loading

Logout succeed

Logout succeed. See you again!

ebook img

Effects of soluble epoxide hydrolase inhibitor on the expression of fatty acid synthase in peripheral blood mononuclear cell in patients with acute coronary syndrome. PDF

file size0.44 MB
languageEnglish

Preview Effects of soluble epoxide hydrolase inhibitor on the expression of fatty acid synthase in peripheral blood mononuclear cell in patients with acute coronary syndrome.

Zhaoetal.LipidsinHealthandDisease2013,12:3 http://www.lipidworld.com/content/12/1/3 RESEARCH Open Access Effects of soluble epoxide hydrolase inhibitor on the expression of fatty acid synthase in peripheral blood mononuclear cell in patients with acute coronary syndrome Xuan Zhao, Jian-qing Du, Dan-yan Xu* and Shui-ping Zhao Abstract Background: Researches have shown that solubleepoxide hydrolase inhibitors(sEHi) can protect against the development of atherosclerosis. Simultaneously, emerging evidences have implicated the association between fatty acid synthase (FAS) and acute coronary syndrome (ACS). We tested thehypothesis that sEHi could reduce the occurrence of ACS by regulating FAS. Methods: Hospitalized ACS patients were selected as the ACS group (n= 65) while healthy normal subjects as the control group (n = 65).The blood levels of lipoproteins, fasting glucose, myocardial enzyme and high-sensitivity C-reactive protein (hs-CRP) were measured within 24 hours after admission.The peripheral blood mononuclear cells (PBMCs) were isolated and cultured. Trans-4-[4-(3-Adamantan-1-ylureido)cyclohexyloxy] benzoic acid (t-AUCB), a kindof sEHi, was then added to cells invarious concentrations (0, 10, 50,100 μmol/L). The expression ofFAS, interleukin-6 (IL-6) mRNA and protein was detected by real-time PCR or Western blot,respectively. Results: (1)Comparedwith thecontrol group, theserum concentration of hs-CRP in theACS group was increased (P<0.05). The expression ofFAS, IL-6mRNA and protein were significantly increased inPBMCs from the ACS group (all P<0.05). Moreover, thelevels of FAS and IL-6 mRNA were positively correlated withtheserum concentration of hs-CRP (r= 0.685, P<0.01; r= 0.715, P<0.01) respectively. (2)The expression of FAS, IL-6 mRNA and protein in PBMCs from the ACS group were dose-dependentlyinhibited bysEHi (allP<0.05). Conclusions: sEH inhibition regulated FAS and inhibited inflammationin cultured PBMCs from ACS patients, a mechanism that might prevent rupture of atherosclerotic lesions and protect against development of ACS. Keywords: Soluble epoxide hydrolase inhibitor, Fatty acid synthase, Acute coronary syndrome Background the center, which could reflect that increased SFA levels Acute coronary syndrome (ACS) is the leading cause of adversely influenced plaque stability [6,7]. Moreover, deathandlossoflifeworldwide.ACSusuallyoccurswhen Felton et al. [7] stated that increased SFA levels at the plaques are suddenly ruptured [1-4]. Numerous studies edges of advanced plaques was inversely associated with haveshownthatthe concentrationsofsaturatedfattyacid capthickness,andthereforemightreflectapredisposition (SFA) in plaques and the thickness of the fibrous cap are to plaque rupture. The synthesis of SFA is an energy- associated with the formation of disrupted plaques [5]. consuming process that requires the multifunctional en- Greater concentrations of SFA (3.5 versus 2.9, P < 0.05) zyme, fatty-acid synthase (FAS) [8]. It has been suggested have been found at the edges of disrupted plaques than that FAS plays an important role in the development of ACSbyregulatingthesynthesisofSFA. EvidencesuggeststhatFASisthekeyenzymethatregu- *Correspondence:[email protected] latesdifferentiationofthemonocyteintothemacrophage, DepartmentofCardiology&InternalMedicine,SecondXiangyaHospital, CentralSouthUniversity,139MiddleRenminRoad,Changsha410011,PR and the inhibition of FAS limits phagocytosis by China ©2013Zhaoetal.;licenseeBioMedCentralLtd.ThisisanOpenAccessarticledistributedunderthetermsoftheCreative CommonsAttributionLicense(http://creativecommons.org/licenses/by/2.0),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedtheoriginalworkisproperlycited. Zhaoetal.LipidsinHealthandDisease2013,12:3 Page2of8 http://www.lipidworld.com/content/12/1/3 macrophages [9]. Indeed, macrophages have been shown years), including 39 men and 26 women. Subjects were to ingest oxidized low-density lipoprotein cholesterol excluded from the study if they had severe liver and kid- (ox-LDL-C)throughphagocytosisinthesubendocardium, ney diseases,lung diseases, fracture,carcinoma,any kind which is the basis of the development of atherosclerosis. of infectious disease, autoimmunity disease or combined Moreover,macrophagesreleaselyticenzymesthatdegrade acute complications. All patients provided written the fibrous cap, resultinginplaqueinstability and rupture informed consent and the study was approved by the [10].Therefore,theinhibitionofFAS coulddecreaseACS Ethics Committee of Second Xiangya Hospital, Central by reducing the number of macrophages present in the South University,Changsha,HunanProvince,China. plaqueandpreventingphagocytosisbymacrophages. Furthermore,inflammationalsoplaysakeyroleindevel- Methods opment of ACS [11,12]. Consequently, it is not surprising Biochemicalanalysis that biomarkers of inflammation, such as high-sensitive All the subjects selected were admitted to hospital within C-reactive protein (hs-CRP) and interleukin-6 (IL-6), have 24 hours, and blood was taken for isolation and culturing been used to indicate inflammatory status in these dis- ofPBMCs.Routineblood,serumconcentrationsofglucose, eases. Likewise, the concentration of FAS was positively hs-CRP, total cholesterol (TC), triglycerides (TG), LDL-C correlated with the levels of inflammatory factors in vivo and high density lipoprotein cholesterol (HDL-C) were [13,14]. One study showed that inflammation upregulated measured thefollowing morning after fasting for10hours. FAS expression at the levels of both mRNA and protein, Themethodsformeasurementofbiochemicalvariables,in- and stimulated lipogenesis in non-adipose tissues, which cluding fasting glucose concentrations, fasting lipoprotein caused ectopic lipid deposition [15]. Taken together, these profilesandhs-CRPweredescribedinpreviousstudy[26]. data suggest that FAS is associated with plaque rupture mediatedbyregulatinglipidmetabolismandinflammatory PBMCsisolationandcellculture processes. PBMCs were isolated from the peripheral blood by ficoll Solubleepoxidehydrolase(sEH)isanemergingtargetfor density gradient centrifugation. PBMCs (1×106 of the pharmacological treatment of cardiovascular diseases be- target cells per well) were cultured in complete RPMI cause the inhibition of sEH leads to increased circulating 1640 containing 10% fetal bovine serum (FBS). The cells levels of epoxyeicosatrienoic acids (EETs) and other fatty were demonstrated to have >95% viability with 2% Try- acidepoxides,whichmediateendothelium-dependentvaso- pan blue exclusion. trans-4-[4-(3-Adamantan-1-ylur- dilation, promote angiogenesis and have anti-inflammatory eido)cyclohexyloxy] benzoic acid (t-AUCB) [27], a kind properties [16-19]. sEH inhibitors (sEHi) were originally of sEHi, was synthesized in the laboratory of Dr. Bruce developed as antihypertensive and anti-inflammatory Hammock (UC Davis). At first, we prepared a 0.2M agents [20-23]. Moreover, Ulu et al. [24] found that sEHi stock solution by mixing 500μL of dimethylsulphoxide couldreduceatheroscleroticplaqueformationintheapoE- (DMSO) with 41.25 mg of t-AUCB. Then, stock solution KOmousemodel.However,nostudiesexistregardingsEHi was diluted with medium to different concentrations (0, forthetreatmentofACS. 10, 50, 100 μmol/L) as required and used to treat cells Based on the evidence given above, we expected that for 24 h. While the PBMCs from the healthy subjects sEHimightaffectthedevelopmentofACSvia stabilization were cultured asthe control withoutanyintervention. of the plaque and anti-inflammation by regulating FAS. In ourstudy,weshowedthat(1)TheexpressionlevelsofFAS, Real-timePCR IL-6 mRNA and protein in the ACS group were obviously The cells were collected and total RNA was extracted increased.(2)TheexpressionofFASmRNAandproteinin from cells using TRIZOL kits as recommended by the peripheral blood mononuclear cells (PBMCs) from the manufacturer (Invitrogen). A total of 1 μg of total RNA W ACS group were dose-dependently inhibited by sEHi. isolated from each group using an RNeasy kit (Qiagen) Therefore, it was implied that sEHi might have effects on with the addition of DNase was reverse transcribed into preventionofACS. cDNA and then 1 μl cDNA was used to perform real- time polymerase chain reaction assay (PCR). The primer Methods and materials sequenceswere asfollows: Subjects According to diagnosis and classifications standard of FAS:F:50CGCGTGGCCGGCTACTCCTAC30,R: ACS by the WHO [25], 65 patients with acute coronary 50CGGCTGCCACACGCTCCTCT30 syndrome from 49.8to 75.2 yearsold (64.8 ±12.1 years), IL-6:F:50CAATCTGGATTCAATGAGGAGAC30,R: including 38 men and 27 women, were admitted to the 50CTCTGGCTTGTTCCTCACTACTC30 ACS group. The control group comprised 65 healthy GAPDH:F:50GGAAGGTGAAGGTCGGAGTCA30,R: volunteers from 53.4 to 73.2 years old (65.2 ± 10.2 50GCTCCTGGAAGATGGTGATGG30 Zhaoetal.LipidsinHealthandDisease2013,12:3 Page3of8 http://www.lipidworld.com/content/12/1/3 PCR reactions were performed on the 7300 Real-Time positivelycorrelated with the serum concentration of hs- PCR system using SYBRW GREEN PCR Master Mix CRP in the ACS group (r = 0.685 P < 0.05 and r = 0.715 (Applied Biosystems) as detailed in the manufacturer’s P<0.05),respectively (Figure 2and3). guidelines. Cycling parameters were 95°C for 10 sec, then 40 cycles of 95°C for 5 sec and 60°C for 31 sec. All EffectsofsEHionFASandIL-6mRNAinPBMCs the effective data were statistically analysed by the 2-ΔΔCt t-AUCB had a dose-dependent inhibitory effect on the method. expression of FAS, IL-6 mRNA in PBMCs from the ACS group, and reached the maximum effect when the con- Westernblotting centration of t-AUCB was 100 μmol/L. Compared with The cells were collected and total protein was extracted the control group (t-AUCB: 0 μmol/L), 10, 50, 100 from cells using the kits as recommended by the manu- μmol/L levels of t-AUCB had inhibited the expression of facturer. Protein concentration was determined by the FAS, IL-6 mRNA in PBMCs from the ACS group with a bicinchonininc acid (BCA) method, and samples were statisticaldifference(P<0.05)(Figure 4a). then loaded per well for sodium dodecyl sulfate poly- acrylamidegelelectrophoresis(SDS-PAGE).Theproteins EffectsofsEHionFASandIL-6proteinlevelsinPBMCs wereelectrophoreticallytransferredtopolyvinylidenefluor- t-AUCB had a dose-dependent inhibitory effect on the ide (PVDF) membranes. The membranes were blocked expression ofFAS, IL-6 proteininPBMCs from theACS with blocking buffer, and incubated with primary anti- group. Compared with the control group (t-AUCB: 0 bodies, followed by incubation with secondary antibodies. μmol/L), levels of10,50,100μmol/L t-AUCBhad inhib- At last, the bands were scanned by the GEL imaging sys- ited the expression of FAS, IL-6 protein in PBMCs from tem, and then the bands were analyzed using Photoshop the ACS group (P < 0.05). The relative expression levels software.Allthebandswerecomparedtoβ-actinasthein- of FAS protein in the t-AUCB 0, 10, 50 and 100 μmol/L ternalcontrol. groups were 0.957 ± 0.080, 0.935 ± 0.075, 0.855 ± 0.053, 0.685 ± 0.046, respectively. The relative expression of Statisticalmethods IL-6 protein in the t-AUCB 0, 10, 50 and 100 μmol/L AllthedatawereanalysedstatisticallyusingSPSS16.0soft- groups were 1.276 ±0.060,0.9310 ±0.064,0.738± 0.044 ware package. All results were expressed as the mean ± and0.506±0.072,respectively(Figure4b). standard error (SE), except that hs-CRP results were loga- rithmically transformed to approximate a normal distribu- Discussion tion. Single comparisons were examined with Student’s Numerous studies have demonstrated that the inflamma- t-tests. One-way analysis of variance (ANOVA) was used tory level is increased in the ACS patients [11,12,28,29]. to compare several groups. A linear relationship was Shantsila and Lip [30] highlighted that monocytes were assessed by least-square regression analysis. A two-sided P actively involved in the pathological processes related to valueof<0.05wasconsideredtobestatisticallysignificant. ACS, which promoted the synthesis of pro-inflammatory molecules, such as IL-6, tumor necrosis factor-α (TNF-α) Results and hs-CRP. Among them, hs-CRP has been proved to Basicclinicalcharacteristicsofthestudysubjects be the strongest and most significant predictor of the in- There was no statistical significance between the ACS flammatory level and the risk of plaque instability and group and the control group in terms of gender, age, rupture [31-33]. Our studies showed that the serum con- number of people who smoke, body mass index (BMI), centration of hs-CRP and the total white blood cells were blood pressure, fasting blood sugar (FBS), hemoglobin elevated in the ACS group, which wasinaccordancewith (Hb), serum creatinine(Cr),TG,TC, HDL-C, LDL-C (all previously published studies [34,35], indicated that in- P > 0.05). However, the total white blood cell count flammation was correlated with the development of car- (WBC), troponin T (cTnT), creatine kinase (CK), creat- diovascularevents. ine kinase isoenzyme (CK-Mb) and hs-CRP of the ACS Among the inflammatory factors, IL-6 induces the group were higher than the control group (P < 0.05) production and secretion of CRP [36]. In the present (Table1). study, we found that the expressions of IL-6 mRNA and protein in PBMCs were significantly increased in ACS ExpressionsofFAS,IL-6mRNAandproteininPBMCsand groupandthenlevelsofIL-6mRNAwerepositivelycor- theirrelationshipswithhs-CRP related with the serum concentration of hs-CRP, which As shown in Figure 1, compared with the control group, indicated that PBMCs were actived in the ACS group the mRNA and protein expression levels of FAS and IL- andmore inflammatoryfactorsweresynthesized incells. 6 were significantly increased in the ACS group (all P < The disruption of unstable coronary artery plaques is 0.05). Moreover, the levels of FAS and IL-6 mRNA were responsible for the majority of incidents ofACS[1-3,37]. Zhaoetal.LipidsinHealthandDisease2013,12:3 Page4of8 http://www.lipidworld.com/content/12/1/3 ― Table1Basicclinicalcharacteristicsofthestudysubjects(x(cid:2)SE) Control(n=65) ACS(n=65) P-Value Gender,male/female 39/26 38/27 0.542 Smoker,(n)(%ofthetotal) 28(43.1) 31(47.7) 0.493 Age(years) 65.2±10.2 64.8±12.1 0.419 Systolicbloodpressure(mmHg) 120.7±14.2 123.4±14.1 0.208 Diastolicbloodpressure(mmHg) 74.6±10.2 70.8±7.4 0.285 TG(mmol/L) 1.8±1.0 1.5±1.0 0.390 TC(mmol/L) 4.4±0.6 4.0±0.8 0.154 HDL-C(mmol/L) 1.0±0.3 0.9±0.3 0.067 LDL-C(mmol/L) 2.6±0.7 2.4±0.8 0.265 Cr(μmol/L) 74.9±17.0 82.7±14.8 0.489 CK(U/L) 169.2±21.1 207.3±30.3a 0.038 CK-Mb(U/L) 13.5±5.6 38.6±43.0a 0.001 cTnT(ng/mL) 4.7±4.5 795.7±287.1a 0.000 FBS(mmol/L) 5.1±0.9 5.3±1.4 0.101 WBC(×109/L) 6.9±1.1 7.5±2.4a 0.028 Hb(g/L) 123.0±9.0 118.0±13.0 0.347 BMI(Kg/m2) 22.8±2.4 23.9±3.0 0.086 h-CRP(mg/L) 1.3±0.9 5.6±4.1a 0.001 Medicationhistory,n(%) ACEI/ARB NE 15(23.0) - β-blocker NE 24(36.9) - Statin NE 30(46.2) - CCB NE 32(49.2) - Insulin NE 2(3.0) - HospitalizedACSpatientswereselectedastheACSgroup(n=65)whilethehealthynormalsubjectsasthecontrolgroup(n=65).Thelevelsofroutineblood analyses,lipoproteins,fastingbloodglucose,myocardialenzymeandhigh-sensitiveC-reactiveprotein(hs-CRP)weredeterminedwithin24hoursafteradmission. Valuesaremean±SEorpercentage(n)(%).aP<0.05,comparedwithcontrolgroup. FAS is a significant contributor to the rupture of athero- increased in the ACS group, which provided important sclerotic plaques. Firstly, increased SFA concentrations, evidenceforthe associationbetween FASandACS. which is inversely associated with cap thickness, might A study showed that inflammation upregulated mRNA reflect a predisposition to rupture [7]. Results also and protein expression of FAS, and stimulated lipogen- showed that increased FAS in PBMCs promote synthesis esis in non-adipose tissues, causing ectopic lipid depos- of SFA [8]. Secondly, as already noted, the disrupted ition [10]. We hypothesized that the composition of SFA plaques are intimately related to the accumulation of in plaques was further increased as a result of upregu- lipid-filled macrophages at their edges. Macrophage cells lated FAS expression in the inflammatory state. Our produce cytokines that activate neighboring smooth studies proved that compared with the control group, muscle cells, resulting in extracellular matrix formation, the expression levels of FAS mRNA were positively cor- fibrosis, and plaque instability, which play key roles in related with the serum concentration of hs-CRP, which ACS [5,38,39]. FAS is also the key enzyme of the matur- showed that the variation of fatty acid metabolism ationofmacrophages,astheuptake ofmodifiedlipopro- reflected high levels of inflammatory status in vivo. teins is inhibited when fatty synthesis is suppressed Therefore, it could be speculated that the expression of during the differentiation process of the monocyte [9]. FAS in PBMCs was closely correlated with the vulner- Therefore, FAS increase the occurence of ACS by regu- able state of plaques and the inflammatory levels in the lating the synthesis of SFA and augmenting numbers of ACSpatients. mature macrophages in the lipid core. Our results Furthermore, our study also showed that the increased showed that, compared with the control group, the expression of FAS mRNA and protein in PBMCs from expression levels of FAS mRNA were significantly the ACS group were dose-dependently inhibited by Zhaoetal.LipidsinHealthandDisease2013,12:3 Page5of8 http://www.lipidworld.com/content/12/1/3 FAS expression. But the detail of the mechanism is un- known,andfurther studies arerequired. Rae and Graham [14] showed that the C75, which was found to be an inhibitor of FAS [42], effectively blocked pro-atherogenic metabolic responses to a inflammatory factor, preventing this factor from inducing increases in macrophage triacylglycerol and cholesteryl ester content. Ithasbeen suggested thatlipid accumulationinduced by inflammation in cells could be reduced by inhibiting the synthesis of fatty acid by FAS. Moreover, the last study showed that induction of fatty acid synthesis by FAS was absolutely necessary for monocyte differentiation and the phagocytic activity of macrophages [9]. The inhib- ition of FAS could prevent lipoprotein uptake during monocyte differentiation [9], which was the crucial step of the maturation of macrophages. Additionally, it has been demonstrated previously that treatment with sEHi reduced the area of atherosclerotic lesions, and these effects were associated with a reduction of serum lipid andIL-6 [43]. IL-6 plays a significant role in the development of acute inflammatoryresponses,includingendothelialandlympho- cyte activation [44]. In our study, the increased expression ofIL-6mRNAandproteininPBMCsfromtheACSgroup wereinhibitedbysEHiinadose-dependentmanner,which was consistent with the anti-inflammatory properties of sEHi in previous studies [22,43]. Resident macrophages Figure1RelativeexpressionlevelsofFAS,IL-6mRNAand proteininPBMCs.PBMCswereisolatedfromperipheralbloodof would not produce pro-inflammatory proteins, such as ACSpatients.Healthysubjectsweretreatedascontrolgroup.a.FAS TNF-α, IL-6, without nuclear factor kappa B (NF-κB) andIL-6mRNAweredetectedbyrealtime-PCR.Alltheeffectivedata werestatisticallyanalyzedbythe2-ΔΔCtmethod.b.FASandIL-6 proteinweredetectedbyWesternblotting.β-actinwastheinternal control.*P<0.05comparedtothecontrolgroup.FAS:fatty-acid synthase;PBMCs:peripheralbloodmononuclearcells;ACS:acute coronarysyndrome. sEHi. This result seems to be in agreement with a previ- ous study in Mesenchymal stem cells (MSCs) which demonstrated that the decrease of FAS was dose dependent in MSCs treated with EETs [40]. In their study, they provided direct evidence that EETs induced increased expression of heme oxygenase-1 (HO-1) led to the increases in adiponectin, phosphorylation/inactiva- tion of Acetyl-CoA carboxylase 1 (ACC1) and conse- quently decreased levels of FAS [40]. Most important, Figure2LinearrelationshipsbetweenexpressionlevelsofFAS they concluded that increased expression of HO-1 might mRNAandtheserumconcentrationofhs-CRPinACS.PBMCs be a trigger for changes in lipid metabolism. HO-1, wereisolatedfromperipheralbloodofACSpatients.FASmRNAwas detectedbyrealtime-PCR.Hs-CRPwasmeasuredbyimmune widely expressed in cells and tissues, is a rate-limiting nephelometry.RelativeexpressionlevelsofFASmRNAmeansits enzyme that catabolizes heme and is important for the 2-ΔΔCtvalue.Hs-CRPwaslogtransformedtoachievenormal suppression of inflammatory responses [41]. Based on distribution.ThelinearrelationshipbetweenexpressionlevelsofFAS these data, we speculated the possible mechanism of our mRNAandserumconcentrationofhs-CRPwasassessedbyaleast- study was that sEHi lead to augmented circulation levels squareregressionanalysis.FAS:fatty-acidsynthase;hs-CRP:high- sensitiveC-reactiveprotein;ACS:acutecoronarysyndrome;PBMCs: of EETs, which increased expression of HO-1, triggered peripheralbloodmononuclearcells. a series reaction, consequently attenuated the levels of Zhaoetal.LipidsinHealthandDisease2013,12:3 Page6of8 http://www.lipidworld.com/content/12/1/3 (STEMI), and non-STEMI; however, we did not study the expression of FAS among these different categories of ACS. Thirdly, in our study, we studied the function of FAS in vitro, but the results in vivo remained un- known. Finally, the potential mechanisms underlying the observed effects were undefined. Figure3LinearrelationshipsbetweenexpressionlevelsofIL-6 mRNAandtheserumconcentrationofhs-CRPinACS.PBMCs wereisolatedfromperipheralbloodofACSpatients.IL-6mRNAwas detectedbyrealtime-PCR.Hs-CRPwasmeasuredbyimmune nephelometry.RelativeexpressionlevelsofIL-6mRNAmeansits 2-ΔΔCtvalue.Hs-CRPwaslogtransformedtoachievenormal distribution.ThelinearrelationshipbetweenexpressionlevelsofIL-6 mRNAandtheserumconcentrationofhs-CRPwasassessedbya least-squareregressionanalysis.FAS:fatty-acidsynthase;hs-CRP: high-sensitiveC-reactiveprotein;ACS:acutecoronarysyndrome; PBMCs:peripheralbloodmononuclearcells. translocation to the nucleus [22]. Therefore, activated NF-κB was the underlying mechanism for elevated expres- sion levels of IL-6 in PBMCs from patients with ACS. Furthermore, it was not difficult to deduce that anti- inflammatory properties of sEHi, especially lower expres- sion levels of IL-6, might involve inhibition of NF-κB activation, though NF-κB activation was not measured directly in these studies. However, future studies need to elucidatetheunderlyingmechanisms. Some limitations of our study should be considered. Firstly,althoughSFAplayedanimportantroleinthedevel- opmentofACS,wedidnotmonitortheSFAinplaquesor plasma. In fact, we have realized the important role of measurement of SFA in plaques, however there are some difficulties: (1) as noted in our manuscript, we expected the concentration of SFA in plaques was reduced by regu- latingFAS,consequentlydecreasedtheoccurrenceofACS. But it was impossible to get the plaques of ACS patients. (2) Afterwards, we figured out whether it was feasible to detect the concentration of SFA in plasma instead of pla- Figure4EffectsofsEHionexpressionlevelsofFASandIL-6 ques? But the answer is negative. Because the concentra- mRNAandproteininPBMCs.PBMCswereisolatedfrom tion of SFA in plasma was liable to be influenced by food peripheralbloodofACSpatients.Then,t-AUCB,akindofsEHiwas addedtocellsofACSgroupinvariousconcentrations(0,10,50, metabolism.Moreover,astudyshowedthattheconcentra- 100)μmol/Landincubatedfor24hours.a.FASandIL-6mRNA tionofSFAinplaqueswasnotassociatedwithitinplasma weredetectedbyreal-timePCR.Alltheeffectivedatawere [7]. So it is not feasible to detect SFA in plasma instead statisticallyanalyzedby2-ΔΔCt.b.FASandIL-6proteinwere of plaques. Taken together, we could not detect the detectedbyWesternblots.β-actinwastheinternalcontrol.*P<0.05 concentration of SFA but speculated the reduction of comparedtothegroupwithoutsEHi(t-AUCB0μmol/L).sEHi: solubleepoxidehydrolaseinhibitor;FAS:fatty-acidsynthase;PBMCs: SFA in plaques theoretically. Secondly, ACS encompass peripheralbloodmononuclearcells;ACS:acutecoronarysyndrome. unstable angina, ST-elevation myocardial infarction Zhaoetal.LipidsinHealthandDisease2013,12:3 Page7of8 http://www.lipidworld.com/content/12/1/3 Conclusion 14. RaeC,GrahamA:Fattyacidsynthaseinhibitor,C75,blocksresistin- In summary, the present study showed that inhibition of inducedincreasesinlipidaccumulationbyhumanmacrophages. sEH by t-AUCB reduced mRNA and protein expression DiabetesObesMetab2008,10(12):1271–1274. 15. MeiM,ZhaoL,LiQ,ChenY,HuangA,VargheseZ,MoorheadJF,ZhangS, of FAS and inflammatoty factor, IL-6, in PBMCs from PowisSH,RuanXZ:Inflammatorystressexacerbatesectopiclipid the ACS group. These findings have led to the postulate depositioninC57BL/6Jmice.LipidsHealthDis2011,10:110. 16. LarsenBT,CampbellWB,GuttermanDD:Beyondvasodilatation:non- that sEHi might attenuate the development of ACS by vasomotorrolesofepoxyeicosatrienoicacidsinthecardiovascular regulating lipid metabolism and inflammation as well as system.TrendsPharmacolSci2007,28(1):32–38. preventingruptureofatheroscleroticlesions. 17. ZhaoTT,WastiB,XuDY,ShenL,DuJQ,ZhaoSP:Solubleepoxide hydrolaseandischemiccardiomyopathy.IntJCardiol2012,155(2): 181–187. Competinginterests 18. ImigJD,HammockBD:Solubleepoxidehydrolaseasatherapeutictarget Theauthorsdeclarethattheyhavenocompetinginterests. forcardiovasculardiseases.NatRevDrugDiscov2009,8(10):794–805. 19. NiGH,ChenJF,ChenXP,YangTL:Solubleepoxidehydrolase:apromising Authors’contributions therapeutictargetforcardiovasculardiseases.Pharmazie2011,66(3): 153–157. Alltheauthorswereinvolvedinthedesignofthisstudy.XZandJQD substantiallycontributedtothedesignofthestudy,performingthe 20. JungO,BrandesRP,KimIH,SchwedaF,SchmidtR,HammockBD,BusseR, experiment,analysisofdata,anddraftingthemanuscript.DYXandSPZ FlemingI:SolubleepoxidehydrolaseisamaineffectorofangiotensinII- madecontributiontodesign,analysisandrevisionofthemanuscript.Allthe inducedhypertension.Hypertension2005,45(4):759–765. authorshavereadandapprovedthefinalversion. 21. ChiamvimonvatN,HoCM,TsaiHJ,HammockBD:Thesolubleepoxide hydrolaseasapharmaceuticaltargetforhypertension.JCardiovasc Pharmacol2007,50(3):225–237. Acknowledgement 22. SchmelzerKR,KubalaL,NewmanJW,KimIH,EiserichJP,HammockBD: ThisworkwassupportedbyNationalNaturalScienceFundingofChina Solubleepoxidehydrolaseisatherapeutictargetforacute (No.81170190). inflammation.ProcNatlAcadSciUSA2005,102(28):9772–9777. 23. NorwoodS,LiaoJ,HammockBD,YangGY:Epoxyeicosatrienoicacidsand Received:15November2012Accepted:4January2013 solubleepoxidehydrolase:potentialtherapeutictargetsfor Published:10January2013 inflammationanditsinducedcarcinogenesis.AmJTranslRes2010,2 (4):447–457. 24. UluA,DavisBB,TsaiHJ,KimIH,MorisseauC,InceogluB,FiehnO,Hammock References BD,WeissRH:Solubleepoxidehydrolaseinhibitorsreducethe 1. SatoY,HatakeyamaK,MarutsukaK,AsadaY:Incidenceofasymptomatic developmentofatherosclerosisinapolipoproteine-knockoutmouse coronarythrombosisandplaquedisruption:comparisonofnon-cardiac andcardiacdeathsamongautopsycases.ThrombRes2009,124(1):19–23. model.JCardiovascPharmacol2008,52(4):314–323. 25. AcharSA,KunduS,NorcrossWA:Diagnosisofacutecoronarysyndrome. 2. FishbeinMC:Thevulnerableandunstableatheroscleroticplaque. CardiovascPathol2010,19(1):6–11. AmFamPhysician2005,72(1):119–126. 3. MarshallK:Acutecoronarysyndrome:diagnosis,riskassessmentand 26. TanKC,WatNM,TamSC,JanusED,LamTH,LamKS:C-reactiveprotein management.NursStand2011,25(23):47–57.quiz58,60. predictsthedeteriorationofglycemiainchinesesubjectswithimpaired 4. HongYJ,JeongMH,ChoiYH,SongJA,KimDH,LeeKH,YamanakaF,Lee glucosetolerance.DiabetesCare2003,26(8):2323–2328. MG,ParkKH,SimDS,etal:Relationbetweenanemiaandvulnerable 27. HwangSH,TsaiHJ,LiuJY,MorisseauC,HammockBD:Orallybioavailable coronaryplaquecomponentsinpatientswithacutecoronarysyndrome: potentsolubleepoxidehydrolaseinhibitors.JMedChem2007,50 virtualhistology-intravascularultrasoundanalysis.JKoreanMedSci2012, (16):3825–3840. 27(4):370–376. 28. MulvihillNT,FoleyJB:Inflammationinacutecoronarysyndromes.Heart 5. FinnAV,NakanoM,NarulaJ,KolodgieFD,VirmaniR:Conceptof 2002,87(3):201–204. vulnerable/unstableplaque.ArteriosclerThrombVascBiol2010,30 29. TousoulisD,HatzisG,PapageorgiouN,AndroulakisE,BourasG,GiolisA, (7):1282–1292. BakogiannisC,SiasosG,LatsiosG,AntoniadesC,etal:Assessmentofacute 6. SchneiderJG,YangZ,ChakravarthyMV,LodhiIJ,WeiX,TurkJ,Semenkovich coronarysyndromes:focusonnovelbiomarkers.CurrMedChem2012,19 CF:Macrophagefatty-acidsynthasedeficiencydecreasesdiet-induced (16):2572–2587. atherosclerosis.JBiolChem2010,285(30):23398–23409. 30. ShantsilaE,LipGYH:Monocytesinacutecoronarysyndromes.Arterioscler 7. FeltonCV,CrookD,DaviesMJ,OliverMF:Relationofplaquelipid ThrombVascBiol2009,29(10):1433–1438. compositionandmorphologytothestabilityofhumanaorticplaques. 31. FuttermanLG,LembergL:High-sensitivityC-reactiveproteinisthemost ArteriosclerThrombVascBiol1997,17(7):1337–1345. effectiveprognosticmeasurementofacutecoronaryevents.AmJCrit 8. WuX,ZayzafoonM,ZhangX,HameedO:Istherearoleforfattyacid Care2002,11(5):482–486. synthaseinthediagnosisofprostaticadenocarcinoma?:acomparison 32. CalabroP,GoliaE,YehET:CRPandtheriskofatheroscleroticevents. withAMACR.AmJClinPathol2011,136(2):239–246. SeminImmunopathol2009,31(1):79–94. 9. EckerJ,LiebischG,EnglmaierM,GrandlM,RobenekH,SchmitzG: 33. MunkPS,LarsenAI:[InflammationandC-reactiveproteinin Inductionoffattyacidsynthesisisakeyrequirementforphagocytic cardiovasculardisease].TidsskrNorLaegeforen2009,129(12):1221–1224. differentiationofhumanmonocytes.ProcNatlAcadSciUSA2010,107 34. ForteL,CimminoG,LoffredoF,DePalmaR,AbbateG,CalabroP,Ingrosso (17):7817–7822. D,GallettiP,CarangioC,CasilloB,etal:C-reactiveproteinisreleasedin 10. KaskiJC:Molecularimagingofinflammationfordetectionofvulnerable thecoronarycirculationandcausesendothelialdysfunctioninpatients atheromatousplaques.EurHeartJ2012,33(15):1857–1860. withacutecoronarysyndromes.IntJCardiol2011,152(1):7–12. 11. AnogeianakiA,AngelucciD,CianchettiE,D'AlessandroM,MaccauroG, 35. MorrowDA,deLemosJA,SabatineMS,WiviottSD,BlazingMA,ShuiA,Rifai SagginiA,SaliniV,CaraffaA,TeteS,ContiF,etal:Atherosclerosis:aclassic N,CaliffRM,BraunwaldE:ClinicalrelevanceofC-reactiveproteinduring inflammatorydisease.IntJImmunopatholPharmacol2011,24(4):817–825. follow-upofpatientswithacutecoronarysyndromesintheaggrastat- 12. TuttolomondoA,DiRaimondoD,PecoraroR,ArnaoV,PintoA,LicataG: to-zocortrial.Circulation2006,114(4):281–288. Atherosclerosisasaninflammatorydisease.CurrPharmDes2012,18 36. HolvoetP:Relationsbetweenmetabolicsyndrome,oxidativestressand (28):4266–4288. inflammationandcardiovasculardisease.VerhKAcadGeneeskdBelg2008, 13. BerndtJ,KovacsP,RuschkeK,KlotingN,FasshauerM,SchonMR,KornerA, 70(3):193–219. StumvollM,BluherM:Fattyacidsynthasegeneexpressioninhuman 37. TavoraFR,RippleM,LiL,BurkeAP:Monocytesandneutrophilsexpressing adiposetissue:associationwithobesityandtype2diabetes.Diabetologia myeloperoxidaseoccurinfibrouscapsandthrombiinunstablecoronary 2007,50(7):1472–1480. plaques.BMCCardiovascDisord2009,9:27. Zhaoetal.LipidsinHealthandDisease2013,12:3 Page8of8 http://www.lipidworld.com/content/12/1/3 38. ShibataN,GlassCK:Regulationofmacrophagefunctionininflammation andatherosclerosis.JLipidRes2009,50(Suppl):S277–281. 39. BoyleJJ:Macrophageactivationinatherosclerosis:pathogenesisand pharmacologyofplaquerupture.CurrVascPharmacol2005,3(1):63–68. 40. VanellaL,KimDH,SodhiK,BarbagalloI,BurgessAP,FalckJR,Schwartzman ML,AbrahamNG:CrosstalkbetweenEETandHO-1downregulatesBach1 andadipogenicmarkerexpressioninmesenchymalstemcellderived adipocytes.ProstaglandinsOtherLipidMediat2011,96(1–4):54–62. 41. HabtezionA,KwanR,YangAL,MorganME,AkhtarE,WanaskiSP,Collins SD,ButcherEC,KamalA,OmaryMB:Hemeoxygenase-1isinducedin peripheralbloodmononuclearcellsofpatientswithacutepancreatitis:a potentialtherapeutictarget.AmJPhysiolGastrointestLiverPhysiol2011, 300(1):G12–20. 42. RonnettGV,KimEK,LandreeLE,TuY:Fattyacidmetabolismasatarget forobesitytreatment.PhysiolBehav2005,85(1):25–35. 43. ZhangLN,VinceletteJ,ChengY,MehraU,ChenD,AnandanSK,GlessR, WebbHK,WangYX:Inhibitionofsolubleepoxidehydrolaseattenuated atherosclerosis,abdominalaorticaneurysmformation,anddyslipidemia. ArteriosclerThrombVascBiol2009,29(9):1265–1270. 44. MachnickiM:[Regulationofinterleukin6(IL-6)andTNF-alphathrough lactoferrininmice].PostepyHigMedDosw1995,49(1):53–57. doi:10.1186/1476-511X-12-3 Citethisarticleas:Zhaoetal.:Effectsofsolubleepoxidehydrolase inhibitorontheexpressionoffattyacidsynthaseinperipheralblood mononuclearcellinpatientswithacutecoronarysyndrome.Lipidsin HealthandDisease201312:3. Submit your next manuscript to BioMed Central and take full advantage of: • Convenient online submission • Thorough peer review • No space constraints or color figure charges • Immediate publication on acceptance • Inclusion in PubMed, CAS, Scopus and Google Scholar • Research which is freely available for redistribution Submit your manuscript at www.biomedcentral.com/submit

See more

The list of books you might like