loading

Logout succeed

Logout succeed. See you again!

ebook img

DTIC ADA614705: Topically Delivered Adipose Derived Stem Cells Show an Activated-Fibroblast Phenotype and Enhance Granulation Tissue Formation in Skin Wounds PDF

file size0.68 MB
languageEnglish

Preview DTIC ADA614705: Topically Delivered Adipose Derived Stem Cells Show an Activated-Fibroblast Phenotype and Enhance Granulation Tissue Formation in Skin Wounds

Topically Delivered Adipose Derived Stem Cells Show an Activated-Fibroblast Phenotype and Enhance Granulation Tissue Formation in Skin Wounds Seok Jong Hong1*, Sheng-Xian Jia1., Ping Xie1., Wei Xu1, Kai P. Leung2, Thomas A. Mustoe1, Robert D. Galiano1* 1Department of Surgery/Division of Plastic and Reconstructive Surgery, Laboratory for Wound Repair and Regenerative Medicine, Feinberg School of Medicine,NorthwesternUniversity,Chicago,Illinois,UnitedStatesofAmerica,2MicrobiologyBranch,USArmyDentalandTraumaResearchDetachment,Instituteof SurgicalResearch,FortSamHouston,Texas,UnitedStatesofAmerica Abstract Multipotentmesenchymalstemcells(MSCs)arefoundinvarioustissuesandcanproliferateextensivelyinvitro.MSCshave been used in preclinical animal studies and clinical trials in many fields. Adipose derived stem cells (ASCs) have several advantages compared to other MSCs for use in cell-based treatments because they are easy to isolate with relative abundance. However, quantitative approaches for wound repair using ASCs have been limited because of lack of animal models which allow for quantification. Here, we addressed the effect of topically delivered ASCs in wound repair by quantitative analysis using the rabbit ear model. We characterized rabbit ASCs, and analyzed their multipotency in comparison to bone marrow derived-MSCs (BM-MSCs) and dermal fibroblasts (DFs) in vitro. Topically delivered ASCs increased granulation tissue formation in wounds when compared to saline controls, whereas BM-MSCs or DFs did not. ThesestudiessuggestthatASCsandBM-MSCsarenotidentical,thoughtheyhavesimilarsurfacemarkers.Wefoundthat topicallydeliveredASCsareengraftedandproliferateinthewounds.WeshowedthattransplantedASCsexhibitedactivated fibroblast phenotype, increasedendothelial cellrecruitment, and enhancedmacrophage recruitment invivo. Citation:HongSJ,JiaS-X,XieP,XuW,LeungKP,etal.(2013)TopicallyDeliveredAdiposeDerivedStemCellsShowanActivated-FibroblastPhenotypeand EnhanceGranulationTissueFormationinSkinWounds.PLoSONE8(1):e55640.doi:10.1371/journal.pone.0055640 Editor:LeonardEisenberg,NewYorkMedicalCollege,UnitedStatesofAmerica ReceivedAugust27,2012;AcceptedDecember28,2012;PublishedJanuary31,2013 Thisisanopen-accessarticle,freeofallcopyright,andmaybefreelyreproduced,distributed,transmitted,modified,builtupon,orotherwiseusedbyanyonefor anylawfulpurpose.TheworkismadeavailableundertheCreativeCommonsCC0publicdomaindedication. Funding:ThisstudywassupportedbytheUnitedStatesArmyMedicalResearchandMaterialCommand(W81XWH-10-2-0054).Flowcytometrywassupported bytheNorthwesternUniversityFlowCytometryFacilityandaCancerCenterSupportGrant(NCICA060553).Thefundershadnoroleinstudydesign,data collectionandanalysis,decisiontopublish,orpreparationofthemanuscript. CompetingInterests:Theauthorshavedeclaredthatnocompetinginterestsexist. *E-mail:[email protected](SJH);[email protected](RG) .Theseauthorscontributedequallytothiswork. Introduction degradationoftherapeuticgrowthfactorsinthewoundsiteorthe requirement for the administration of these growth factors in a Woundrepairisacomplexanddynamicprocesswhichconsists proper spatiotemporal sequence in order to improve wound of inflammation, angiogenesis, and tissue formation and remod- repair. Recent progress in regenerative medicine has suggested eling[1,2,3].Uponinjury,fibrinclotsaredepositedonthewound multipotentstemcellsorprogenitorcellsfortissuerepair[5,6,7,8]. site to prevent hemorrhage. Circulating platelets migrate to the Itisthoughtthatthetransplantedstemcellsorprogenitorcellscan wound and release inflammatory signals such as transforming integrate themselves to the environment and control the wound growth factor-b (TGF-b), platelet-derived growth factor (PDGF), repairprocessbysecretingfactorsandcommunicatingwithother and epidermal growth factor (EGF). This is followed by the cellstoimprovetheclinicaloutcomeofwoundrepair.Inaddition, infiltration of neutrophils and macrophages and the migration of stem cells could mediate wound repair by replacing damaged keratinocytestothewoundtorecoverthebarrierfunctionofskin. tissue by both differentiating into the required cells and inducing Endothelial cells and fibroblasts migrate to the site and build up surrounding cells todedifferentiate toreplace thetissues. granulation tissues by depositing collagen and other extracellular MSCs have been isolated from various tissues such as bone matrices.Duringthefinalstagesofrepair,fibroblastsremodelthe marrow,adiposetissue,umbilicalcordblood,skeletalmuscle,and collagen by producing matrix metalloproteinases (MMPs) over a brain [7,9]. MSCs have ability to attach to plastic to form course of several months. Thus wound repair is a highly fibroblast-likecoloniesandtoproliferateextensivelyinvitro.MSCs orchestrated sequential process in which signals of one cell type can be differentiated into multiple lineage cells: chondrocytes, regulate othercell typesina cascade. cardiomyocytes,adipocytes,osteoblasts,endothelial,andneuronal Growthfactorshavebeenusedtoimprovetheclinicaloutcome cells[7,10,11,12,13].AmongMSCs,ASCscanbeeasilyobtained of the wound repair process. It has become clear that the use of in large quantities with minimal morbidity and invasiveness growth factors, specifically as single-agent therapies, has limited [14,15,16].ASCsactivaterepairprocessesinaparacrinemanner impactonwoundrepair[4].Thiscouldbepartlyduetotherapid by secreting cytokines and growth factors, such as vascular PLOSONE | www.plosone.org 1 January2013 | Volume 8 | Issue 1 | e55640 Report Documentation Page Form Approved OMB No. 0704-0188 Public reporting burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing data sources, gathering and maintaining the data needed, and completing and reviewing the collection of information. Send comments regarding this burden estimate or any other aspect of this collection of information, including suggestions for reducing this burden, to Washington Headquarters Services, Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington VA 22202-4302. Respondents should be aware that notwithstanding any other provision of law, no person shall be subject to a penalty for failing to comply with a collection of information if it does not display a currently valid OMB control number. 1. REPORT DATE 2. REPORT TYPE 3. DATES COVERED 01 JAN 2013 N/A - 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Topically Delivered Adipose Derived Stem Cells Show an 5b. GRANT NUMBER Activated-Fibroblast Phenotype and Enhance Granulation Tissue Formation in Skin Wounds 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER Hong S. J., Jia S-X., Xie P., Xu W., Leung K. P., Mustoe T. A., Galiano R. 5e. TASK NUMBER D., 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION United States Army Institute of Surgical Research, JBSA Fort Sam REPORT NUMBER Houston, TX 9. SPONSORING/MONITORING AGENCY NAME(S) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM(S) 11. SPONSOR/MONITOR’S REPORT NUMBER(S) 12. DISTRIBUTION/AVAILABILITY STATEMENT Approved for public release, distribution unlimited 13. SUPPLEMENTARY NOTES 14. ABSTRACT 15. SUBJECT TERMS 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF 18. NUMBER 19a. NAME OF ABSTRACT OF PAGES RESPONSIBLE PERSON a. REPORT b. ABSTRACT c. THIS PAGE UU 11 unclassified unclassified unclassified Standard Form 298 (Rev. 8-98) Prescribed by ANSI Std Z39-18 ASCsinWoundHealing endothelial growth factor (VEGF), TGF-b, granulocyte/macro- Ficoll-Paque Plus (1.077 g/ml, GE Healthcare, Piscataway, NJ) phagecolonystimulatingfactor(GM-CSF),stromalderivedfactor and centrifuged at 2,0006g for 30minutes. The interface layer 1 (SDF-1), and hepatocyte growth factor (HGF) [13,17,18,19]. containing BM-MSCs was recovered and washed in HBSS. BM- Thesecellsalsorecruitendogenousstem(orprogenitor) cellsand MSCswerethenculturedinMinimumEssentialMedium(MEM) can stimulate them to differentiate into the required cell types. containing 10%FBS. ASCssuppressimmunereactionsandhavereducedhistocompat- FortheisolationofrabbitDFs,skintissuewascutintosquared abilityantigens[20,21,22,23].ASCshavebeenusedinpreclinical pieces(,161 cm2)andplacedwiththeepidermisfacedownina animals studies and clinical trials in the field of reconstructive dish.Dispase(LifeTechnologies,Carlsbad,CA)with5 mg/mlin surgery, orthopedics, andimmunediseases [7,15,24,25]. PBSwasaddedandincubatedovernightat4uC.Dermaltissuewas Manyanimals-suchasmouse,rat,rabbit,andpig-havebeen mincedmanuallyafterremovingepidermaltissueanddigestedin used in wound healing studies. However, there is no ideal model 0.25% collagenase type II (Life Technologies) in HBSS at 37uC which exactly resembles human wounds. For example, open overnight. The solution was filtered through a 100mm sterile wounds in rodents heal quickly primarily due to wound nylon mesh filter and spun at 5006g for 10minutes. The pellet contraction because of the subcutaneous panniculus carnosus was then resuspended in DMEM medium containing 10% FBS muscle, which is not characteristic of human wounds. Rather, andcultured in culture dishes. human skin wounds heal to a significant degree by generation of new tissue (granulation tissue and re-epithelialization) in addition In vitro differentiation of MSCs to mesodermal lineage tocontraction.Thus,thoughASCsareapromisingcandidatefor For adipogenic differentiation, MSCs were seeded in 24 well cell therapy in wound repair, there have been limitations in the plates at a concentration of 26104 and cultured in adipogenesis quantitative analysis of wound repair [26,27,28,29]. The rabbit differentiationmedium(LifeTechnologies).After8daysculturing, earmodelhasauniqueadvantageinwoundhealingstudybecause cellswerefixedin4%paraformaldehydeandOilRedOstaining of the ability to evaluate the role of therapeutic treatment in was performed to detect intracellular lipid accumulation. For wounds by quantification of epithelialization and granulation osteogenicdifferentiation,MSCswereseededincollagen(50 mg/ tissue formation [30,31,32,33]. In addition, the presence of a ml)coated24wellplatesataconcentrationof16104andcultured cartilage wound base acts to stent open the wound and prevent in osteogenesis differentiation medium (Life Technologies) for 28 contraction. In this report, we addressed the effect of topically or35days.Cellswerefixedin4%paraformaldehydeandAlizarin deliveredASCsinwoundrepairbyquantitativeanalysisusingthe RedSstainingwasperformedtodetectaccumulatedcalcium.For rabbit ear model. We characterized rabbit ASCs, and analyzed chondrogenic differentiation, a total of 86104 MSCs in 20ml of theirmultipotencyincomparisontoBM-MSCsandDFsinvitro.In culturemediumwereplatedinthemiddleof24wellplates.After addition, the effect of wound healing by ASCs treatment was 3 hours incubation, chondrogenesis differentiation medium was compared to BM-MSCs and DFs treatment. Wound analysis provided(LifeTechnologies).After14or21daysofculture, cells suggests that topically delivered ASCs exhibit activated fibroblast were fixed in 4% paraformaldehyde. Then, Alcian Blue Staining phenotype, enhance macrophage recruitment, and increase wasperformed,whichdetectedsulfatedproteoglycanrichmatrix. granulation tissueformation inwounds. Reverse transcription-quantitative PCR (RT-qPCR) and Materials and Methods Western blot analysis Total RNA was prepared by treatment with Trizol Reagent Isolation and culture of ASCs, BM-MSCs, and DFs (Sigma-Aldrich, St.Louis, MO)andgenomicDNA was removed ASCs were isolated as described previously with some using theTurbo DNA-free kit (Ambion,Austin, TX).cDNA was modification [11,31,34,35]. Briefly, inguinal fat pads were made from total RNA using superscript II (Invitrogen, Carlsbad, dissected out from young female New Zealand White rabbits (3– CA) with random primers. PCR was performed to detect 6 months old, ,2–4kg) and placed in sterile, pre-warmed expression of mRNAs. For the quantitative analysis, RT-qPCR phosphate-buffered saline (PBS). Fat pads were then washed analysesusingSYBRgreenIwereperformedusinganABIprism several times in PBS, minced manually, and digested in 0.075% 7000sequencedetectionsystem(AppliedBiosystems,FosterCity, collagenase type II in Hank’s Buffered Salt Solution (HBSS) for CA). Expression of each gene was normalized to the level of 1 hour at 37uC in a shaking water bath. The stromal vascular glyceraldehyde-3-phosphatedehydrogenase(Gapdh)togetaDCt. fraction (SVF) containing ASCs was isolated by centrifugation at The 22DDCt method was used to calculate gene expression 5006g for 5 minutes, resuspended in HBSS, filtered through a differencebetweendifferentiatedandcontrolsamples.Expression 100mm sterile nylon mesh filter, and then spun again at 5006g ofgeneswasdetectedbyPCRwiththefollowingoligonucleotides for 5 minutes. The resultant pellet was resuspended in 10ml of – Gapdh (59- AGGTCATCCACGACCACTTC -39 and 59- red blood cell (RBC) lysis buffer (10mM KHCO3, 150mM GTGAGTTTCCCGTTCAGCTC -39), adiponectin (59- NH4Cl,0.1mMEDTA),andallowedtositatroomtemperature CCTGGTGAGAAGGGTGAAAA -39 and 59- GCTGAGCGG- for 10minutes. The supernatant was removed by centrifugation TAGACATAGGC -39), osteopontin (59- AGGATGAGGAC- followingRBClysisandthepelletwasresuspendedinDulbecco’s GATGACCAC -39 and 59- CACGGCCGTCGTATATTTCT - Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) 39), col10a1 (59- GGAAAACAAGGGGAGAGAGG -39 and 59- containing 10% fetal bovine serum (FBS, Thermo Scientific, CCAGGAGCACCATATCCTGT -39). Rockford,IL)andplatedinculturedishes.Afterovernightculture, For Western blot analysis, MSCs were washed with PBS, the media was then removed and replaced with fresh culture harvested,andlysedwithRIPAbuffer(150 mMNaCl,1%NP-40, medium.ThemediumwaschangedtwiceaweekandASCswere 0.5% deoxycholic acid, 0.1% SDS, 50mM Tris-HCl, pH 7.5). subcultured whentheyreached 80–90%confluency. EqualamountsofproteinwereaddedtoaSDSpolyacrylamidegel BM-MSCswereisolatedfromthefemoralmedullarycavitiesof and transblotted on nitrocellulose membranes. Membranes were rabbits.BonemarrowwascollectedinPBScontaining2 units/ml incubated with anti-CD29 (1:5,000 dilution; Abcam, Cambridge, heparin and left at room temperature for 10minutes. After MA), anti-CD44 (1:5,000 dilution; Abcam), anti-CD90 (1:5,000 removingthefloatingfatlayer,thesolutionwasaddedto5 mlof dilution; Abcam), or anti-CD105 (1:2,500 dilution, Abcam) and PLOSONE | www.plosone.org 2 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing then incubated with horseradish peroxide-conjugated secondary using 3,39-diaminobenzidine (DAB). Hematoxylin was used as a antibody(1:5,000dilution;VectorLaboratories,Burlingame,CA). counterstain. Mouse anti- alpha smooth muscle actin (a-SMA, Specific bands were visualized using an Enhanced Chemilumi- 1:2,000 dilution, Santa Cruz Biotechnology, Santa Cruz, CA), nescence (ECL) detection kit (GE Healthcare). The blots were mouseanti-neutrophilMarker(RPN3/57,1:1,000dilution,Santa probed with anti-b-actin antibody (1:5,000 dilution; Sigma– Cruz Biotechnology), mouse anti-CD3 (1:1,000 dilution, Santa Aldrich) to serve as a control for gel loading. The intensity of Cruz Biotechnology), and mouse anti-macrophage (1:1,000 signal was measured using the NIH image program (ImageJ, dilution, Abcam) were usedasprimary antibodies. http://rsb.info.nih.gov/ij/). For immunofluorescence microscopy, chicken anti-GFP (1:200 dilution, Life Technologies), a-SMA (1:200 dilution, Santa Cruz Labeling of ASCs with green fluorescence protein (GFP) Biotechnology), mouse anti-collagen III (col3, 1:200 dilution, TostablyexpressGFP,ASCsweretransducedwithalentivirus Novus Biologicals, Littleton, CO), mouse anti-CD31 (1:25 (LV-GFP)inwhichGFPexpressionisdrivenbyacytomegalovirus dilution, Abcam), mouse anti-Ki67 (1:20 dilution, Novocastra, (CMV) promoter according to the manufacturer’s protocol (Life Buffalo Grove, IL), and mouse anti-PCNA (1:100 dilution, BD Technologies). Briefly, 2 multiplicity of infection (MOI) of Biosciences, San Jose, CA) antibodies were used as primary lentivirus was infected to ASCs in the presence of 6mg/ml of antibodies. Alexa Fluor 488 or 555 conjugated secondary polybrene.Transducedcellswereselectedbytreating10 mg/mlof antibodies were usedto detect theprimary antibody (Invitrogen). blasticidin. GFP expressing cells were further selected by flow Nuclei were stained with 49,6-diamidino-2-phenylindole (DAPI, cytometry using the Northwestern University Flow Cytometry 1 mg/ml). Facility. Results Treatment of MSCs to the full thickness excisional Isolation and characterization of rabbit ASCs wounds of rabbit ears RabbitASCshavespindleshapesduringinvitroprimaryculture Young, adult New Zealand White rabbits (3–6 months, ,2– andaremorphologicallysimilartoDFs(Figure1A&1C).Rabbit 4 kg)wereacclimatedtostandardhousingandfedadlibitumunder BM-MSCs have a larger surface area compared to ASCs an experimental protocol approved by the Northwestern Univer- (Figure1B).WecharacterizedASCsbyanalyzingsurfacemarkers sity Animal Care and Use Committee (protocol number: 2010- and multipotency of differentiation. Unlike embryonic stem cells, 1841). Rabbits were anesthetized with an intramuscular injection which have specific makers such as Oct-4 and SSEA, MSCs ofketamineandxylazineasdescribed[31,32].Woundsweremade cannot be characterized by specific markers because definitive witha7 mmsurgicalpunchbiopsy(Acuderm,Ft.Lauderdale,FL) cellular markers are not yet identified. Thus, a series of positive downto,butnotthrough,thecartilage.Sixwoundswerecreated and negative surface markers are needed for the characterization perear.Tissuewasthenelevatedinanefforttoremoveepidermis ofMSCs[7,9,13,15,16,25,36].WeselectedCD29,CD44,CD90, and dermis, but leave the perichondrium intact. MSCs were andCD105aspositivemarkers.Twohematopoieticcellmarkers, topically delivered to wounds in a specific manner to allow each CD34 and CD45, were used as negative markers. Given the animal to serve as its own internal control; for example, MSCs limited information of antibodies in rabbit protein, we tested were delivered into 6 wounds on the one ear and saline was antibodies that were designed to detect human antigens. Speci- delivered into 6 wounds on the contralateral ear of the rabbits. ficityofantibodies,exceptCD45,wasconfirmedbyWesternblot Wounds are then covered with semi-occlusive dressings (Tega- analysis (data not shown). Expression of CD34 was detected in dermTM,3MHealthCare,St.Paul,MN).Woundswereharvested neither ASCs nor BM-MSCs (data not shown). We tested with a 10mm surgical punch biopsy tool (Acuderm) at post- antibodies from four different vendors but could not find operativeday(POD)7aftereuthanizationwiththeadministration antibodies which are specific to rabbit CD45 protein (data not of intracardiac Euthasol followed by a bilateral thoracotomy to shown). Expression of CD29, CD44, CD90, and CD105 was assurethedeathofrabbits.Woundswereimmersedin10%zinc- detected without significant changes, though minor variations formalin forfixation. werefoundwhenquantifiedwiththeNIHImageJprogram,from passage 1 through passage 9 both in ASCs (Figure 1D) and BM- Histological and immunochemical analysis of wounds MSCs(Figure S1). Formalin-fixed wounds were processed, embedded in paraffin blocks,andthensectionedonamicrotomeatathicknessof4mm. Multi-lineage differentiation potential of ASCs Thesectionswerestainedwithhematoxylinandeosin(H&E)and WeaddressedthemultipotencyofASCs,andcomparedthemto histological analysis - epithelial gap and granulation area - was BM-MSCsandDFs.Foradipogeneis,OilRedOstainingshowed performed using a Nikon Eclipse 50i light microscope and NIS an accumulation of lipid droplets in the cytoplasm of ASCs and ElementsBRsoftware(Nikon,Melville,NY).Slideswereanalyzed BM-MSCswhichweregrowninadipogenesismediumfor8days and scored in a blinded fashion and statistical analysis was (Figure2A&B).Incontrast,fewerlipiddropletswerefoundinthe performed using the Student’s t-test (two-tailed and unpaired) cytoplasm of DFs (Figure 2C). Alcian Blue staining showed when comparing 2 study groups, and 1-way analysis of variance positive signals in ASCs and BM-MSCs which were cultured in (ANOVA) when comparing the means of multiple groups. The chondrogensismediumfor14daysandsignalswerestrengthened level of significance will be set at p,0.05. The n numbers in the at day 21 culture (Figure 2D & E). Alcian Blue staining positive histological analysis figures represent total wounds from different signals were found in DFs culture, though those signals were rabbits whichhad6 woundsper ear. weaker compared to ASCs and BM-MSCs (Figure 2F). Accumu- For the immunostaining, sections were treated with antigen latedcalciumwasdetectedinASCsandBM-MSCsbutnotinDFs retrieval solution (Dako, Carpinteria, CA) by boiling for 20min- by Alizarin Red S staining at day 28 culture in the osteogenesis utesbeforeantibodytreatment.Forimmunohistochemistry(IHC), medium (data not shown). Both ASCs and BM-MSCs showed a the signal was detected using the Vectastain kit (Vector highaccumulationofcalciumatday35culture(Figure2G&H). laboratories) after primary antibody treatment and visualized DFs also showed an accumulation of calcium, although it was a PLOSONE | www.plosone.org 3 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing Figure1.MorphologyandsurfacemarkersofrabbitMSCs.(A–C):BrightfieldimagesofrabbitASCs(A),BM-MSCs(B),andDFs(C).Cellswere growninculturedisheswithgrowthmediumandphotosweretaken.Scalebar;100mm.(D):Westernblotanalysis.WholecellextractofrabbitASCs frompassage1(P1)toP9waspreparedandloaded20mgperwell.TheexpressionofCD29,CD44,CD90,andCD105weredetectedwiththeirspecific antibodiesasindicated.b-actinwasdetectedasaloadingcontrol. doi:10.1371/journal.pone.0055640.g001 smalleramountcomparedtoASCsandBM-MSCsintheday35 differences such as epithelial gap and granulation tissue areas culture (Figure 2I). were digitally quantified as previously described (Figure S3) We analyzed the expression of specific genes of adipocyte, [30,31]. All three concentrations of ASCs increased granulation osteocyte, and chondrocyte lineages by RT-qPCR [11]. Expres- tissue area (data not shown). Wounds treated with highest ASCs sion of an adipocyte specific gene, adiponectin, was increased by number - 36105 - had a larger epithelial gap. This means there 35-fold and 17-fold in ASCs and BM-MSCs, respectively, when was minor inhibition of keratinocyte migration, though this was culturedinadipogenicmediumfor8days(FigureS2A).However, not statistically significant(data not shown). inductionofadiponectininDFswasnotfoundinthesameculture To determine the dose of ASCs which does not inhibit condition. Expression of an osteocyte specific gene, osteopontin, epithelialization but increases granulation tissue formation, was increased by 3.2-fold and 2.7-fold in ASCs and BM-MSCs, wounds on one ear were treated with 16105 ASCs and wounds respectively. This increase in gene expression was not found in on thecontralateral ear were treated with 36104ASCs. Wounds DFs when it was cultured in osteogenic medium for 28 days with 16105 ASCs (n=11) had similar epithelial gaps (FigureS2B).Expressionofachondrocytespecificgene,Col10a1, (4.35+0.42 mm, Figure S4A) compared to wounds with 36104 wasincreasedby6-fold,12-fold,and1,515-foldinDFs,ASCs,and ASCs (n=12, 4.09+0.32 mm). However, wounds treated with BM-MSCs, respectively, when cultured in chondrogenic medium 16105ASCsshowedgreatergranulationtissuearea,thoughitdid for21days(FigureS2C).TheseresultssuggestthatASCsandBM- not reach statistically significance (Figure S4B, 1.4860.21 vs. MSCs have differential properties, though they share similar 0.9560.13mm2,p=0.09).Thuswedeterminedthat16105ASCs surface markers and have multilineage differentiation potential. as an optimumnumber for woundhealing study. ASCs and BM-MSCs are prone to differentiate into adipocytes Next, we increased the number of wounds and animals to and chondrocytes, respectively. DFs have less multipotency increase power of statistical analyses. With each rabbit serving as compared toASCs andBM-MSCs. its own internal control, 16105 of P3 ASCs were delivered to woundsononeearandthewoundsoncontralateralearreceived ASCs enhance granulation tissue formation in wounds saline alone as control as described above and wounds were TodeterminetheoptimalquantityofASCstopromotewound analyzed at POD7. When compared to saline treated control healing, we treated wounds with different amounts of ASCs. wounds, ASCs treated wounds showed increased granulation ThoughweshowedtheconservationofsurfacemarkersofASCsin tissue area (0.5060.07mm2 vs. 1.1360.14 mm2, p=0.0001, vitro, weused an early passage (P3) ASCs inthese experiments to Figure 3A). ASCs treatment did not affectepithelialization of the avoidchangesofcharacteristicsofASCsoverthelongterminvitro epidermis when compared to saline treated wounds culture. ASCs were harvested, washed in PBS to remove cell (4.0360.31mm vs. 3.9160.26 mm, respectively; p=0.8, Figure culture medium, and resuspended in PBS. Three different S5). For comparison, 16105 of P3 BM-MSCs (or DFs) were amounts of ASCs - 36105, 16105, and 36104 - in 7 ml of PBS deliveredtowoundsononeearandsalinecontrolweredelivered were delivered to each 7 mm wound of one ear. In the to wounds on the contralateral ear. We found that granulation contralateral ear, 7ml of PBS were delivered to each wound as a tissue area was not significantly changed by BM-MSCs control. Wounds were harvested at POD7 and histological (0.96+0.32 mm2 vs. 1.15+0.13mm2, Figure 3B) or DFs PLOSONE | www.plosone.org 4 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing Figure2.RabbitMSCsdifferentiatetomesodermallineagesinvitro.Passage2ASCs(A,D,G),BM-MSCs(B,E,H),andDFs(C,F,I)wereused fordifferentiation.(A–C):Adipogenicdifferentiation.Cellswereculturedinadipogenesisdifferentiationmediumfor8days.OilRedOstainingwas performed to detect lipid accumulation. Nuclei were stained with Hematoxylin. (D–F): Chondrogenic differentiation. Cells were cultured in chondrogenesis differentiation medium for 21 days. Alcian blue staining was performed.(G–I): Osteogenic differentiation. Cells were cultured in osteogenesis differentiation medium for 35 days. Alizarin Red S staining was performed to detect calcium accumulation. Abbreviation: MSCs, mesenchymalstemcells;ASCs,adiposederivedstemcells;DFs,dermalfibroblasts;BM-MSCs,bonemarrowderivedmesenchymalstemcell.Scalebar; (A–F)50mm,(G–I)100mm. doi:10.1371/journal.pone.0055640.g002 (0.6260.10mm2vs.0.7060.10mm2,Figure3C)treatmentwhen Interestingly, the majority of transplanted ASCs showed a-SMA compared to saline treated wounds. We also performed an signal (cells with yellow color, Figure 4C, D, F, G & Figure S7). ANOVA test to compare the effect of three different cell types - WealsoobservedASCswhichdidnotexpress a-SMA(cellswith ASCs, BM-MSCs, and DFs, on wound repair (Figure S6). The green color,Figure 4 &Figure S7). posthoct-testshowedthesignificantdifferencebetweentheASCs We next analyzed expression of collagen III (Col III), which is and DFs, BM-MSCs and DFs, while there’s no statistically produced by myofibroblasts before synthesis of mechanically significant difference between ASCs and BM-MSCs. However, stronger collagen I. Expression of Col III was detected in wound given the variation among rabbits which are not syngeneic, each bed(FigureS8A,C,E)andgranulationtissue(FigureS8A,D,F), rabbit served as its own internal control in our wound healing thoughthesignalwasweak.ExpressionofColIIIwasdetectedin analyses. Thus, we think that the Student t-test is more accurate the outside of wounded area (Figure S8A & B). Transdifferentia- than theANOVA test forour purpose. tion of ASCs to endothelial cells was addressed using a platelet endothelial cell adhesion molecule (PECAM-1, CD31) - specific Transplanted ASCs exhibit activated fibroblast antibody. Expression of CD31 was prominently detected in the phenotype granulationtissue(FigureS9).However,co-expressionofCD31in transplantedASCswasnotdetected(FigureS9).Thus,transdiffer- Wound healing is a complex process in which interactions of entiationoftransplantedASCstoendothelialcellwasnotfoundat diversecelltypesandcytokinesareinvolved.ASCscancontribute POD7 in the rabbit wounds. Proliferation of transplanted ASCs towoundhealingbyeithercytokineexpression,ordifferentiation wasdetectedwithKi-67orPCNAspecificantibodies(Figure5& andrepopulationinwounds.WeanalyzedthetransplantedASCs Figure S10). in wounds using GFP-expressing ASCs (GFP-ASCs). A total of 16105 GFP-ASCs in saline was delivered into each wound. Wounds were harvested at POD7 and histological analysis was Analysis of cells involved in wound healing in the ASCs performed.Immunofluorescencestainingwithanti-GFPantibody treated wounds showed that transplanted ASCs were evenly distributed in the WefurtheranalyzedASCstreatedwoundsimmunohistochem- wound bed and granulation area (Figure 4A & Figure S8A). icallyandcomparedthemwithsalinetreatedwounds.Expression Duringthewoundrepairprocess,fibroblastsmigratetothewound of a-SMA was found in the granulation tissue of ASCs treated site and build up granulation tissue by depositing collagen and woundsandsalinetreatedcontrolwounds(Figure6A,E).a-SMA other extracellular matrices [37,38]. These activated myofibro- signalsinASCstreatedwounds(Figure6E)arefromendogenous blasts are characterized by a-SMA expression. Immunofluores- activatedfibroblastcellsandtransplantedASCs(Figure4&Figure cence staining with anti-a-SMA antibody detected endogenously S7). a-SMA signals in Figure 6A are from endogenous activated activated fibroblasts (cells with red color, Figure 4 & Figure S7). fibroblast cells. The transplanted ASCs are allogeneic because PLOSONE | www.plosone.org 5 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing Figure 3. Histological quantification of MSCs treated wounds. (A–C): A total of 16105 ASCs (A), BM-MSCs (B), and DFs (C) in PBS were delivered to 7mm wounds on one ear. In the contralateral ear, PBS alone was delivered as a control. Wounds were harvested at POD7 and granulationtissueareawasmeasured.Numberofwoundsanalyzed;(A,n=35forsaline&n=36forASCs;B,n=17forsaline&n=20forBM-MSCs,C, n=17forsaline&n=24forDFs).Nrepresentsthetotalnumberofwoundsfromsix(A)orfour(B,C)rabbits.Datashownasmean+SEM.***p,0.001, ns=notsignificant. doi:10.1371/journal.pone.0055640.g003 syngeneic rabbits are not available. We investigated whether increase endothelial cell recruitment, and enhance wound repair transplanted allogeneic ASCs evoke immune reactions in vivo, by macrophagerecruitment. thoughimmunemodulatorypropertyofASCshasbeenproposed [16,20,21,39]. Neither CD3 (T cell antigen) nor CD45 (common Discussion leukocyte antigen) positive signals were found by their specific BM-MSCs were first isolated among various MSCs and have antibodies in ASCs treated wounds at POD7 (Figure 6F & data potentialtocontributetowoundrepairinmanytissues.However, notshown).Angiogenesisisoneofcriticalfactorsinwoundrepair the procedure for extracting BM-MSCs is relatively invasive and process. Blood vessel formation in granulation tissue, which is could cause patient morbidity. Extended time is required to determined by endothelial marker (CD31) staining, was detected expandBM-MSCsinculturetogetalargeenoughnumberofcells in ASCs treated wounds and control wounds (Figure 6C, G). for clinical uses. ASCs have several advantages compared with Interestingly, a few CD31 positivecells were foundinthewound BM-MSCs because they are easy to isolate with relative beds of ASCs treated wounds, though blood vessel structure was abundance [9,14,27]. ASCs and BM-MSCs have similar surface not found (Figure 6H). In contrast, we could not detect CD31 markers,cytokinesandgeneexpressionprofiles[7,9,16,42].Thus, positivecellsinthewoundbedsofsalinetreatedwoundsatPOD7 weselectedASCsasacelltherapyreagentforwoundrepairinthis (Figure6D).Sincetransdifferentiation ofASCtoendothelialcells report and compared their properties to BM-MSCs. The was not found at POD7 in our animal model (Figure S9), we mesodermallineagedifferentiationexperimentsuggeststhatASCs suggestthatASCsincreaseendothelialcellrecruitmentinwounds. are more likely to differentiate into adipocytes, while BM-MSCs Neutrophils migrate to wounded sites upon injury and initiate are prone to differentiate into chondrocytes (Figure 2). ASCs an initial inflammatory phase for wound repair. Then, macro- engrafts enhanced granulation tissue area in rabbit ear wounds, phagesmovetothesitesandsecretecytokinesandgrowthfactors whileBM-MSCsengraftsdidnotincreasegranulationtissuearea which attract cells involved in wound repair [40,41]. They (Figure 3). It is known that granulation tissue formation is not participate in remodeling the extracellular matrix and forming always beneficial because prolonged activation of fibroblasts in granulationtissuetorepairwounds.Wedidnotdetectasignificant dermis increases granulation tissue formation and results in numberofneutrophilsatPOD7woundsinwhichASCsorsaline hypertrophicscar[1,43,44].However,itisnoteasytotellwhether controlsweretreated(Figure7A,B).Wedetectedaverageof16.4 the granulation tissue is healthy or not in early phase, the time macrophages in the granulation tissue near to the migrating window we analyzed, because formation of granulation tissue is epidermiswithhighpowermicroscopicfields(HPF,Figure7C,E). essential during the wound healing process. We have done initial The number of macrophages in the granulation tissue was experimentsanalyzingtheeffectsofMSCsonscarringandfound markedly increased by ASCs treatment at POD7 (Figure 7D, E). no evidence of increased scarring with MSCs in spite of their Thus, our wound analyses (through Figures 3 to 7) suggest that increasedcellularityinthewoundhealingexperiments.However, transplanted ASCs exhibit the activated fibroblast phenotype, inananalysisofscarformationat28days,therewasnosignificant PLOSONE | www.plosone.org 6 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing Figure4.TransplantedASCsexpressa-SMAinwounds.GFP-expressingASCswereanalyzed7daysaftertransplantationinwounds.Chicken anti-GFPandmouseanti-a-SMAantibodieswereusedtodetectGFPanda-SMA.NucleiwerestainedwithDAPI.(A):Lowmagnificationofwounds. TheareasanalyzedinFigure6wereindicatedby‘a’and‘b’.(B–D):HighermagnificationsoftheindicatedregionsinA(whitesquares;labeledasi,ii, iii).(E–G):HighermagnificationsoftheindicatedregionsinB–D(whitesquares;labeledasiv,v,vi).Mergedimagesofa-SMA(red)andGFP(green) indicatethata-SMAisexpressedinASCs.Scalebars:500mm(A),50mm(B–G). doi:10.1371/journal.pone.0055640.g004 Figure5.TransplantedASCsproliferateinwounds.GFP-expressingASCswereanalyzed7daysaftertransplantationinwounds.Chickenanti- GFP(A)andmouseanti-Ki67(C)antibodieswereused.NucleiwerestainedwithDAPI(B).MergedimagewasshowninD.Scalebars:50mm. doi:10.1371/journal.pone.0055640.g005 PLOSONE | www.plosone.org 7 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing (Figure2).WhiletheuseofDFsinwoundrepairhasbeenreported [31,58],theDFsengraftdidnotenhancegranulationtissueareain rabbit ear wounds(Figure 3). Even though ASCs are a promising candidate for cell therapy, there are several pitfalls to be addressed. First, it is expected that engrafted ASCs participate in wound repair by either paracrine signaling or direct differentiation to specific cell types such as endothelialcellsorkeratinocytes.Therearereportswhichshowed transdifferentiationofASCsinvivo[26,59].However,itisspeculated that the major role of engrafted ASCs is secreting cytokines and growth factors, which enhance wound repair (see the following paragraph). Multipotency of ASCs has been tested in vitro where signals are provided to differentiate ASCs to specific cell types; however, this is unlikely to happen in vivo. Therefore, further investigation to find the optimum microenvironment for ASCs differentiationisessentialinthecomplexandmulticellularprocess of wound repair. Second, allogeneic and xenogeneic therapeutics have been considered because they have reduced expression of histocompatibility antigens and secrete immunoregulatory mole- cules [10,15,16]. However, investigation of immune reaction by comparing autologous ASCs in quantitative analysis is needed. Third,alimitingfactorofASCsisthattheydifferinproliferation and differentiation capacity depending on age, gender, and the location in the body from which the cells are derived [41,42,43]. Understanding the underlining mechanisms, such as epigenetic control,isneededfortheclinicaluseofnon-autologousASCs. Though there are disputes on transdifferentiation of ASCs in vivo, costaining of engrafted ASCs with other cell types has been reported in vivo. ASCs are differentiated to endothelial and epidermal cells in the murine model 2–4 weeks after delivery [26]. However, costaining of ASCs with endothelial marker was not found in the rabbit wounds 7 days after delivery (Figure S9). Therefore,wesuspectthat7daysarenotenoughforrabbitASCs to be transdifferentiated to other cells or that the microenviron- Figure 6. Analysis of protein expression in ASCs treated ment in rabbit wounds is different from that in murine wounds. wounds.Salinecontrol(A,B,C,D)andASCs(E,F,G,H)weredelivered There are reports which suggest that engrafted ASCs enhance to wounds and harvested as described in Figure 3. a-SMA (A, E) and angiogenesisbyreleasingangiogenicfactors[22,60,61,62].Inline CD3 (B, F) were visualized by DAB after staining with their specific antibodies.CD31(C,D,G,H)wasstainedwithitsspecificantibodyand withthis,wefoundincreasedCD31positivecellsinwoundbedin visualizedusingfluorescenceconjugatedsecondaryantibody.(A,B,C, ASCstreatedwounds(Figure6H),thoughdirectdifferentiationof E,F,G):imagesweretakenfromthearealabeledas‘a’inFigure4.(D, ASCs toendothelial cells was not detected. It has been suggested H):ImmunostainingforCD31inthearealabeledas‘b’inFigure4.The that MSCs contribute to tissue repair via secretion of soluble junctionareabetweencartilageandwoundbedswasdemarcatedby factors rather than transdifferentiation [7,63]. We anticipate that white dot lines. CD31 positive signals were indicated by arrows in H. the paracrine effect of ASCs in wound healing is crucial for the Scalebars:50mm. doi:10.1371/journal.pone.0055640.g006 healing ofwounds inwhichlargevolume oftissues islost. Macrophages play key roles during the wound repair process effect on scar area or elevation index (data not shown). Further whichincludes inflammation, granulation formation, andremod- investigationisneededtoregenerate,notrepair,tissuewithMSCs eling in wounds [40]. It has been shown that macrophages promote wound repair after skin injury [64,65,66,67]. Myofibro- treatment; for example, testing different conditions such as using blasts are activated fibroblasts and express a-SMA. They play a matrices as delivery vehicles or initially growing the cells in 3- critical role in wound repair by depositing extracellular matrices dimensional cultures which may optimize their properties such as fibronectin and collagen, and by secreting proteinases [1,26,45,46]. which remodel the matrix [68]. Thus, both myofibroblasts and Our results further support the finding suggesting ASCs and macrophagesarecriticalplayersinwoundrepair.EngraftedASCs BM-MSCs are not identical, though they have similar surface showed the myofibroblast phenotype in rabbit ear wound markers [47,48,49,50]. DFsare poorlycharacterized diverse cells (Figure 4). In addition, the number of infiltrated macrophages which locate in dermis. Upon injury DFs are activated and was increased in ASCs treated wounds (Figure 7). These data becomemyofibroblasts,whichexpressa-SMAandcytokineswhile suggest that transplanted ASCs enhance granulation tissue depositing extracellular matrix [51]. It has been shown that formation via their activated fibroblast phenotype and increased human ASCs and DFs display similar surface markers and recruitment of macrophagesinwounds. multipotency to differentiate into osteocytes, adipocytes, and chondrocytes[52,53,54,55].Theyhavesimilarchemokineexpres- Conclusions sion profiles. However despite the morphological similarity, they arenotidentical[56,57].OuranalysisshowedthatDFshaveless ASCshaveadvantagesascelltherapyagentsascomparedwith potency to be differentiated compared to ASCs and BM-MSCs otherMSCs, suchasBM-MSCs.Thisisbecause theyareeasyto PLOSONE | www.plosone.org 8 January2013 | Volume 8 | Issue 1 | e55640 ASCsinWoundHealing Figure7.HigherinfiltrationofmacrophageswasfoundinASCstreatedwounds.Salinecontrol(A,C)andASCs(B,D)weredeliveredto woundsandharvestedasdescribedinFigure3.Neutrophils(A,B)andmacrophages(C,D)werevisualizedbyDABafterstainingwiththeirspecific antibodies.Scalebars:100mm.(E):Numberofmacrophagesperhigh-powermicroscopicfields(HPF)at400Xmagnification.Macrophageswere countedandaveragedfromfourHPF.Dataarefromfourindependentwoundsandpresentedasmean+SEM.***p,0.001. doi:10.1371/journal.pone.0055640.g007 isolatewithrelativeabundance.WeconfirmedthatMSCssurface Figure S2 mRNA level of lineage specific genes was markers(CD29,CD44,CD90,andCD105)areexpressedinrabbit increasedbydifferentiationinMSCs.DFs,ASCs,andBM- ASCsandaremaintainedininvitroculture.RabbitASCshavethe MSCs were grown in adipogenic (A), osteogenic (B), or ability to differentiate into mesodermal cells such as adipocytes, chondrogenic (C) medium for 8, 28, or 21 days. Total RNAs chondrocytes,andosteocytes.TopicallydeliveredASCsproliferated were isolated and RT-qPCR was performed. Expression of inthewoundsexhibittheactivatedfibroblastphenotype.Engrafted adiponectin (A), osteopontin (B), and Col10a1 (C) was analyzed. ASCs increased macrophage recruitment and enhanced granula- Eachgeneexpressionwasnormalizedaccordingtotheexpression tion tissue formation in wounds. Our data support ASCs as a levelofGapdh.Dataarefromasinglerepresentativeexperiment. possiblecelltherapycandidatefortherepairofwounds. The level of gene expression in cells cultured in differentiation medium was compared to cells cultured in non-differentiated Supporting Information medium,whichwas set at 1. (PDF) Figure S1 Western blot analysis for surface markers of rabbitBM-MSCs.WholecellextractofrabbitBM-MSCsfrom Figure S3 Schematic drawing of rabbit wounds and P1toP9waspreparedandloaded20mgperwell.Theexpressionof histologicalanalysis.EG,epithelialgap;GA,granulationarea. CD29,CD44,CD90,andCD105weredetectedwiththeirspecific (PDF) antibodiesasindicated.b-actinwasdetectedasaloadingcontrol. (PDF) PLOSONE | www.plosone.org 9 January2013 | Volume 8 | Issue 1 | e55640

See more

The list of books you might like