loading

Logout succeed

Logout succeed. See you again!

ebook img

DTIC ADA485743: Interactions between IGFBP-3 and Nuclear Receptors in Prostate Cancer Apoptosis PDF

file size1.1 MB
languageEnglish

Preview DTIC ADA485743: Interactions between IGFBP-3 and Nuclear Receptors in Prostate Cancer Apoptosis

AD_________________ Award Number: W81XWH-07-1-0053 TITLE: Interactions between IGFBP-3 and Nuclear Receptors in Prostate Cancer Apoptosis PRINCIPAL INVESTIGATOR: Kuk-Wha Lee, M.D.; Ph.D. CONTRACTING ORGANIZATION: University of California Los Angeles Los Angeles, CA, 90095 REPORT DATE: January 2008 TYPE OF REPORT: Annual PREPARED FOR: U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION STATEMENT: Approved for Public Release; Distribution Unlimited The views, opinions and/or findings contained in this report are those of the author(s) and should not be construed as an official Department of the Army position, policy or decision unless so designated by other documentation. Form Approved REPORT DOCUMENTATION PAGE OMB No. 0704-0188 Public reporting burden for this collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing this collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden to Department of Defense, Washington Headquarters Services, Directorate for Information Operations and Reports (0704-0188), 1215 Jefferson Davis Highway, Suite 1204, Arlington, VA 22202- 4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to any penalty for failing to comply with a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 2. REPORT TYPE 3. DATES COVERED (From - To) 01-01-2008 Annual 15 DEC 2006 - 14 DEC 2007 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Interactions Between IGFBP-3 and Nuclear Receptors in Prostate Cancer Apoptosis 5b. GRANT NUMBER W81XWH-07-1-0053 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Kuk-Wha Lee, M.D.; Ph.D. 5e. TASK NUMBER E-Mail: [email protected] 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER University of California Los Angeles Los Angeles, CA 90095 9. SPONSORING / MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION / AVAILABILITY STATEMENT Approved for Public Release; Distribution Unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT IGFBP-3 is a potent inducer of apoptosis in both androgen-dependent and androgen-independent prostate cancer lines. When the nuclear receptor RXRalpha was described as an unexpected intracellular binding partner for IGFBP-3 and effects on DNA transcription were demonstrated, rapid effects of IGFBP-3 on programmed cell death (apoptosis) still could not be explained. These rapid effects on apoptosis were clarified when I hypothesized that IGFBP-3 was a biological signal for Nur77 nuclear receptor translocation to the mitochondria where an apoptotic cascade is initiated. We proposed to determine scientifically the protein regions in each of these important cell death molecules that essential for apoptotic action and demonstrate this observation with mouse models. Our data so far reveal a nuclear export sequence in IGFBP-3. Mutation of this sequence impairs its apoptotic activity. Utilizing the IGFBP-3 KO mouse, we show that IGFBP-3’s critical role in castration-induced apoptosis. Mating studies are underway to determine the effects of genetically deleting Nur77 and IGFBP-3 in the ontogeny of prostate cancer. 15. SUBJECT TERMS IGFBP-3, apoptosis, prostate cancer, nuclear receptors 16. SECURITY CLASSIFICATION OF: 17. LIMITATION 18. NUMBER 19a. NAME OF RESPONSIBLE PERSON OF ABSTRACT OF PAGES USAMRMC a. REPORT b. ABSTRACT c. THIS PAGE 19b. TELEPHONE NUMBER (include area U U U UU 36 code) Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std. Z39.18 Table of Contents Introduction…………………………………………………………….……………...5 Body…………………………………………………………………………………….6-12 Key Research Accomplishments………………………………………….………13 Reportable Outcomes……………………………………………………………….14 Conclusions…………………………………………………………………………..15 References……………………………………………………………………………16 Appendices……………………………………………………………………………NA 4 Introduction Prostate Cancer (CaP) continues to be the most frequently occurring malignancy (aside from skin cancers), found in American men. IGFBP-3 is a potent inducer of apoptosis in both androgen-dependent and androgen-independent prostate cancer lines. When the nuclear receptor RXRalpha was described as an unexpected intracellular binding partner for IGFBP-3 and effects on DNA transcription were demonstrated, rapid effects of IGFBP-3 on programmed cell death (apoptosis) still could not be explained. These rapid effects on apoptosis were clarified when I hypothesized that IGFBP-3 was a biological signal for Nur77 nuclear receptor translocation to the mitochondria where an apoptotic cascade is initiated. This project will determine scientifically the protein regions in each of these important cell death molecules that essential for apoptotic action and demonstrate this observation with mouse models. The innovative aspects of this grant include: (1) Characterization of a novel interface (i.e. mitochondrial localization) of nuclear receptor / IGFBP superfamilies in the initiation of tumor programmed cell death; (2) Development of pre-clinical mouse models of prostate cancer that can be used to assess therapies that exploit the IGFBP-3:Nur77:RXR cell death pathway; and (3) provide a compelling rationale for Phase I studies of IGFBP-3 (or small molecule mimetics of this pathway) in men with prostate cancer. 5 Body Task 1. Characterize IGFBP-3 protein-protein interactions and mitochondrial targeting in vitro and demonstrate that they are essential for IGFBP-3 induced apoptosis. a. Confirm IGFBP-3/RXR/Nur77 ternary complex formation via protein-protein interaction studies. (Months 1-6) We have established association as published in our Carcinogenesis paper (appendix #1). We investigated the ability of IGFBP-3 to associate with Nur77 in nuclear and cytoplasmic compartments utilizing co- immunoprecipitation techniques. 22RV1 prostate cancer cells were incubated with 1 mcg/ml of recombinant IGFBP-3 for 2 hours and nuclear and cytoplasmic fractions were Fig. 1. Interaction between IGFBP-3 and Nur77. 22RV1 cells were incubated with 1 mcg/ml of recombinant IGFBP-3 for 2 hours. isolated as indicated. Nuclear and Cytoplasmic fractions were isolated as indicated. Protein A-agarose was used Protein A-agarose was used to immunoprecipitate bound to immunoprecipitate bound complexes and resolved by SDS-PAGE. Nur77 and IGFBP-3 were complexes and these were detected by immunoblotting. resolved by SDS-PAGE. Western immunoblotting (Fig. 1) showed that endogenous IGFBP-3 associates with Nur77 in both nuclear and cytoplasmic fractions that is largely unchanged by the addition of exogenous IGFBP-3. Association of Nur77 with control precipitating antibody was not detected. Moreover, detection of IGFBP- 3:IGFBP-3 complexes was revealed suggesting that IGFBP-3 can form oligomeric complexes in subcellular compartments. Non- glycosylated IGFBP-3 in this short incubation period was targeted to the nucleus, consistent Fig. 2. Nur77 mediates IGFBP-3-induced apoptosis (A) Differential with our previous response of caspase activation to 2.5 µg/ml IGFBP-3 in Mouse observations. Embryonic Fibroblasts (MEFs) derived from Nur77 Wild-Type (WT) and knockout (Nur77-/-) cells. **P<0.005 relative to no treatment (Student’s t- To further study the test). (B) Specificity of Nur77 involvement for IGFBP-3 induced functional interface of apoptosis. Note similar responses to DMSO in WT and knockout line. IGFBP-3 and Nur77, 6 we derived Nur77 null (Nur77-/-) embryonic fibroblast cells (MEFs) from the Nur77-/- knockout mouse. Using these Nur77 null MEFs, we tested the ability of IGFBP-3 to induce apoptosis (Fig. 2A). Overnight treatment with IGFBP-3 resulted in a 60% increase in apoptosis as measured by fluorometric measurement of caspase 3/7 activation in fibroblasts derived from the wild-type animal, but was not able to induce further caspase activation in the line derived from the Nur77-/- knockout animal. The phenomenon was specific to IGFBP-3 induced apoptosis as caspase activation induced by 2% dimethylsulfoxide (DMSO) was not different in WT versus knockout MEFs (Fig. 2B). Thus, Nur77 mediates the pro-apoptotic effect of IGFBP-3. To more closely examine the role of Nur77 in IGFBP-3 induced apoptosis, we treated Fig. 3. Nur77 significantly contributes to Nur77 KO and WT MEFs with increasing IGFBP-3 induced apoptosis in a dose- doses of recombinant IGFBP-3 that ranged dependent manner. Apoptosis in 22RV1 prostate cancer cells was measured after 48h from 1-10 µg/ml over 12 hours (Fig. 3). As of transfection by WT and mutant IGFBP-3 in expected from the former experiment, expression vectors by a histone-associated IGFBP-3 significantly induced apoptosis in DNA fragment ELISA (Roche). WT MEFs in a dose-dependent manner. Surprisingly, IGFBP-3 also significantly induced caspase activation in the KO line in a dose- dependent manner, although this was minimal when compared to the WT line. However, this does suggest that a small portion of IGFBP-3 induced caspase activation may be Nur77- independent, although the functional relevance of this is currently unknown. To validate our findings of Nur77 as a mediator of IGFBP-3 action, we reintroduced Nur77 by transient transfection, with and without co- expression of IGFBP-3. Overexpression of Figure 4. Reintroduction of Nur77 into IGFBP-3 alone did not induce caspase Nur77 KO MEFs restores activation. Overexpression of Nur77 alone did responsiveness to IGFBP-3. Values are induce apoptosis activation consistent with normalized to b-galactosidase expression to adjust for transfection efficiency. Post previous reports. Reintroduction of Nur77 via 48 hours transfection cells were taken SF transient transfection restored responsiveness to overnight and treated for 12 hours with the IGFBP-3 overexpression in the Nur77 knockout indicated doses of IGFBP-3 **P<0.005 line (Fig. 4). Thus, rescue of IGFBP-3 induced relative to control vector alone, and also for combination compared to Nur77 alone. 7 apoptosis was associated with restoration of Nur77 expression. Nur77 is phosphorylated by Jun N-terminal kinase (JNK) and by Akt. This phosphorylation is required for its nuclear export and involves JNK activation (phosphorylation) and inhibition of Akt phosphorylation. We investigated the effect of IGFBP-3 treatment of cancer cells on JNK phosphorylation and Akt phosphorylation and activation. (Figure 5) A, Western immunoblot for phospho and total Akt; also for phospho and total JNK B, Akt kinase assay as assessed by phosphorylation of a GSK-3 fusion protein after immunoprecipitation of Akt. Experiments were repeated three times. Treatment with 1 mcg/ml of IGFBP-3 activated JNK in 22RV1 prostate cancer Figure 5. IGFBP-3 induces cells. Associated with this is a significant phosphorylation of c-Jun N- reduction in phosphorylated Akt and Akt activity terminal kinase and suppression as evidence by an Akt kinase assay . of Akt phosphorylation and activity. Figure 6. IGFBP-3-induced apoptosis involves translocation of Nur77 in CaP xenografts in vivo.. (A) Cross-sectioned LAPC-4 tumors stained with anti- Nur77 (100X, oil immersion). Diaminobenzidine (DAB) was used as a chromogen (dark brown), and commercial hematoxylin was used for counterstaining (blue nuclei). Note predominant nuclear Nur77 staining in control tumor versus empty blue nuclei in the IGFBP-3-treated tumor. Top panel is 40X magnification; lower panel is 100X magnification (oil immersion). Arrows indicate nuclei in which Nur77 is intra-nuclearly stained or translocated to the mitochondria. Control immunohistochemistry shows competition of signal by blocking peptide, as well as lack of binding of secondary antibody. (B) Quantitation of TUNEL staining was used as a measure of apoptosis. TUNEL staining was quantitated by pixel histogram as indicated in bar graph. **P<0.005 relative to control treatment. 8 To determine the effect of IGFBP-3 on Nur77 translocation and apoptosis in vivo, we utilized LAPC-4 cells in Matrigel to create human CaP xenografts on SCID mice. Accordingly, cells were injected and tumors established for 2 weeks. At that time, IGFBP-3 or saline was given as a daily injection at a dose of 4 mg/kg/d intraperitoneally (IP) for 21 days, after which mice were euthanized. Tumor sections were stained with a Nur77 antibody to assess subcellular localization in response to IGFBP-3 as well as subjected to TUNEL staining as a marker for apoptosis. Consistent with our in vitro data, Nur77 exhibited a predominantly nuclear staining pattern in the rapidly growing control tumors (Fig. 6A, upper panels). Treatment with IGFBP-3 resulted in predominantly cytoplasmic staining of Nur77 with hematoxylin-counterstained nuclei prominent (Fig. 6A, lower panels). Associated with this was a marked significant increase in staining for TUNEL as a marker of apoptosis (Fig. 6B). In concert, these data support a novel extra-nuclear mechanistic role for the orphan receptor Nur77 in mediating the apoptotic actions of IGFBP-3 in vitro and in vivo. b. Validate a putative nuclear export sequence (NES) in IGFBP-3. (Months 7-9). We have successfully created the NES sequence mutants via 2 round PCR, and are characterizing the response to Leptomycin B currently. Primers used were L224A_L227A, 5'- ggaagacacactgaatcacgcgaagttcgccaatgtgctgagtcccagg-3' and L224A_L227A_antisense 5'- cctgggactcagcacattggcgaacttcgcgtgattcagtgtgtcttcc-3'. Sequences have been verified. 9 c. Delineate the mitochondrial targeting sequence (MTS) in IGFBP-3. (Months 7-9). Fig. 7. Verification of the mitochondrial targeting sequence (MTS) mutant by sequencing. We have constructed the MTS-deletion mutants of IGFBP-3 with FLAG fusions via PCR and are characterizing subcellular co-localization with organelle specific markers currently with various imaging techniques. 10 d. Assess the effects of mutant IGFBP-3 (NES and MTS) on apoptosis. (Months 9-12) We have begun to assess the effects of the NES and MTS mutants on apoptosis and show that mutation prevents effeicient apoptosis by IGFBP-3. (Fig. 8) Task 2. Define the role of the IGFBP-3/RXR/Nur77 apoptotic pathway in vivo in the TRAMP mouse model. a. We will age the Nur77 KO and IGFBP- 3 KO mice to determine if and when Fig. 8. Mutation of the NES and MTS these mice develop prostatic pre- prevent efficient apoptosis by IGFBP-3. neoplastic lesions. (Months 1-18) Apoptosis in 22RV1 prostate cancer cells We have established cohorts and was measured after 48h of transfection by are currently aging them. WT and mutant IGFBP-3 by Lipofectamine in expression vectors by a histone-associated b. Examine the role of IGFBP-3 in DNA fragment ELISA (Roche). apoptosis induced by androgen withdrawal by castration of TRAMP and IGFBP-3 KO:TRAMP mice i. Develop IGFBP-3 KO:TRAMP cross and assess mouse aging and tumor chronomics. (Months 1-24). Total 100 mice. We are currently breeding these mice and genotyping. After some initial problems with mouse mating (mice were not mating secondary to loud construction noise from adjacent building project), we are happy to report that after moving to a new location the mice have resumed breeding. ii. Examine subcellular localization of RXR, IGFBP-3, and Nur77 utilizing in situ immunohistochemistry and immunoblot post cellular fractionation in tumors before and after castration (25 mice/group; 13 castration and 12 “sham” castration) at 12 weeks of age (Total 75 mice). Animals to be sacrificed after 6h (2 mice/group) and then every 24h for 4 days. (months 1- 6) 11

See more

The list of books you might like