loading

Logout succeed

Logout succeed. See you again!

ebook img

DTIC ADA259830: Specific Recognition of CG Base Pairs by 2-Deoxynebularine Within the Purine-Purine-Pyrimidine Triple-Helix Motif. PDF

pages16 Pages
file size0.2 MB
languageEnglish

Preview DTIC ADA259830: Specific Recognition of CG Base Pairs by 2-Deoxynebularine Within the Purine-Purine-Pyrimidine Triple-Helix Motif.

AD-A259 830 OFFICE OF NAVAL RESEARCH DTIC Grant N00014-92-J1052 Q ELECTE FEB 2 199353 U R&T Code 4135018 F Technical Report #6 "Specific Recognition of CG Base Pairs by 2-Deoxynebularine within the Purine * Purine* Pyrimidine Triple-Helix Motif" by H. U. Stilz and P. B. Dervan California Institute of Technology Division of Chemistry and Chemical Engineering Pasadena, CA January 11, 1993 Reproduction in whole or in part is permitted for any purpose of the United States Government This document has been approved for public release and sale; its distribution is unlimited. 93-01794 I\I>E&E $ lh•mfli Specific Recognition of CG Base Pairs by 2-Deoxynebularine within the PurinePurineoPyrimidine Triple-Helix Motif' Hans Ulrich Stilz and Peter B. Dervan* Beckman Institute California Institute of Technology Pasadena, California 91125 RUNNING TITLE: Recognition of CG-base pairs Ac*e*i%1a For Dsrio t-lan/ * AvJabbiiitv Codes * Av~ilan1d/or :Dist i oia1 DTIC QUALITY W3SPFCTED 3 + We are grateful to the Office of Naval Research for generous support * To whom correspondence should be addressed 3 ABSTRACT The sequence-specific recognition of double-helical DNA by purine-rich oligodeoxyribo- nucleotide-directed triple-helix formation is limited to purine tracts. Within the geometric constraints of the phosphate-deoxyribose position of a purine-purine*pyrimidine triple helical structure model building studies suggested that the deoxyribonucleoside 2'- deoxynebularine (dN) might form one specific hydrogen bond with cytosine (C) or adenine (A) of Watson-Crick cytosine-guanine (CG) or adenine-thymine (AT) base pairs. 2-Deoxynebularine (dN) was incorporated by automated methods into purine-rich oligodeoxyribonucleotides. From affinity cleavage analysis, the stabilities of base triplets within a purine-purine-pyrimidine (puepuepy) triple helix were found to decrease in order N.CG-N*AT >>N.GC-N.TA (pH 7.4, 37 *C). Oligodeoxyribonucleotides containing two N residues were shown to bind specifically within plasmid DNA a single 15 base pair site of the human immunodeficiency virus genome containing two CG base pairs within a purine tract. This binding event occurs under physiologically relevant pH and temperature (pH 7.4, 37 'C) and demonstrates the utility of the new base. Quantitative affinity cleavage titration reveals that, in the particular sequence studied, an N-CG base triplet interaction results in a stabilization of the local triple helical structure by I kcalemol-1 (10 mM NaCl, 1 mM spermine tetrahydrochloride, 50 mM Tris-acetate, pH 7.4, 4 *C) compared to an A.CG base triplet mismatch. R I N.CG., R H II N" NAT HH NeT WA+T Oligo Z .X 1AG 4C T 2 A YY TC,G,A 3 G C 3p5'-AATTCTCTCTAAAAIAGGGXGGGGAGGGGAGGGAAAAACTCTCT GAGAGATTTTTCCCCTCCCTCCCTTTTTGAAGAGAGTC-5' 3'-TGGGZGGGGTGGGG T-5- I 3 (cid:2) (cid:2) a I (cid:2) 4 I. 33 a am.ame u@ (cid:2) a *m.ain.w y* WW a U 'S I Base Triplets 120 E AT 0 CG 100 6 GC c E TA co 80 "_ 6600 0 c 40 20 0 N A G C T Third Strand ;-f,- 3 " 32 p C6 A 3' so Y*5' C-G A-T 5'G-C G.G-C G-G-C Z2.C-G G. G-C G.COUgo ZI Z2 G-G-C G-G-C 6 A N GGC7 A A Z1.A.T 8 A G GGC 9 A C Z2-C-G 10 A T 0.G.-C 11 T N sAGj-GZ-C I.A-T 12 T A 13 TG _.N Ceor-C 14 T C TA-T 15 T T .- 16 N N 3 3c-G 17 N T 3' G-C e C-C C-G T-A T-A A-T 5* 3* ar~e 9 1 2 3O c4 p)5 6 7 8 9 .(cid:127) 10 11 12 13 14 (cid:127)p) 0.70 0.12 S f 32 48 bp 590 bp 51-GTCtzCGCCCCTCGCCTC~tGCC-3' 6 5' GGNGGGGAGNGGAGT* - 7 5' GGAGGGGAGAGGAGT* - 10 5' - GGTGGGGAGTGGAGT* 11 5' - GGNGGGGTGNGGTGT* 17 5' GGTGGGGNGTGGNGT* -

See more

The list of books you might like