Logout succeed
Logout succeed. See you again!

DTIC ADA422932: Genetics Risk Factor for Prostate Cancer PDF
Preview DTIC ADA422932: Genetics Risk Factor for Prostate Cancer
be AD. award Worker: DAMD17..02-1-0056 TTTIR: GeneLics Risk F ctor for Prostate Cancer PRIKCIZAL INVRSTIGATOR: Edvard P. Colnann, ¥.D CONDRACTING ORGANLZATTON: Georgetour University Washinglor, Do 20007 REPORT PATE: Januaxy 2204 Tyee OF REPORT: Acviual PREPAREE FOR: U.S. Army Medical Remearck and Vaterie? Command Fort Detrick, Macylend 21702-S0"2 DISTRIBITION STAVEVENT: Approved for PubWic Re:ease; Distribution Urvinites The views, opiniowe aud/or fiad‘ags conta:ned in this report ave those of the author(s) end should not be conrt=ued as an offlcia! Department of the Acmy position, policy er decision unless so gesignated by other documentation 20040524144 REPORT DOGUMENTATION PAGE orm Approved OMB No, 078.0788 >. Gelnann, %.5 7 PERE TRTE SRA TON TREES AD ADDRESSED Bomegencs Osiweracey tut _golammnedgeorgetom edu 3 EROISORNE /ONTORNG. AGENCY AAM|S: AND ADDRESSES! Ford Dewvick, Ko’ylend 21702-8012 U.S, army lode. Raseezea aad material Conma i dppeoved for Fublic Rolorne: TEE TREN 6 altattes SASSO SUS e ote Ge cima errhan a nearer sgn atone | TGaCY Use ORLY Emon ATE “F REPORY TPE AND OATES COVERED 1 theove Sant) Sanmary 2008 Sanael (evan 2003 = 3" bee 29681 Qonevien Riss Factor for Broetate Coreor DRED. 7-02-1-0056 | ABSTRACT sina 700 Wor NEES: 19 a Remeoprotsin vith provlaLe Eecetion eng/or peaales lyperucthylazion Soactivates othe: transcription factor: corrasates with prostats onreer progr’ = Yering dageees th tirteally all primary prostete cmicurd ae a trosertiption tector My biuaing atyestly to DNR. EX eatalexes with tie ON, uminding orrvwe bo ip 2 stolctiowetric relationship and ehe-we Atle emreasion ia adslta, fore of Was. Maxs.2 prateia expression is reiuccd 10 Toe ots 2 gene in aetecred iy Ta 300 of peinacy prontate cancers. AG1 acta RE rlgo compliet and veh ab eatin peagonee Sector, ie have roe found fosionerage 2. 1X3." Finda to Seismie sacwid BNA cleevaste by vopesiomerage 1, HOG,1 doer eo! alfect veligezron of velaved JNA by toposionorase T Topoalovarase fia Anvolved in UNA replicabios, teaseriptio:, acd repair and gay be cdr Signefieacl centsol or NEC2 im prostare epithel’s” cell ERES.2, bomeodoraiz prateir, topeeinuwrace, IMB xapat: 15 7 SERIA ASSERT Usploest fied ‘oF is pace Trelaseifzed Ucelons fed Da ie ea Enna Tabla of Comenis Table of Contents. Introduction. Badly. Koy Research Accomplishments... Reportabla Outcomes.. 13 Conclusions. Raferences... 14-18 Appendices. Introduction AX3.7 is an androgen-rugeluted NK-class homoobox gene ssh expression to both adult nice and human restiictod primarily ir he presiate pland (1-5), The human NAX3.7 gene has been mapped in chromosome Bp21 (6), « louus deleted in 85% of prostate eancer (7-9). Fine steacture mapping und sequercing of the minimally delete region of 8p21 has placed NAG. in the center of the §p21 deletion (10). However, the contralateral allele does not wigergo soon rutition in prostate emeer, suggesting that loss of a single allele raay be importenr in prostate carcinogenesis (6). Cemintant Wh this notion is the fowing hal heterozygosity for foss of Miv3 in mice confers prosaic dedifereutiation amd typerplasia sugtesting thet NAX3.2 haploinsnfticieney is demisinat and explaining how AIA I may have a gatekeeper role inthe of prostare cancer eases ia which the gene is deofed (4.10.11. NKXRL fw 0 complex fonction that indudes binding directly to DNA via the Inomendomnain resulting, most emamouty, in sauscriptions! scppresvion. NKX.1 also binds te other iruuseripting factors such #s verom response “actor, also via the NKX3.1 homeodomain this ease NK XS. | enhatecs tanser’ption of SRF-reyponsive genes. ‘This project was aimed al tw eritcal youls, Ube fist was tm idcorify a reporter that wan. sensitive t activation by NEX3.1. To this end see have reported aed further clafy work with a Gragment of dhe CMY carly wien promoter Dua is seositive to NKX3.1, The second part of his pivjeet was to Meutfy groveins that ecmplexcd wish NKX3.1 and #1 explain the functional igaitieance of the interaction between these peorcins and bath normal and ply morphic NKX.1 [Ac Comiruetion and testing of NKX2A1 reporter ones With wil-type and mutant NEXS.! exprosiun vectors (ear I) 1. ‘Testing cf Inman NKX3.1 efests 00 "Fig chioken SMGA repovler plasmid fect of NK.1 on Chicken SGA promoter sf ‘he edfsets of human NKX3.1 om sctivity of tho chicken sol muscle actin (SMGA) promowr 7 Figure 1, Sinflyr to findinus of Carson et al, swith murius No.1, we served dhat Eutran INKX3.1 can cnhmoe the effect of secur Relation aethty response factor (SRF) on the serure-cespouse ‘ element containing SMCA promote (12). 7 We also showed wut the hurana SMGA. ! = promoter is equilly revgonsive to SIE and ° NKX3.1 ¢Figore 2} er set oH 2. Camstruction oC NKX.1 and SR ‘expression vectors under contol of TISVLc promoter. ‘As detailed in the your [Progress Report ese const element of the Stetemnt of Work was uhandoneel -anld not b> engineer ona this 3. Deletion analysis oC OMY promoter We live generated reiminary deletion fagmomts / Effect of NKXS.2 on SRF Aétivatian of Human SHGA Promoter of thy CMY exly. region promoter and placed them Bee es Sgwveam fiom the Reza " Tusiferase repartee acao. These z al camirucis are shown in Figure ¥ al i 3A. Inieaction of these : “4 repels with NKXG.1 and C= ta terminal franeated NKX3.1_ 18 i shown in Figure 38. ‘The effect fo of NEX3.1 we similar with all : the CMV promnier consteucts a However, the off of the C- . tecminal rmuncated sw NKX3.1(4184-234) veut mons =~ - : : imakedly cahanesd by deleting | Mosaetezin : cements of the CMV promates. At should he noted Ful the CMY promoter asc his a TAACTA Ihexanveleotide seyuence that is az NKX3.1 recognition sity 3). This site hus aon routed svithout any nll on fe renortsr acne responses presented in Figure 38. Fig 38 ig 38 Deletion Analysis of CHV Promotor“ Effeet of XS. on CMY-Rentlla Reporter Construct osama + 4. Analysis oF NKXG.1 WT andl rantant constvets driven by TISVIk on CMV and SMGA vectors As describes lan A, these experiments enanat be completed and were deleted fiom the ork, SS, litfeer of SRE on NKAX3.1 intersotions swith CMV-derived repartee p:asoids A suboptirnal level of NEXG.1A( 4-234) placid was used with the CMVAT-3 reporter in ‘order to asiows the effect. if any, of SRF on the imaracrion of NKLX3,1 with ths CMV promoter. ‘We observed thul al higher amounts of SRF plasuud theze was abut a 2-fold inemase in NET. activation of the CMY(AL-3) reporter construct (igure 4) B. Yeastiwochybrii cloning of NXGL binding parmers. (¥eur 1-2) 1, Isolation of Y2H clones that ind WT i ceseeenntensincr mes uate ae anes NKX3.1 2. Sequencing clones and contimstion by GST pulldown 2. Construction of KKX3.1 R52C DB [asmid and seloction ef clones thet biné fo NIOG.1 RIC. 4, Back selection of NEX3.1 2521 clones ageinat WT NEX3.L 5. Auolysis by seqaeneiny and GS pall. down of any clones tbat hind NKX3.1 RS2C bur not WA NKX3.L [As described in the Year 1 Progicss Report wwe had wy abandon this element dus to ftasibilily isumes. The hybrid yeunt two lybrid ait camstraets — GALANKXG.1 and VP-16NKX3.1 were bulb hiologieally inactive preswunably due to misfiring oF the fasion proteins, Although we considered pursuing LEXA tusions thut we used ©. Bieberich ta identify PDEF ao an NEX3.! binding protein 114), bat after discursionx with C. Ticherich we decided not t pursuc these cxpstimenty. Insel we have decided Lo exploit afiiaity chromatography to isolate poorcias that complex with NKN3,t. We made an allinity column of NES3.limallase-hindig protein (MBL) fusion procein as am affinity tengent, PC-3 cell estract ‘was pissed Uhroagh the eoltume and chrough a control MBP column, Polysurylumide yet slecttophoresis of the ullinity-parfied peptides that adhered tothe fo columars is shown in Pigare 5, Nove thot the NKCX3.I/MIRP fusion pronein selecred many :aare proteins than the coniro! VIB Figs NKXD3.1 Afrinity-Puriied Proteins BIO-RAD 816% THsHCL, SOUL ‘The ten emumcrarod bands were subjevied to in-gol digestion provedure with capillary column TC-mivioelecuospray MS analysis to generate and secucare » number of peptides Proteins were identficd by intemal vequencing experiments performed by inden mast speetrorneliy in the Mars Spestromretry Cenler in the Analytical Chemistry Lah. The 1.C-MS system is bused on Kinnigan LCQ-Deoa XP ien tap 2iass spectromctsts with Agilent 1100 rierowapllury LC systems, Exhaets wor injocue ara the peptides are cluted fem « 10-een x 75 hum id Phenomenex Jupiter C18 roversod-phase capillary column veith acctooirite'0. 1% formic Acid gradient a Mow rate of 0.5 suLAmin, Tho 1. eMluent was directly analyzed by coupling il ‘he mass spectrometer using a Potana nanaclsotrogpray ion wource. The peptides were analyal sing the data-dependent maltack capability of the instrument acqviring fill scan mass sacctta te detormine peptide mofecular weights (MS) and product fon specica (MS:MS} to doteraice amine Acid sequenes im successive instmancrx seqnd. This munl2 of analysis is completely automated. The dla are amalyved interpreting the CLD specta of the ions un priduce the tabulated results for each digest, The interpretation process is pexform! hy searches af de SwissPeot an! NCBI protein soquetee dahases using ue search program SEQUIEST. Thawed #7 was thus idvotijed os represerning Laman topasiomerase I, a type Ttoposiomerese that iy chiquilous expressed in calls, Toposiomornse | (Topesiorerase I) is a member of the type 1B subfimly of uaposivmerases 1. Topesiomcrase I gan relax positively vr negatively supereailed TINA hy hinding and cleaving a single strand via a vovluent linkage between a tyrosine aed 2 3 end of DNA, The biuding and umsinding is vofactor independant and does nor require Ma! {18.16}. ‘Topasiomerase {is assayed using a UCH2 plasmid with 9 50 nucleotide insert derived from the tecrabymena ribosome gone sepeal QUIOTL) (17). Loposicmerase T nicks DNA. referatially, bur nat exelustycly, as 4 vomiation of nucleotides that cxtends ftom: positims -+ 19 =I on the seissle stand that read 9-(A/TC!OMATIT-T. The enzyine attaches covalently 9 the =I T residue We first demonstrated the effeel a NKX3.1 on tnposiomerase | elcavage of HOT! seper cuted DNA. ‘the result is seen in Figure & where we sce chat NEXG.1 along hut nal etTeet or ‘unwinding of pHOT] DN, bul hal & marked effoet on the tepasioraerase activity. The reastioe Fig 6 Effect of NKS3.1 on Topoisomerase I 120. Fraction Cleaved DNA nea.agnm seas performed necuding to a protocol provided by Tepnyen, Ine. (Cailunibus, OM). Briefly, 04U (approxitamtely]Ong un a final conceatiaion of S.3uM) of loposiomerase | was incubated wit ‘ndivated umount of recombinant NK53.1, 2 yl af 10x bulTer containing 100mM TriseCl. pH7.5. TM RaCl or KUL, 1mM PMSF, lM f-oereaptoethanot, aud 250ug (7.tmM) of pHOT! plastaid in a final reaetion voCume of 20ul at roan tempersaire. Lhe reaction wats slope by the ‘addition of Sy of SOmiM DTA, 0.5% SDS, 0.1% bromophenol blue and 508% (vw) suuiose) in reaction mixauc, DA was alocaphonssud in 1% egarase gals at 15¥ (2Véom) for 18 hours. Gis swore stained with ethidium bromide and shotographed under UY Tight ‘We also trated topostouserase I im th lermonsated Oat NEX3,6 shen, ‘Thi eect is shown ia Figure 7. 2 presence of a teed ainouut of NKXG.1 ané ca the vals at which Loposiorserase 1 effected DIA cleavage Fig? Effect of NKX3.1 on Topoisomerase I 7 60 ¢ Z o 50 3 g gt fe} g 30 om 3 & 20 en: = onions “miei o 10 a . peg ° a 4 2 4 8 Topo 1 (U) ‘We next examined the interaction of NKW3.1 and tapesiomerase T in the presence a? camprotheeia, 4 chemotherapeutic ngen! md kriven inhihiloe a uapusiomerae 1, Cacsplothecia intesualaues into DNA at che site of toposiomerase I binding tn DNA anu prevents religation, thus suhitiviag the covalent complex of tapasiomerese [ard clezved DNA und promoting call desth (8,19). The say was performed as deser:bed for ths DNA teloxalion ssany wilh the exceptian ot adding the indicated amoust of camptothecin (18,20). Figure ® showy the expected ellect uf campisthecin on the cleavage of PHOT] DNA ty tapesiomersse 1 Substantially lower ‘ameenizations of NKX3.1 have a umneh grcaisr effet om toposinmerase cleuvaye activity that is anlughnized by increasing conesutrations of eamptathesin. The data suggest that the physologie ieraetion of NKX3.1 and taposinmnenne: is diysupued hy the binding of eampwoihecia ta DNA aed competitive obsumction of she rligaion and release of tupesiomerase I fom the covalent enzyie-DNA complex, —_—. —____ — Figs i Effect of NIXC3.1 an Camptothecin and Topoisomerase 1 . £7) ened niewa das 2 j 1 te . camptothecin Gm oes (1250 toe ot ee Tapoiamersse 1 cleaves onc of the two crams of double-wtrindsd DNA (the scissile siren) and forms a covalent bond between a rosie and thymidine residue, The DNA duplex then unwinding through ul lest ane aun and the enzyme religae:s DNA und releases. The io functions, DRA cleavage und religatian can be analyzed separated by the use af specially ‘oligonucleotide agents ay shown below (21. Reagents: 14 niet 5'"GAAAAAAGACTTAG- 7 25 mee 3'- C TIT TET CTGAATCTITITAAA AAT 11 met acceptor 5'-AGAAAAATITT- “Toposiomernse 1 cleaves the partial dupl te -FGAAAAARGACEEKG. PoC TEPTTL CIGAAICETTTTAAAAATS* Yopl S-TOAAASAAGACTT-¥ Ye C TTT TTT CTGAATCLY ITIAASAAT-S LL-aner acceptor nove ean form a duplex with the eleaved partial duplex. S-AGASAAATTTT- accept 5'-#CAAAAAAGACTTAGAAAAATIT Yo CUTE TIT CIOAAT CTTT TTAAAASTS A Lémcr oligenuetontide wag labeled at te S° tennis in 25) retation combining s0pmol of L4mer ofigonuleoride, Syl GO0OCVamol of y[PLATP, anal 1011 TS pulynue‘ectide kinase iv polynucleotide kinase reaction buffer (NEB Ine. Beverly, MA} ct 37°C for 20min. 14 olymuclentide Kinase was inactivated by heating al 65°C. fr 20min. Labeled DNA was puniice swith # QTAguich Nucleotide Removal Kit (QIAGEN Sciences, Veleneia, CA). M¥/25mer partial duplex was generated by annealiog the Inbelod Idmer ofigonuclentide with 100-Z01d molar excess 25mver us ensure naxianal annealing of the ldmey ince a pirtial duplex. The annealing eactian of Tony included 8740 ["PeLdmer, 3.Sul 300uM 2Smer oligunncleotide, snd 104 of 10X anneal ‘buffer conraining 100aM Tris HUT (pH7.5), IM NaCt unl 10maM EDTA. ‘The annealing mista ‘vas heated a! 94°C: for 3-Stain aud then eooled 40 room femmes fur 1s hens prior usage Tae TNA cleavage eeaction was pexformed in 2Dul vith |} (pm) of suicide substrate and dt (1.2 = 2210 of Topusiomerase 1 (LapaCbN, Ins, Columbus, OH} in 2M Tris-ICH (pl17.5), llieaM KCI, LM ADU and tmM of DTT incuhuted for 30min at 37°C. Reactions tha inctaded rexommbinant NKXS.1 were preineaated with Toposiwrenuve Tin wale soora tenpeeare for S0rain prog 1 the addition of swcidls suhstrs. The react was ermine by addition of SDS at 37°C 1 a final concentration of 12%, The cleaved DNA suostate was yyrifegtion using (OFAquiek Nucleotide Removal Kit, 30, of cloted cleaved DNA substrate was incubated al 37°C lise Hon wich Su Lagi of proteinase K al w Gal voncentation of 0.1pg¥ul. 10ul of reaetion ‘was ceueved and added to 30, louging dye (86% formamide, 20mM ELLA, pH 8.0, 1.13 % xylene evan, 0.93 95 beoeephencl blue), deaarired st °C" For Smin. und electrophoresed on a 16% polyacrylamide gel with 7M urea, Tho gol was actoradiogeaphed after drying and quantitated swith Seion imaging woliware (Seion Corporation, Frederick. MD), For the religation way the 14:25mer suicide substste was incubatod with human toposiomerase I as destibed in suicide cleavage assay in tke presence of « LDG-fold excess | Inner aeceplor oligrmucleatide in a 20 scaction, NX3.{ emt 1imer aecepior were added at the Jniation of eaction aud ineubstad at 37°C lor 30min followed by terminating reaction by 1% SS aud then tented with Jeng’ml profeiaase K at 37°C for 30min, To dliseriminau cleavage und tcligation reactions $SMNuCL was added to the sesction mixture ko terminate the cleasace reavtion, NKXS.| wus apptied either prior to or after the addition of 0. SNuC to determine either its indluumee «m eleavuge of DNA duplex, or 0 dotcunine its uffeels on DNA religation by ‘Topviamerase . FolLowing the addition of the 11mer secepunr,reastion mixcures were incubsted at 37°C for 6bsmn and terminsts< by the uddition of 1% SDS followed by and proteolysis at 37°C for 40 min. ‘en jl of sample was dissolves in 3040 of fearmamids loading bulTer. Sumples were Tonled ut 90°C: foe S0mia and resolvod on « 16¥ eonaknred pelyuerylaride wel sith 7M urea. The gol vas uuliraioaraphed afler drying ant quaniiad witk Scion Imaging software (Scion Corporation, Fredetick, ML),