAMONP RESS OXFORD NEW YORK TORONTO SYDNEY · PARIS FRANKFURT · · · · U.K. PergamoPnr esLst .d. H eadingtHoinlH la ll, Oxford OX3 OBW.E ngland U.SA PergamoPnr esIsn cM.a.x welHlo useF.a irviPeawr k, ElmsfoNredw,Y ork1 0523U.. SA CANADA PergamoonfC anadaS.ui e 1041.5 0C onsumersR oad, t WillowdOanltea.r Mi2oJ 1P9C.a nada AUSTRALIA PergamoPnr es(sA ustP)t yL.t .d. P 0 Box5 44. Potts PNo.iSn.tW.2. 0 1L Australia FRANCE PergamoPnr esSsA RL.2 4r ued esE coles. 7524P0a riCse.d ex0 5.F rance FEDERALR EPUBLIC PergamoPnr esGsm bH.6 24K2r onberg-Taunus. OF GERMANY Pferdstr1a.Fs esdee rRaelp ubloifGc e rmany -----· --------- -------------------- Copyrigh1t980P ergamoPnr esLst d. © AllR ightRse serveNdo. p arotf t hipsu blicamtaiyo bne reproducsetdo,r ienda retriesvyaslt eomr t ransmiitnt ed anyf orm:J r by anym eans:e lectroenliecc.t rostatic. magnettiacp em.e chanicpahlo.t ocopyriencgo.r dionrg otherwiswei.t houpte rmissiionn w ritifnrgo mt he publishers. BritLiisbhr aCrayt alogiuniP nugb licaDtaitoan FEBSS ymposiuomn D NA, Lib/i1c9e.7 9 DNA,r ecombinaitnitoenr,a catnido ns repai(rF.E BSp ublicatviooln.s6;3 ). 1. De·o xyribonuaccli-edCi ocn gresses I. Title IL ZadrazSi l, IllS.p onaJr , IVF.e deratoifoE nu ropean BiochemiScoacli eties V. Ceskosloveanksakdae mvieed VI. Series 574.8'732 QP624 79-42641 ISBN0 -08-025494-2 Ino rdetro m aket hivso lumaev ailaabsle ec onomically anda sr apidalsyp ossibtlheea uthortsy·p escrhiapvtes beenr eproducinet dh eoirri ginal Tfhoirmsme st.h ohda s ittsy pograph/iicmailt atbiuotin tis sh opedt hatth eiyn n o wayd istrtahcert e ader. Printed in GreatH 'Hh1cai/t&0a 1iC11o 1. /Ll1tc1d\•.e ,tA e.r PREFACE The thirds ymposiumo n DNA, organizedb y the instituteo f the CzechoslovaAkc ademyo f Sciencesa nd sponsoredb y FEBS,b rought togethers peicalistfsr om the Europeanc ountriest o exchangei nformation in a rapidlyd evelopinga rea of research. These symposiah ave traditionallbye en focussedo n the relationshibpe tweent he structure and functiono f the geneticm aterial. In this meetingp resentations were relatedt o four topics:D NA recombinatioinn vivoa nd in vitro, DNA interactionasn d DNA repair. For the past five yearst hese problemsh ave been studiedi ntensively usingn ew methodologicaalp proachesa nd newlyd evelopedt echniques for cloning,p hysicalm appinga nd sequencingo f DNA. This,t ogether with the potentialf or more exacta nalysiso f the complexp rocesses in which DNA and other biologicalm acromoleculeasr e involved,i n the coursoef storagea nd expressiono f genetici nformationh,a s provideda basis fofru rtherg enetics tudiesa t the molecularl evel. Thus,p roblemsr elatedt o the geneticc omplexityo f highero rganisms, relationshipbse tweent he structureo f geneticm ateriala nd the regulationo f expressiono f genetici nformationa nd genetic engineerinogf microorganismsh,a veb ecomea menablet o experimental investigation.T hesep roblemsa re closelya ssociatedw ith endeavours to understandt he molecularf oundationosf livingp rocessest o create a rationalb asisf or treatingg enetica nd virald iseases. The resultso f more than 25 yearso f researchw ork devotedt o the study of DNA, sinceW atsona nd Crick's discoveorfy i ts structure,p rovide greath opesf or a usefule xploitatioonf all thesef indingsf or the benefito f mankindi n termso f improvingh is geneticb ackgrounda nd his environment.T he resultso f the symposium,p resentedi n this volumeo f FEBS publicationsa,r e a modestc ontributiotno thesei ssues. S. Zadrazil J. Sponar xiii STRUCTURAL AND FUNCTIONAL ANALYSISO F CLONED BACTERIAL rRNA GENES VenetiIa.Bn oerro,s C,s ordas-TK6itshs,, P. E. A. I.K isasn d Sain 8. InstiotfuB tieo chemisBtiroyl,o gRiecsaela rCcehn teSrz,e ged, Hungary ABTSRACT Thes eevnr RNAo peron(seg ne)s ofE .c oliw erep hysiaclyl mappebdy r estirctioenn dnouclseea,s usign theS outehrn blotitngt echnqiue. Twcoo pmleter RNAo peron(srr nBa nd rrnh'De rei solatebdy t her eocmbiannt DmNeAt ohd, usnig thep BR322p lamsidc loning ivceelh.T her RNAo preon carribeydt het ransducipnhga gt.ed ar1o5E2w as fountdo bea hyrbido f trhren Da ndr rnEo peorn.s The DNA sequencoef t hep roomterre igonf orr rnB wdaeset rmined. TheR NAp-olyemrasbein dign siteosn t hec lonedr RNA opeornsw erel ocailzedb yf itler-bindainndeg le crton micrsocpoict echniqsu.er RNAt rasncirptiowna si nvseti gatebdy e lcetronm icorscopya ndh ybriidzatioann aylsis oft hei nv itrot rasncripst.A ll thesfein dingwse re correlatweidt ht heD NAs equecne, anda tentatiev model wasp rpoosde to pelxaitnh eu nusuparlpo ertioefsr RNA proomtres. INRTODUICOTN Oneo ft hem aina dvnatageosf t her ecmobinaDnNtA technooglyi st hati t laolwst hed etailemdol ecular analysiosf g enewsh icahr en ota menabtloec laiscsal genteicm ethod.s Ther ibomsaolR NAg eneosf Escherichia colbie lontgo t higsr ou,p nom utanhta se verb een isolateidn t heMT.h et hreseta blerR NA( 61 S,2 3 S) s, S compnoenst oft heb acteriraiolbs omea res ynthiesetda s a 30 precruso,r which siubsse qunetlpyr ocsesedt hrough s a copmlexs erieosfr eactnis.o Theg ense (poeorns) coding fort his3 0S transcriptr edaurned ,a snetveraclop ies arel ocatsecda tteroendt heb atceriaclh roomsmoe. 3 P. Venetiaaln.e r et These are the most active genes of bacteria. l.lthough they wake up only about 0.8 % of the genome, more than 50 % of all transcription takes place on them in expo nentially growing cells. This high rate of transcription is subject to several intricate control mechanisms. The problems raised by this interesting system can ultimately be solved only by a detailed molecular analysis of the rRNA genes, especially their regulatory regions. In this report we summarize our work, done in the past few years on this system. RESULTS By using the so-called Southern-blotting technique (Southern,1 975) we were able to deterl'line the copy number of E. coli rRNA genes. BrieflyE:. coli DNA was digested with BamHI restriction endonuclease,w hich does not cleave into the rRNA operon, and the DNA was hybrid ized to rRNA after electrophoresis.A s seven distinct hybridizing bands of approxi�ately equal intensity were detected, it was concluded that the number of rmJA operons is seven (Kiss, Sain, Venetianer, 1977). This approach was then extended, and E. coli DNA was similarly analyzed with 9 different restriction endonucleasesa nd 36 different double and triple combinations of these enzymes (Boros, Kiss, Venetianer, 1979). These results unambiguously established that the copy number is indeed seven, and allowed the determinationo f the physical map of the vicinity of all seven genes. This map, shown on Fig 1.w as very helpful in the further analysis of rRNA genes. First: it helped to identify cloned rRNA genes (see below); second: it allowed the detection of hitherto unknown rearrangements.F or instance, it was supposed that the transducing phage AdaroE152 carries the bacte rial rrnD operon (Jorgensen, 1976). A comparison of the physical map of this phagew ith the E. coli map suggests that the RNA operon of this phage is a "hybrid", re sulting from recombinationb etween the rrnD anrdr nE operons. For detailed analysis of individual rRNA genes, and esrecially their promoter regions we decided to clone them. First the rrnB gene was cloned, starting from the transducing phage Adrifdl8 (Kiss and coworkers, 1978). ElectronmicroscopicR -loop mapping and in vitro transcrip tion experiments verifietdh at the 7.1 kB Barr.HI fragment cloned in plasmid pBR 313 indeed carries the intact rRNA gene of the phage. Then we attempted to clone all seven genes starting from the bacterial chromosome, but this attempt had been only 4 AnalyosfiC sl oneBda cterriRaNlAG enes partilayls ucecssufl. Outo f2 000s creeedn rebcioanmnst onlys eevnc lnoes containbeadce triarlR NAg eens. By usnigt hep hysicmaalp s howonn F ig1 .i tw as eastyo estbalisht hats ix of thecsleoe nsc arritehde r rnDg ene and ocnoen tnaeidr rn.B Thisl attecrl oen howevperro ved to breat herun stabel,t hem aintaenncea ndl areg-scale preparatoifot nh er ecobmianntp lasmid temredp BK1 7) ( wasd ifficult. Iti si nteerstingt on otet hatt hel oss oft hep lamsida ppearteod bger auda,l througshp onta neosu deleitonss tartnigf romt hec lnoedb acterifarla g men,t butg oing itnhteov ectorp lasidmi tesl.f Another intertesingo bservationi:n severacla setsh ed isappear anceo fa nr RNAg enec arrygi pnlamsidw asa ccomapniebdy thea ppearaonfca e n ew, eightrhR NA geinnte h ec hromo som.e Thseee xtrac opiewse rea los unstable. rrAn El :i'� ';E ; -"'0 f.� "'=c. {� n.�+:r 8. -!..::t:..-.��- •.. ..-l..;n- -cr:Jt..� .. !;;_ia= -�:i x�0 --a:'"8 rr9n i s 8."' 5 a: ."0-!:o :x: + ill IV> rrnC � i = ;; -iro � "'� "'0E c."' "'0 -i! Ii .... x .... .. rrn 0 -..;g.......ttla:..-�. o£°tl -..� ;r - E a rrn -= ;:: ;;; ;ji;g l ;r i"Oc ilJlli - rrnFlorG) iE = -+ "'c. rmG lorFl -= 8. ii - :r -15 -10 -5 0 5 10 15K B Fig.l. Physcialm apo ft hes evenr RNAo peroonfsE . coli 5 P.V enetianer eta l. Forf urhtera naylsiwse choset her rnBg en.e Fig2 .s hows thep hyiscla mapo f thtweo r eocmbniantp lasmidsc aryrign rrn.B Fporr acticraeals ontsh es equenncgiw orkw asd one onp lamsid2 1I2. An 1.6 kB longH indI II -BamHfIr agment wasp reparferdo mt hisp lamsid. Itc ontaienda llt heD NA ofb acterioarli gifnr omt hea ttr egiotnil lt he8 0ht nucelotideo ft hem atur1e6 S rRNsAeq uenc,e thusi tm ust haev contianedt hep romtoerr egi.o Anftetrh ed etermina tiono ft he deatiled physicamla po ft hisr eigo,n se quenicngw asc arreido utb yt het ehcniquoef M axaamn d Gilbte r(1797),a ccodringto t hes trategoyut lniedo n Fig2 . ;:11E" 1 :r0." E:rn E :f Q... :r11E" 1 i • H • t 235 165 pBK 17 23s 2/12 p BR3 13 :3 ...... :::: ::1 -- --- :X:� 11�1.z::C '.:I:� �'.:I:'.:[� �::C�ID :J<C ��111..8'.:l: ::C +H t H t t Ht t 100 0 -100 -200 -300 -400 -500 -&00 -700B P Fi.g 2.P hysailcm apo ft her ecobminantp lamsidsp BK1 7 and2 /1a2n do ultineo ft hes equencisntrga tegy Incideanltl,y itm ustb en otetdh ata tt heo there ndo f ( thisf ragmetnhte s equencweas alsod eetrmineadn dt his sequecned efnieda seocndarya ttachmesnitte f orp hage lambda, Csordas-Th6t,B oors, Veneatnier,s ubmittefdo r publiactio.n The7 00b pl ongs equenciem mdeiateplrye ) cedingt hem aturreR NAs equnecet husp rseumabliyn cluding thee nitrep romotreerg ioins s hwono nF ig 3. 6 A•GC TGAGACGGTAGTTTCTGACTTGGCACTAAAACGTATCCTACGCCCAGATGGAGGTCTCA£GGACACATACGGCAAGTTTGTATTGGG -700 -680 -660 -640 -620 TTGCACCATTTCACATGCAGAAACAACCGTiT ACAAG!GCTGClAG AGGGAATATCCCTCGGGGCCGTACGTAGTGTGCGCGGTCGCCGAAC -600 -580 -560 -540 G�G CCTGGTTGTT,AGAACAlT GAATAGAGCACACTACCTCGGCGCGATG!CAGATATGC�TTTTGTATGGCGCC�AA GACTTGGAACACAATT -520 -500 -480 -460 -440 ATGTCCCGTTTTACAGCGTTCTGAAAACCGGGCCTTCGAAAACATGGCAGTTATGTGCTGATTTGGTTGAATGTTGCGCGGTCAGAAAAT -420 -400 -380 -360 TATTTTAAATTTCC��CCTbGTAGATTACACATGCGctrCATAAdcTGCt:_CCACTGACACGGAACAACGGCJGAGAGATCGAC CAGCCGC -340 -320 -300 -280 -260 I CGGGGTTCTCCTGGAGGAACGCAATGCAAAAAGAACATAAGACTTTCGTACTGTAGCGGGAATATGAGTCACACCCCGCGCCGCT C qr (J:: �- - - - L_ -240 -220 -200 -180 ' GAGAAAAA GCAGAGCGGCACTTGTCACTAA.ACTTTTATCAGACAATCTGTGTGAGTGACCAGCGTACTGTACATGTAACGTCGCAAGACG -160 -140 -120 -100 -80 AAATAGAATAAACGCTCTCAAGAGTGAACACGTAATTCATTACGAAGCTAATATCATATTTTTCATATATTGTAGGACAAGATGTTTGAT -60 -40 -20 -1 +17 Fig Ther rnBp romtoer sequnec.e Nubmerig nstratsa tt heb eginninogf t hem ature 3. 16 s rRNAs euqenc.e Onlyo ne stranids s hwon.A rrowisnd iactet her estritcione ndo nulceaes cleavagsei teuss edi ns euqenicng.T heP ribwn-oseuqecnesc orrsepodning tot het wop romotersa reb oexd,b rokena rrowisnd ictaet hes ietso fi nitiaiton. Thep olymerraesoceg nitisoeqnu encaers eu ndreliend. rrnB TTTGTATGGCAATGACGCACGCTGAACAATTATTGCCCGTTTTACAGCGTTACGGCT� CGAAACGCT C�AAAA 1CTGGCAG rrnD GGCCCCGTGCAAGTCTTTTAG TATGCAAAAAA GCA CC TTTTGTGTGCG rrnX GATTGGGTGT��..AATAGCCT GGCAGACCTGCCGCAAGC -4�0 -460 -440 -420 rrnA CCTCTTGTCAGGCCGGAATAACTCC rrnB TTTT CCTCTTGTCAGGCCGGAATAACTCC rrnD ATT GCA.U\..lt<R-"1'1� fth-""-""� TACTTGTGCAAAAAATTGGGATCC ATAA rrnE CTATTGCGGCCTGCGGAGAACTCC ATAA CGCTTGTCTTCCTGAGCCGACTCCA TAA -340 -320 rrnA --,T GCCACCACTGACACGGAA CAACGGCAAACACGCCGCCGGGTCAGCGGGGTTCTCCTGAGA ACTCCGGCAGAGAAAGCAA rrnB GCCACCACTGACACGGAACAACGGCAAACACGCCGCCGGGTCAGCGGGGTTCTCCTGAGAACTCCGGCAGAGAAAGCAA rrnD T GCCTCCGTTGAGACG AGAACGTGAAACACTTCACAGGATG CTCGGAACA AC GAA GAGAAAAAAA TCC rrnE GCCTCCATCGACACGGCGGAT GTGAATCACTTCACACAAACAGCC GGTTC GGT TGAA GAGAAA AATCC rrnx�;;i=GC=:::::CTCCATCGACACGGC�G T gTGAATCACTT�A�ACAAACAGCC GGTT� GGT TGAA GAGAAA AATCC -300 -280 -260 -240 L rrnA AAATAAATGCTTGACTCTGTAGCGGGAAGGC AC ACCCCGCGCCGCTGAG AAAAAGCGAAGCG GC ACTGC rrnB AAATAAATGCTTGACTCTGTAGCGGGAAGGC AC ACCCCGCGCCGCTGAGA AAAA GCGAAGCG GC ACTGC rrnD TGAA ATTCAGGGTTGACTCTAAGA GAGGAA AGC GCCACCTCGCGACAGTGAGCTGAAAGCC GCGTCGCAACTGC rrnE TGAAA TTCAGGGTTGACTCTGAAAGAGGAAAGC GCCACCTCGCGACAGTGCG�TA AAGC GCGTCGCAACTGC rrnX TGA1\ATTC �GgGTTGACTCTG� GAGGAAAGC _G£CACCTCGCGA�AGTGAgcTGAAAGCC GCGTCGCAACTGC ---==----==� -220 -200 -180L_ -160 Fig 4.T hef iev rrnp roomterre gionasl ignetdom axizmeih omolioeg.s