loading

Logout succeed

Logout succeed. See you again!

ebook img

Engineered potato virus A nuclear inclusion protein PDF

pages46 Pages
release year2013
file size2.35 MB
languageEnglish

Preview Engineered potato virus A nuclear inclusion protein

US008426186B2 (12) United States Patent (10) Patent N0.: US 8,426,186 B2 Chi et a]. (45) Date of Patent: Apr. 23, 2013 (54) ENGINEERED POTATO VIRUS A NUCLEAR Birch, et al., “Puri?cation of Recombinant Human Rhinovirus 14 3C INCLUSION PROTEIN Protease Expressed in Escherichia coli,” Protein Expression and Puri?cation, 6: 609-618 (1996). (75) Inventors: Ellen Chi, San Diego, CA (US); Dougherty, et al., “Molecular Genetic Analysis of a Plant Virus Michael Hunter, San Diego, CA (US); Polyprotein Cleavage Site: A Model”Virology, 171: 356-364 (1989). Ronald Swanson, San Diego, CA (U S) Dougherty, et al., “Biochemical and mutational analysis of a plant virus polyprotein cleavage site,” The EMBO Journal, 7(5): 1281 (73) Assignee: Centocor Ortho Biotech Inc., Horsham, 1287 (1988). Gosalia, et al., “High Throughput Substrate Speci?city Pro?ling of PA (US) Serine and Cysteine Proteases Using Solution-phase Flurorgenic Peptide Microarrays,” Molecular & Cellular Proteomics, 4: 626-636 ( * ) Notice: Subject to any disclaimer, the term of this (2005). patent is extended or adjusted under 35 Higaki, et al., “Evolution of Catalysis in the Serine Proteases,” Cold U.S.C. 154(b) by 0 days. spring harbor Syrnposia on Quantitative Biology, 52: 615-621 (1987). (21) App1.No.: 13/086,627 Kekarainen, et al., “Comparison of the complete sequences of ?ve different isolated of Potato virusA (PVA), genus Potyvirus,” Archives (22) Filed: Apr. 14, 2011 ofVirology, 144: 2355-2366 (1999). Mastumura, et al., “In vitro Evolution of Beta-glucuronidase into a (65) Prior Publication Data Beta-galactosidease Proceeds Through Non-Speci?c Intermediates,” Journal of Molecular Biology, 305: 331-339 (2001). US 2011/0318808 A1 Dec. 29, 2011 Nunn, et al., “Crystal Structure of Tobacco Etch Virus Protease Shows the Protein C Terminus Bound Within the Active Site,” Journal Related U.S. Application Data of Molecular Biology, 350: 145-155 (2005). Parks, et al., “Expres sion and Puri?cation of a Recombinant Tobacco Etch Virus Nia (60) Provisional application No. 61/324,972, ?led on Apr. Proteinase: Biochemical Analyses of the Full-Length and a Naturally 1 6, 2010. Occurring Truncated Proteinase Form,” Virology, 210: 194-201 (1995). (51) Int. Cl. Rothman, et al., “How Does an Enzyme Evolved In vitro Compare to C12N 9/50 (2006.01) Naturally Occurring Homologs Possessing the Targeted Function? (52) U.S. Cl. Tyrosine Aminotransferase from Aspartate Aminotransferase,” J our nal of Molecular Biology, 327: 593-608 (2003). USPC ........................................................ .. 435/219 Tozser, et al., “Comparison of the substrate speci?city of two (58) Field of Classi?cation Search ...................... .. None potyvirus proteases,” FEBS Journal, 272: 514-523 (2005). See application ?le for complete search history. Verchot, et al., “Mutational Analysis of the Tobacco Etch Potyviral 3 5-kDa Proteinase: Identi?cation of Essential Residues and Require (56) References Cited ments for Autoproteolysis,” Virology, 190: 298-306 (1992). Walker, et al., “Enzyme Engineering—The Design and Construction FOREIGN PATENT DOCUMENTS of Novel Enzymes,” Molecular Biology and Biotechnology, London, W0 WO 00/20619 A2 4/2000 Royal Society of Chemistry, Chapter 17: 377-388 (1989). OTHER PUBLICATIONS * cited by examiner Joseph et al., Arch. Virol. 145:2493-2502, 2000* UniProt Accession No. Q9QBT7, Mar. 2010, 3 pages.* Primary Examiner * David J Steadman Aharoni, et al., “The ‘evolvability’ of promiscuous protein func (74) Attorney, Agent, or Firm * Kirk Baumeister tions,” Nature Genetics, 37(1): 73-76 (2005). Anindya, et al.Potyviral NIa Proteinase, a Proteinase With Novel (57) ABSTRACT Deoxyribonuclease Activity, The Journal of Biological Chemistry, The present invention relates to potato virus NIa protease 279(31): 32159-32169 (2004). variants or fragments thereof, polynucleotides encoding Bazan, et al., “Viral cysteine proteases are homologous to the trypsin like family of serine proteases: Structural and functional implica them, and methods of making and using the foregoing. tions,” Proceedings of the National Academy of Science USA, 85: 7872-7876 (1988). 3 Claims, No Drawings US 8,426,186 B2 1 2 ENGINEERED POTATO VIRUS A NUCLEAR 1995), that exhibit an extended P6-P1' recognition sequence INCLUSION PROTEIN EXXYXQ*(S/G) (SEQ ID NO: 69) (Dougherty et al., Virol ogy, 171:356-364, 1989). Although there are striking simi CROSS-REFERENCE TO RELATED larities in the recognition sequence for NIa proteases across APPLICATIONS the potyvirus members, each protease is highly speci?c for its oWn target sequence (ToZer et al., The FEBS J. 272:514-523, This application claims priority to US. Provisional Appli 2004). Structurally, NIa proteases appear to be related to cation Ser. No. 61/324,972, ?led 16 Apr. 2010, the entire trypsin-like serine proteases through divergent evolution contents of Which is incorporated herein by reference in its involving replacement of NIa catalytic cysteine by serine in entirety. the trypsin-like proteases (BaZan and Fletterick, Proc. Natl. Acad. Sci. 85:7872-7876, 1988). NIa and trypsin-like serine FIELD OF THE INVENTION proteases share a similar overall 3-dimensional protein fold as Well as the spatial proximity of their respective catalytic resi The present invention relates to potato virus NIa protease dues. The 3C-like family of cysteine proteases offers several variants or fragments thereof, polynucleotides encoding advantages over more complex extracellular proteases. They them, and methods of making and using the foregoing. can be easily produced in the cytosol of bacteria, have no BACKGROUND OF THE INVENTION disul?de bonds, and have an extended substrate recognition sequence. The challenge of using the 3C-like proteases is Considerable effort has been employed to engineer 20 their activity loss in non-reducing conditions due to oxidation enZymes and other proteins to achieve higher selectively and/ of active site and/or surface exposed cysteines, therefore lim or speci?c activity (Matsumura and Ellington, J. Mol. Biol. iting theiruse (Higaki et al., Cold Spring Harbor Symposia on 305:331-339, 2001; Rothman and Kirsch, J. Mol. Biol. 327: Quantitative Biology, 615-621, 1987). Therefore, the pro 593-608, 2003; Aharoni et al., Nature Genetics, 37:73-76, teases require reducing agent to sustain their functional activ 2005). Human trypsin-like serine proteases are an appealing 25 ity (Nunn et al., J. Mol. Biol. 350:145-55, 2005; Birch et al., target for engineering With the goal to tailor proteases to Protein Expression and Puri?cation 6:609-18, 1995). Thus, recogniZe a speci?c, prede?ned primary sequence Within a there is a need for engineered plant viral proteases that remain target protein that is normally not recognized, resulting in active in the absence of exogenous reducing agents. speci?c spatial and temporal modulation of target activity. Trypsin-like serine proteases are also valuable research tools 30 SUMMARY OF INVENTION in molecular biology. Manufacturing of trypsin-like serine proteases poses chal One aspect of the invention is an isolated polypeptide lenges due to their structural complexity related to the encoding a NIa protease variant, Wherein the variant is resis required appropriate disul?de bond formation and proper tant to oxidation and retains activity. processing of the native globular polypeptide chain for activ 35 Another aspect of the invention is an isolated polypeptide ity. Furthermore, trypsin-like serine proteases often have a comprising a polypeptide having the sequence shoWn in SEQ constricted recognition sequence limiting the absolute speci ID NO: 1 having amino acid substitutions selected from the ?city that can be engineered into the molecules. (Gosalia et group consisting of: al., Mol. Cell. Proteomics, 4:626-36, 2005, US Pat.Appl. No. a. cysteine at position 19 is substituted for serine or valine; US20040072276A1). An alternative to human trypsin-like 40 b. cysteine at position 110 is substituted for serine; serine proteases, intracellular plant viral proteases that are c. cysteine at position 151 is substituted for serine or ala easier to manufacture could be used as a starting point to nine. develop therapeutics as Well as neW research tools. d. cysteine at position 181 is substituted for serine; and Potyviruses are a class of plant viruses transmitted mainly e. cysteine at position 211 is substituted for serine. by aphids, causing signi?cant losses in pasture, agricultural, 45 Another aspect of the invention is an isolated polypeptide horticultural and ornamental crops annually. Typical repre comprising a polypeptide having the sequence shoWn in SEQ sentatives of potyviruses are Potato virus A (PVA), tobacco ID NO: 28. etch virus (TEV) and tobacco vein mottling virus (TVMV). Another aspect of the invention is isolated polynucleotides Potyvirus monopartite genome contains (+) stranded RNA, encoding the polypeptides of the invention. covalently linked to a viral encoded protein (V Pg) at the 50 Another aspect of the invention is a vector comprising an 5'-end and polyadenylated at the 3'-end (Dougherty et al., The isolated polynucleotide encoding a polypeptide of the inven EMBO J. 7:1281-1287, 1988). The genome serves as an tion. mRNA and a template for the synthesis of a complementary Another aspect of the invention is an isolated host cell (—) stranded RNA by a polymerase translated from the viral comprising the vector of the invention. genome. Upon entry into the cell, the virus RNA binds to 55 Another aspect of the invention is a method for expressing endogenous ribosomes and the genome is translated as a the polypeptides of the invention. single polypeptide chain. The large single polyprotein is sub sequently processed into mature proteins by three virus-en DETAILED DESCRIPTION OF THE INVENTION coded proteases (Verchot et al., Virology, 190:298-306, 1992), the ?rst protein (P1), the helper component (HC), and All publications, including but not limited to patents and the nuclear inclusion protein (NIa) proteases. The NIa pro patent applications, cited in this speci?cation are herein tease is responsible for the majority of the polyprotein pro incorporated by reference as though fully set forth. cessing, including the generation of mature RNA replication As used herein and in the claims, the singular forms “a,” associated proteins and capsid proteins (Verchot et al., “and,” and “the” include plural reference unless the context Virology, 190:298-306, 1992). 65 clearly dictates otherWise. Thus, for example, reference to “a The NIa proteases belong to the family of picomavirus 3C polypeptide” is a reference to one or more polypeptides and cysteine proteases (Parks et al., Virology, 210:194-201, includes equivalents thereof knoWn to those skilled in the art. US 8,426,186 B2 3 4 Unless de?ned otherwise, all technical and scienti?c terms glutamate); (2) basic (lysine, arginine histidine), (3) aliphatic used herein have the same meaning as commonly understood (glycine, alanine, valine, leucine, isoleucine, serine, threo by one of ordinary skill in the art to Which an invention nine), With serine and threonine optionally be grouped sepa belongs. Although any compositions and methods similar or rately as aliphatic-hydroxyl; (4) aromatic (phenylalanine, equivalent to those described herein can be used in the prac tyrosine, tryptophan); (5) amide (asparagine, glutamine); and tice or testing of the invention, exemplary compositions and (6) sulfur-containing (cysteine and methionine) (Stryer (ed.), methods are described herein. Biochemistry, 2nd ed, WH Freeman and Co ., 1981). Whether The term “Nla protease” as used herein refers to the potato a change in the amino acid sequence of a polypeptide or virus A (PVA) Nla protease encoded by amino acids 2032 fragment thereof encoded by a variant polynucleotide results 2264 of the virus proprotein shoWn in GenBank Acc. No. in a functional homolog can be readily determined by assess CAB58238. The polypeptide sequence of the Nla protease is ing the ability of the modi?ed polypeptide or fragment to shoWn in SEQ ID NO: 1. produce a response in a fashion similar to the unmodi?ed The term “polypeptide” as used herein refers to a molecule polypeptide or fragment using the assays described herein. that comprises at least tWo amino acid residues linked by a Peptides, polypeptides or proteins in Which more than one peptide bond to form a polypeptide. Small polypeptides of replacement has taken place can readily be tested in the same less than 50 amino acids may be referred to as “peptides”. manner. Polypeptides may also be referred as “proteins.” The term “Wild type” or “WT” refers to a polypeptide or a The term “polynucleotide” as used herein refers to a mol polynucleotide that has the characteristics of that polypeptide ecule comprising a chain of nucleotides covalently linked by or polynucleotide When isolated from a naturally occurring a sugar-phosphate backbone or other equivalent covalent 20 source. An exemplary Wild type polynucleotide is a poly chemistry. Double and single stranded DNAs and RNAs are nucleotide encoding a gene that is most frequently observed typical examples of polynucleotides. in a population and is thus arbitrarily designated the “normal” The term “complementary sequence” means a second iso or “reference” or “Wild type” form. lated polynucleotide sequence that is antiparallel to a ?rst The term “activity” or “active” as used herein refers to an isolated polynucleotide sequence and that comprises nucle 25 active Nla protease, e.g., a Nla protease capable of cleaving otides complementary to the nucleotides in the ?rst poly its substrate. Exemplary substrates are synthetic peptides cor nucleotide sequence. Typically, such “complementary responding to identi?ed recognition sequences, for example sequences” are capable of forming a double-stranded poly SEVVLFQASS (SEQ ID NO: 70), SEAVYTQGSS (SEQ ID nucleotide molecule such as double-stranded DNA or NO: 71), or SENVTFQGSS (SEQ ID NO: 72), as described in double-stranded RNA When combined under appropriate 30 Table 5. and in Mertis et al., (Mertis et al., J. Gen. Virol. conditions With the ?rst isolated polynucleotide sequence. 83: 121 1-1221, 2002). Partial cleavage of the substrate is suf The term “varian ” as used herein refers to a polypeptide or ?cient for effective biological activity of the protease, for a polynucleotide that differs from a reference “Wild type” example cleavage of 50%, 60%, 70%, 80%, 90%, 95%, or polypeptide or a polynucleotide and may or may not retain 99% of a substrate. Thus, biological activity does not require essential properties. Generally, differences in sequences of 35 complete cleavage of the substrate. “Partially active” refers to the Wild type and the variant are closely similar overall and, in a Nla protease that partially cleaves its substrate. many regions, identical. A variant may differ from the Wild The term “resistant to oxidation” or “oxidation resistant” type in its sequence by one or more modi?cations for as used herein means that the Nla protease variant is active example, substitutions, insertions or deletions of nucleotides and functionally stable in the absence of a reducing agent that or amino acids. Substitutions or insertions may result in con 40 is required for functional stability of the Wild type Nla pro servative or non-conservative amino acid substitutions, or in tease. The reducing agent required for the activity of the Wild the generation of a stop codon. A variant of a polynucleotide type Nla protease can be dithiotreitol (DTT), 2-mercaptoet may be naturally occurring, and may have 70%, 75%, 80%, hanol or tris carboxyethylphosphate (TCEP), typically in the 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity With the range of 01-10 mM. Wild type polynucleotide. 45 “Heterologous amino acid sequence” as used herein refers It is possible to modify the structure or function of the to an amino acid sequence not naturally fused to the Nla polypeptides encoded by variant polynucleotide sequences protease polypeptide. Heterologous amino acid sequences for such purposes as enhancing activity, speci?city, stability, can be attached to either the N- or C-terminus of the Nla solubility, and the like. A replacement of a codon encoding protease polypeptide using standard methods. The heterolo leucine With codons encoding isoleucine or valine, a codon 50 gous sequences can be used to provide a tag for fusion protein encoding an aspartate With a codon encoding glutamate, a puri?cation, such as attachment of polyhistidine or glutamine codon encoding threonine With a codon encoding serine, or a S-transferase tags, or to increase half life of the Nla protease, similar replacement of codons encoding structurally related such as attachment of a constant domain of an immunoglo amino acids (i.e., conservative mutations) Will, in some bulin or albumin, or fragments thereof. Heterologous amino instances but not all, not have a major effect on the biological 55 acid sequences can be fused to the polypeptide using Well activity of the resulting molecule. Conservative replacements knoWn methods, for example chemical coupling, or via an are those that take place Within a family of amino acids that amide bond. An immunoblogulin hinge or a fragment thereof, share chemically related side chains. Naturally occurring a fragment of a variable region of an immunoglobulin, or a amino acids can be divided into four families based on their linker can also be fused to the Nla protease polypeptide. side chains: (1) acidic (aspartate, glutamate); (2) basic 60 The term “vector” means a polynucleotide capable of (lysine, arginine, histidine); (3) nonpolar (alanine, valine, being duplicated Within a biological system or that can be leucine, isoleucine, proline, phenylalanine, methionine, tryp moved betWeen such systems. Vector polynucleotides typi tophan); and (4) uncharged polar (glycine, asparagine, cally contain elements, such as origins of replication, poly glutamine, cysteine, serine, threonine, tyrosine). Phenylala adenylation signal or selection markers, that function to nine, tryptophan, and tyrosine are sometimes classi?ed 65 facilitate the duplication or maintenance of these polynucle jointly as aromatic amino acids. Alternatively, naturally otides in a biological system. Examples of such biological occurring amino acids can be grouped as (1) acidic (aspartate, systems may include a cell, virus, bacteria, animal, plant, and US 8,426,186 B2 5 6 reconstituted biological systems utilizing biological compo Another embodiment of the invention is an isolated nents capable of duplicating a vector. The polynucleotides polypeptide comprising a polypeptide having the sequence comprising a vector may be DNA or RNA molecules or shoWn in SEQ ID NO: 1 having substitutions selected from hybrids of these. the group consisting of: The term “expression vector” means a vector that can be a. cysteine at position 19 is substituted for serine or valine; utiliZed in a biological system or a reconstituted biological b. cysteine at position 110 is substituted for serine; system to direct the translation of a polypeptide encoded by a c. cysteine at position 151 is substituted for serine or ala polynucleotide sequence present in the expression vector. nine. The present invention provides NIa protease variants that d. cysteine at position 181 is substituted for serine; and are resistant to oxidation, polynucleotides encoding the vari e. cysteine at position 211 is substituted for serine. ants, vectors comprising these polynucleotides, isolated host The polypeptides of the invention may comprise fusion cells, methods for expressing the polypeptides of the inven polypeptides comprising a polypeptide of the invention fused tion, and methods of using the polynucleotides and polypep With a heterologous polypeptide. Such heterologous polypep tides of the invention. The variants of the invention are useful tides may be leader or secretory signal sequences, a pre- or as research tools, and can be used, e.g., to cleave fusion pro- or prepro-protein sequence, a Histidine tag (His-tag) proteins to remove tags. (GentZ et al., Proc. Natl. Acad. Sci. (USA) 861821-284, One embodiment of the invention is an isolated polypep 1989), the HA peptide tag (Wilson et al., Cell 371767-778, tide encoding a NIa protease variant, Wherein the variant is 1984), glutathione-S-transferase, ?uorescent tags such as resistant to oxidation and retains its activity. In oxidiZing green ?uorescent protein (GFP), and the like. Exemplary NIa 20 conditions, i.e., in the absence of a reductant, the Wild type protease variantiHis-tag fusion proteins have amino acid NIa aggregates and becomes inactive (Example 1). sequences shoWn in SEQ ID NOs1 37, 38 or 39. In one aspect, In another embodiment, the NIa protease variant resistant the NIa protease variant polypeptide is fused to an immuno to oxidation and retaining its activity has at least one cysteine globulin constant domain or a fragment thereof. Such con residue substituted. Other variants may have 2, 3, 4 or 5 25 structs are Well knoWn and are described in eg US. Pat. Nos. cysteine residues substituted. The Wild type NIa protease 5,116,964, 5,709,859, 6,018,026; WO 04/002417; WO shoWn in SEQ ID NO: 1 has a total of ?ve cysteines1 one 04/002424; WO 05/081687; and WO 05/032460. Immuno active site cysteine at position 151, and four cysteines at globulin constant domain may be a CH1, CH2, or a CH3 positions 19, 1 10, 181 and 21 1 Which, based on crystal struc domain, or a hinge region, and can be derived from IgG1, ture predictions are on the surface of the protease and thus 30 IgG2, IgG3, IgG4, IgA, IgM, or IgA. The NIa protease variant susceptible to oxidation. Exemplary substitutions are substi polypeptide can be fused to an immunoglobulin constant tutions for serine, valine or alanine. Sequences of exemplary domain or a fragment thereof via a linker, for example a NIa protease variants are shoWn in Table 2. glycine-rich linker, or via a fragment of an immunoglobulin Variants of the invention can be made by Well knoWn variable region. Such linkers and variable region fragments 35 methods, for example site-directed or random mutagenesis are described in eg WO08/011,446 and US. Pat. No. 5,908, (Kunkel, Proc. Natl. Acad. Sci. USA, 821488-492, 1985; 626. Exemplary fusion proteins can be formed by conjugating Weiner et al., Gene, 1511119-123, 1994; Ishii et al., Methods together a NIa protease variant having an amino acid EnZymol., 293153-71, 1988), or by chemical synthesis (US. sequence shoWn in SEQ ID NO: 28 and one or more domains Pat. Nos. 6,670,127, 6,521,427). Rational design can be 40 derived from or similar to an immunoglobulin domain, such employed to design variants anticipated to have speci?c effect as CH1, CH2, and CH3 domain. on structure or activity of the Wild type protease. Whether a Another embodiment of an invention is an isolated change in the amino acid sequence of a polypeptide or frag polypeptide comprising a polypeptide having the sequence ment thereof results in a functional homolog can be readily shoWn in SEQ ID NO: 28. determined by assessing the ability of the variant polypeptide 45 In another embodiment, the invention provides for an iso or fragment to produce a response in a fashion similar to the lated polypeptide comprising a polypeptide having the Wild type polypeptide or fragment using the assays described sequence shoWn in SEQ ID NO: 28. herein. Peptides, polypeptides or proteins in Which more than The polypeptides of the invention can be lyophiliZed for one replacement has taken place can readily be tested in the storage and reconstituted in a suitable carrier prior to use. An same manner. Exemplary assays assessing protease activity 50 exemplary carrier is phosphate buffered saline. This tech nique has been shoWn to be effective With conventional pro measure ?uorescence released by a ?uorophore/quencher tein preparations. LyophiliZation and reconstitution tech substrate peptide such as 4-(4-dimethylaminophenylaZo) benZoyl (DABCYL)-YGENVTFQGSK-5-[(2-aminoethyl) niques are Well knoWn in the art, see e.g., Rey and May, Drugs and the Pharmaceutical Sciences Vol. 137, 1999; Wang, Int. J. amino]naphthalene-l-sulfonic acid (EDANS) (SEQ ID NO: 55 Pharm. 20311-60, 2000. These techniques alloW for the devel 73) upon proteolysis, or evaluate cleavage of a peptide sub opment of protein formulations With increased long term strate on SDS-PAGE after protease cleavage. stability, including storage at room temperature, as Well as The polypeptides of the invention may be produced by easier geographical distribution. This process also affords the chemical synthesis, such as solid phase peptide synthesis on protein to be used at higher concentrations by adjusting the an automated peptide synthesiZer. Alternatively, the polypep 60 reconstitution procedure. tides of the invention can be obtained from polynucleotides Another aspect of the invention is isolated polynucleotides encoding these polypeptides by the use of cell-free expres encoding any of the polypeptides of the invention or their sion systems such as reticulocyte lysate based expression complement. Certain exemplary polynucleotides are dis systems or by expression and isolation from cells harboring a closed herein, hoWever, other polynucleotides Which, given nucleic acid sequence of the invention by Well knoWn tech 65 the degeneracy of the genetic code or codon preferences in a niques, such as recombinant expression of easily isolated given expression system, encode the NIa protease variants of a?inity labeled polypeptides. the invention are also Within the scope of the invention. US 8,426,186 B2 7 8 Exemplary polynucleotides are polynucleotides comprising 3rd ed., Cold Spring Harbor Laboratory Press, Cold Spring the nucleic acid sequence shown in SEQ ID NOs: 41-43 and Harbor, N.Y., 2001). These methods include calcium phos 46-48. phate transfection, DEAE-Dextran mediated transfection, The polynucleotides of the invention may be produced by microinjection, cationic lipid-mediated transfection, elec chemical synthesis such as solid phase polynucleotide syn troporation, transduction, scrape loading, ballistic introduc thesis on an automated polynucleotide synthesizer. Alterna tion and infection. tively, the polynucleotides of the invention may be produced Another embodiment of the invention is a method for by other techniques such a PCR based duplication, vector expressing a polypeptide comprising the steps of providing a based duplication, or restriction enZyme based DNA manipu host cell of the invention and culturing the host cell under lation techniques. Techniques for producing or obtaining conditions su?icient for the expression of at least one polynucleotides of a given knoWn sequence are Well knoWn in polypeptide of the invention. The polypeptides of the inven the art. tion comprise polypeptides having an amino acid sequence The polynucleotides of the invention may also comprise at shoWn in SEQ ID NOs: 2-34 and 37-39. least one non-coding sequence, such as transcribed but not Host cells can be cultured under any conditions suitable for translated sequences, termination signals, ribosome binding maintaining or propagating a given type of host cell and sites, mRNA stabiliZing sequences, introns and polyadenyla suf?cient for expressing a polypeptide. Culture conditions, tion signals. media, and related methods su?icient for the expression of Another embodiment of the invention is a vector compris polypeptides are Well knoWn in the art. For example, many ing an isolated polynucleotide encoding polypeptides of the mammalian cell types can be aerobically cultured at 370 C. invention. 20 using appropriately buffered DMEM media While bacterial, Another embodiment of the invention is a vector compris yeast and other cell types may be cultured at 370 C. under ing an isolated polynucleotide having a sequence shoWn in appropriate atmospheric conditions in LB media. SEQ ID NO: 42 or 47. The vectors of the invention are useful In the methods of the invention the expression of a for maintaining polynucleotides, duplicating polynucle polypeptide can be con?rmed using a variety of different otides, or driving expression of a polypeptide encoded by a 25 techniques Well knoWn in the art. For example, expression of vector of the invention in a biological system, including a polypeptide can be con?rmed using SDS page, detection reconstituted biological systems. Vectors may be chromo reagents, such as antibodies or receptor ligands speci?c for an somal-, episomal- and virus-derived such as vectors derived expressed polypeptide, or using for example FACS or immu from bacterial plasmids, bacteriophages, transposons, yeast no?uorescent techniques. episomes, insertion elements, yeast chromosomal elements, 30 Other features of the invention Will become apparent in the baculoviruses, papova viruses such as SV40, vaccinia course of the folloWing descriptions of exemplary embodi viruses, adenoviruses, fowl pox viruses, pseudorabies ments Which are given for illustration of the invention and are viruses, picornaviruses and retroviruses and vectors derived not intended to be limiting thereof. from combinations thereof, such as cosmids and phagemids. The vectors of the invention can be formulated in micro 35 Example 1 particles, With adjuvants, lipid, buffer or other excipients as appropriate for a particular application. Generation and Characterization of NIa Variants In one embodiment of the invention the vector is an expres sion vector. Expression vectors typically comprise nucleic Cloning and Mutagenesis acid sequence elements that can control, regulate, cause or 40 The amino acid sequence of potato virus A NIa protease permit expression of a polypeptide encoded by such a vector. (Genbank Acc. No. CAB58238, amino acids residues 2032 Such elements may comprise transcriptional enhancer bind 2263), shoWn in SEQ ID NO: 1, including an N-terminal ing sites, RNA polymerase initiation sites, ribosome binding poly-histidine tag for af?nity puri?cation Was back translated sites, and other sites that facilitate the expression of encoded into a cDNA sequence optimiZing codon usage. The full polypeptides in a given expression system. Such expression 45 length cDNA Was generated by parsing the sequence into systems may be cell-based, or cell-free systems Well knoWn smaller fragments and synthesiZing these as oligonucleotides in the art. Nucleic acid sequence elements and parent vector using GENEWRITERTM technology and puri?ed by RP sequences suitable for use in the expression of encoded HPLC (Dionex, Germany). The puri?ed oligonucleotides polypeptides are also Well knoWn in the art. Were then assembled into a full-length, double stranded Another embodiment of the invention is an isolated host 50 cDNA fragment as described in US. Pat. No. 6,670,127 and cell comprising a vector of the invention. Representative host US. Pat. No. 6,521,427. cell examples include Archaea cells; bacterial cells such as The cDNA from the gene assembly process Was cloned Streptococci, Staphylococci, Enterococci, E. coli, Streptomy into the pET9d vector (Novagen, Madison, Wis.) into NcoI/ ces, cyanobacteria, B. sublilis and S. aureus; fungal cells such XhoI sites using standard protocols. Mutagenesis targeting as Kluveromyces, Saccharomyces, Basidomycete, Candida 55 active site cysteine and surface sulfydryl changes Was done albicans or Aspergillus; insect cells such as Drosophila S2 using the QuikChange site-directed mutatgenesis kit (Strat and Spodoplera Sf9; animal cells such as CHO, COS, HeLa, agene, La Jolla, Calif.) using oligonucleotides shoWn in Table C127, 3T3, BHK, 293, CV-1, BoWes melanoma and 1. Protein sequence alignments and the solved crystal struc myeloma; and plant cells, such as gymnosperrn or tures of TEV NIa protease ((Allison et al., Virology 154:9-20, angiosperm cells. The host cells in the methods of the inven 60 1986; Phan et al., J. Biol. Chem. 277:50564-72, 2002) Were tion may be provided as individual cells, or populations of used to estimate Whether the unpaired cysteine residues in cells. NIa protease Were surface exposed. As they all appeared to be Introduction of a polynucleotide, such as a vector, into a surface exposed, all Were targeted for point mutations. As a host cell can be effected by methods Well knoWn to those ?rst pass, all except the active site cysteine Were changed to skilled in the art (Davis et al., Basic Methods in Molecular 65 serine residues. Biology, 2'” ed., Appleton & Lange, NorWalk, Conn., 1994; The cysteine residue at position 19 did not tolerate the Sambrook et al., Molecular Cloning: A Laboratory Manual, serine substitution, as indicated by a lack of protein expres US 8,426,186 B2 9 1 0 sion (see below). Consequently, position 19 Was randomized TABLE 2-continued using an NNK oligo in a QuikChange site-directed mutagen esis reaction using standard protocols. Variants With tolerated Nla Variant SEQ 113 N01 DNA substitutions at residue 19 Were identi?ed by'prote1n expres- clgwcl 10S/C181S/C211S 20 s1on (see below). C151S active site substitutions Were mtro- 5 C19L/C110S/C181S/C211S 21 duced into these variants as described above, to assess the C19M/C110S/C181S/C211S 22 differences in catalytic activity. Generated variants and their C19N/C110S/C181S/C211S 23 . .d h . T M 2 E 1 C19P/C1108/C1818/C2118 24 ammo ac1 sequences are s own in' a e . xemp ary C19Q/C110S/C181S/C211S 25 cDNA sequences are shoWn for the Wild type NIa (SEQ ID C191Uc110s/c131s/c211s 26 NO: 40) and for the following NIa variants: C151S (SEQ ID 10 C19T/C110S/C181S/C211S 27 NO: 41), C19V/C110S/C181S/C211S (SEQ ID NO: 42), Six/2111100221 1881158222111; 3289* 42 WT (WEQ ID NO: 44), WT-H1s6 (SEQ ID NO: 45), C151'S- C110S/C151S/C181S/C211S 31 His6 (SEQ ID NO: 46), C19V/C110S/C181S/C211S-H1s6 Cling/C2115 32 (SEQ ID NO: 47), and C19V/C110S/C151S/C181S/C211S- 15 C19v/C1108/C1518/C1818/C2118 33 43 His6 (SEQ ID NO: 48). TABLE 2 Oligo Sequence SEQ ID NO: PVAH6 - 51 CTAACCATGGGCTCTACCTCTATGTTCCGTGGTGTTCGTGACTACAA 4 9 PVAH6 - 3 1 GTTACTCGAGTTATTAATGGTGATGGTGATGGTGGGTAACCAGTTTAACGG 5 o c151s- 51 CTACCAAAGACGGTCAGAGCGGTTCTCCGATCGTTTC 51 c151s-31 GAAACGATCGGAGAACCGCTCTGACCGTCTTTGGTAG 52 c151A- 51 CTCTACCAAAGAAGGTCACGCCGGTTCTCCGATCGTTTC 53 c151A- 3 1 GAAACGATCGGAGAACCGGCGTGACCTTCTTTGGTAGAG 54 c195 - 5 1 CCCGATCTCTTCTGTTATCAGCCAGCTGGAAAACGAATCTGAAGG 5 5 c195 -3 1 CCTTCAGATTCGTTTTCCAGCTGGCTGATAACAGAAGAGATCGGG 56 CllOS- 51 CGACCCACTCTGAAAAAGTTAGCCTGATCCTGACCAACTTCCAG 57 c11os-31 CTGGAAGTTGGTCAGGATCAGGCTAACTTTTTCAGAGTGGGTCG 5s Cl8lS- 51 CACCTCTAACTACTTCGCGAGCTTCCCGAAAGGTTTCACCG 59 C1815 - 3 1 CGGTGAAACCTTTCGGGAAGCTCGCGAAGTAGTTAGAGGTG 6 o c211s- 51 CAACGCGTCTAACGTTAGCTGGGGTTCTTTCCACCTG 6 1 c211s- 3 1 CAGGTGGAAAGAACCCCAGCTAACGTTAGACGCGTTG 62 c19NNK-51 ACCCGATCTCTTCTGTTATCN'NKCAGCTGGAAAACGAATCTGAAG 63 Cl9NNK- 3 1 CTTCAGATTCGTTTTCCAGCTGMNNGATAACAGAAGAGATCGGGT 6 4 TABLE 2 TABLE 2-continued NIa variant SEQ ID NO: DNA 50 NIa variant SEQ ID NO: DNA WT 1 40 C151A 34 C1518 2 41 His6-WT 35 44 C1108 3 WT-His6 36 45 C1818 4 C151S-His6 37 46 C2118 5 55 C19V/C110S/C181S/C211S-His6 38 47 C198/C1108/C1818 6 C19V/C110S/C151S/C181S/C211S-His6 39 48 C198/C1108/C2118 7 Cl9S/Cl81S/C211S 8 *NIa variant has an amino acid sequence ofresidues 1-233 of SEQ ID NO: 38 C198/C1108/C1818/C2118 9 C1108/C1818 10 Protein Expression CUOS/ C2115 11 60 Plasmids encoding cDNAs for the NIa protease variants in CC11190NSC/1C1108S1/SC/1C8211S1/SC 211S 1132 Table 1 Were transformed i. n BL21 cells and si. ngle colon1. es C19D/C1108/C1818/C2118 14 from the transformants cultured in LB media With 100 ug/ml i2 kanamycin at +37° C. overnight. Induction took place When C110S/C181S/C211S 17 the cultures reached OD600 of~0.6-0.~8 With 1 IPTQ, or C19H/C1 log/clglg/cgllg 1g 65 by culturmg the cells in TB auto-induction med1a (Overnight C19I/C1108/C1818/C2118 19 Express Autoinduction Media, EMD Biosciences, Gibb stoWn, N.J.). The cells Were further cultured overnight at 25° US 8,426,186 B2 11 12 C. or 180 C., centrifuged and stored at —80° C. All Nla conditions does the C151A variant With 4 free surface sulf protease variants With a Wild-type C19 residue expressed very hydryls collapse to a predominantly single, monomeric spe Well in all surface sulfhydryl change combinations explored cies. HoWever, the proteases With all surface sulfhydryls (Table 3). changes behave as monomeric proteins in the complete For the NNK library, the constructs Were screened for absence of reducing agent. This suggests that these changes soluble protein expression in TB auto induction media, as provide a clear physical bene?t While retaining catalytic described above. A Western blot Was run to analyZe the expression of the NNK variants. activity (see beloW). TABLE 3 Substitutions Plasmid Variant C19 C110 C181 C211 C151 Number Expression Activity Hiss-WT pDR1706 + + WT pDR2090 + + C1518 8 pDR2092 + + C151A A pDR2091 + C1108 8 pDK3385 + C1818 8 pDK3388 + C2118 8 pDK3390 + C198/C1108/C1818 8 8 8 pDK3384 — C198/C1108/C2118 8 8 8 pDK3383 — C198/C1818/C2118 8 8 8 pDK3382 — C198/C1108/C1818/C2118 8 8 8 8 pDR2371 — C1108/C1818 8 8 pDK3386 + C1108/C2118 pDK3387 + C1108/C1818/C2118 8 8 8 pDK3202 + + C1108/C1518/C1818/C2118 8 8 8 8 pDK3467 + + C1818/C2118 8 8 pDK3389 + C19V/C1108/C1818/C2118 V 8 8 8 pDK3217 + + C19V/C1108/C1518/C1818/C2118 V 8 8 8 8 pDK3466 + + 30 Although several of the position 19 NNK variants Were Substrate and Activity Determination detectable at loW levels (variants l, K, L, M, R, S, T, W, Y, F, A Wild-card recognition sequence, EXVXXQX (SEQ ID G and H substitutions) (1 -2% of the Wild-type Nla), the NO: 74), Was used to search the polyprotein sequence of PVA variant C19V Was expressed at signi?cantly higher level than to determine a consensus recognition sequence for the Nla 35 protease. This Was done independently of published Work any other variant, and at a level equivalent to the Wild type identifying the processing junction points Within the PVA Nla. Based on the information, the folloWing variants Were polyprotein (Mertis et al., J. General Virol., 83:1211-1221, selected for further studies: WT, C1518, C110S/C181S/ 2002). Published and potential recognition sequences, as Well C2118, C110S/C151S/C181S/C211S, C19V/C110S/C1818/ as the consensus sequence determined in this study listed in C2118 and C19V/C110S/C151S/C181S/C211S. 40 Table 4. Synthetic peptides corresponding to select recogni Protein Puri?cation tion sequences Were synthesiZed using solid-phase peptide Protein puri?cation Was done using standard methods in chemistry (Anaspec, San Jose, Calif.) and tested for cleavage the presence of a reducing agent, 2 mM TCEP. Brie?y, cell by the Wild type Nla protease. Reactions Were performed in pellets Were resuspended in Buffer A (20 mM tris-HCl, pH 20mM tris-HCl, pH 8.0, 150mM NaCl and 1mM dithiothrei 7.5, 500 mM NaCl, 2 mM TCEP) supplemented With 0.1 45 tol (DTT) containing 5 uM PVA Nla protease and 500 uM U/ml benZonase and 0.3 mg/ml lysoZyme, soincated on ice, peptide and Were analyZed by reverse-phase HPLC and LC ?ltered, and the cleared lysates Were loaded onto a 5 ml M8. HisTrap HP (GE Biosciences, PiscataWay, N.J.) column pre EnZyme activity Was also determined for each variant equilibrated With buffer A using an AKTA Explorer puri?ca using a fusion substrate protein containing the Nla protease tion system (GE Lifesciences, PiscataWay, N.J.). Proteins 50 consensus recognition sequence, ENVTFQG (SEQ ID Were eluted using an imidaZole step gradient of 50-500 mM NO:65). The consensus sequence Was engineered into a imidaZole in buffer A. Fractions Were analyZed by SDS fusion protein and used as a substrate to assess the enZymatic PAGE and the fractions containing the protein of interest Were activity for all PVA Nla protease variants. Since the sequence pooled and concentrated and ?ltered, folloWed by further contained a consensus site for N-linked glycosylation (NV T), puri?cation by siZe exclusion chromatography (SEC). Con 55 another sequence Was explored, EAVTFQG (SEQ ID NO: centrated and clari?ed samples Were loaded directly onto a 66), With equal success. These fusion proteins contained an Superdex75 SEC matrix (GE Lifesciences, PiscataWay, N.J.) N-terminal poly-histidine tag to facilitate puri?cation, the pre-equilibrated With bufferA and separated isocratically at a PNla protease consensus recognition sequence, an S-tag for How rate of 1 ml/min. Fractions Were analyZed by SDS-PAGE sensitive detection of proteolytic cleavage and a highly and the fractions containing protein Were pooled and tested 60 soluble “?ller” protein to facilitate soluble expression of the for enZymatic activity. All puri?ed variants expressed Well fusion substrate protein. This cassette Was generated by and Were puri?ed to over 95% purity. amplifying the region betWeen the 3' end of the thrombin Some of the variants (C151A, C19V/C110S/C181S/ cleavage site and the Xhol site in pET41 (Novagen), adding C2118 and C19V/C110S/C151S/C1818/C211S) Were also the recognition sequence and Ndel cloning site in the 5' puri?ed in the absence of the reducing agent, 2 mM TCEP, in 65 primer and inserting into the Ndel and Xhol restriction sites order to evaluate the effect of oxidiZing environment to pro of pET28 (Novagen). The “?ller” proteins could then be tein expression, stability, and activity. Only under reducing inserted into the multiple cloning site pulled over from US 8,426,186 B2 13 1 4 pET41. Polypeptide sequence of the fusion proteins With the The NIa protease active site variants (C15 1 S, C110S/C151S/ ENVTFQG and the EAVTFQG consensus recognition C181S/C211S, C19V/C110S/C151S/C181S/C211S) also sequences are shoWn in SEQ ID NO: s 67 and 68, respectively. cleaved the substrate, albeit With less e?iciency (1 -5% of As fusion substrate controls, analogous constructs Were substrate cleaved) When compared to the Wild type NIa (data generated With both TEV (Dougher‘ty et al., Virology, 171: not shoWn). 356-364, 1989) and TVMV NIa protease recognition Enzyme Kinetics sequences (Nallamsetty et al., Protein Expr. and Puri?c. Wild-type NIa protease and active site and surface cysteine 38:108-1 15, 2004) (Table 4). Analogous to human rhinovirus variants Were tested for activity against the ?uorophore/ 3C(HRV3C) recognition sequence, a fusion protein With a P2' quencher substrate peptide 4-(4 -dimethylaminophenylaZo) benZoyl (DABCYL)-YGENVTFQGSK-5-[(2-aminoethyl) proline Was also generated for the consensus sequence and tested as a substrate (Table 4). All recognition sequences Were amino]naphthalene-1-sulfonic acid (EDANS) (Anaspec, San inserted into the fusion substrate protein, described above, Jose, Calif.). Kinetic measurements Were performed on a including the published recognition sequences for TEV and Spectramax M2 microplate reader (Molecular Devices) using TVMV proteases listed. Reactions Were performed in 20 mM an excitation Wavelength of 340 nm and emission Wavelength Tris-HCl, pH 8.0, 150 mM NaCl and 1 mM DTT and alloWed of 490 nm. The reactions Were performed in 50 mM Tris-HCl, to run overnight at 370 C. pH 8.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT With 2 mM Although it has been shoWn that the substrate speci?city of enZyme and 01-300 uM substrate and folloWed for 30 min 3C-like proteases is very high (ToZer et al., The FEBS J. utes at 370 C. EnZyme concentrations Were determined from 272:514-523, 2004), NIa Wild type protease Was able to the calculated theoretical extinction coe?icient. Initial veloci cleave the fusion substrate With the TVMV NIa protease 20 ties Were determined for each and are shoWn in Table 5. recognition sequence, although at a much loWer rate than the PVA NIa protease consensus sequence. HoWever, the NIa TABLE 5 Wild type protease Was unable to cleave either the TEV NIa protease recognition sequence or the PVA NIa protease con Plasmid (RFU/ Km Relative ° sensus sequence With a P2' proline residue in this format, the 25 Variant Number DTT min) (uM) Kan/Km latter suggesting some level of P2' speci?city (Table 4). WT pDR2090 + 78466 177.6 100 C151S pDR2092 + 3236 164.9 4.3 TABLE 4 C110S/C181S/C211S pDK3202 + 51110 251.5 45.9 C110S/C151S/C181S/ pDK3467 + 2346 71.8 7.6 Cleaved C211S Recognition S EQ ID Synthetic S EQ ID by C19V/C110S/C181S/ pDK3217 + 75184 275.4 59.5 Junction* Sequence NO: Peptide* * NO: NIa C211S C19V/C110S/C151S/ pDK3466 + 1888 39.6 10.8 P3/ 6K1 EVVLFQAA 75 SEVVLFQASS 70 Yes C181S/C211S C19V/C110S/C181S/ pDK3217 — 53847 175.4 69.1 35 C211S VPg/Pro ESVEFES 79 C19V/C110S/C151S/ pDK3466 — 1358 43.1 7.1 C181S/C211S NIa/NIb EAVYTQGA 80 SEAVYTQGSS 71 Yes NIb/ cap DMVYFQA 81 NA ENVTKQLA 82 SENVTKQLSS 87 No The substitutions to the surface exposed cysteine residues NA EMVTNQSA 83 SEMVTNQS S S 8 8 No had a minor effect on catalytic activity of NIa protease, Consensus ENVTFQG 65 SENVTFQGSS 72 Yes 40 ENVTFQGP 84 No Whereas substitutions at the active site cysteine (C151) TEV ENLYGQGS 85 No reduced activity signi?cantly. This can be explained by the TVMV ETVRFQGS 86 Yes inability of the substituted serine to donate its hydroxyl pro ton required for catalysis in the micro-environment Within the *As determined in Mertis et. al., 2002. active site, Whereas deprotonation of cysteine readily occurs ASequences that met the EXVXXQX search criteria and from Which the consensus sequence 45 peptide Was generated at physiological pH. *Synthetic peptide used in the assays HoWever, to determine Whether having a reducing agent The Wild type NIa protease and variants C151S, C110S/ present during the puri?cation process as Well as during activ C181S/C211S, C110S/C151S/C181S/C211S, C19V/C110S/ ity measurements impacted only molecules With an active site C181S/C211S and C19V/C1 10S/C151S/C181S/C21 1S Were cysteine; tWo PVA NIa protease variants (C19V/C110S/ 50 screened for activity against the fusion substrate protein With C181S/C211S and C19V/C110S/C151S/C181S/C211S) the ENVTFQG (SEQ ID NO: 66) consensus recognition site. Were puri?ed and assayed in the absence of reductant. The Reaction conditions Were identical to those described above. absence of reductant had little effect on the activity of either Proteolytic cleavage of the substrate Was monitored by SDS variant (Table 5). This suggests that the active site cysteine in PAGE. Each NIa protease With an active site cysteine residue these proteins may not be overly sensitive to an oxidiZing environment and liability is predominantly due to the non cleaved the substrate to completion under these conditions. active site cysteine residues. SEQUENCE LISTING <l60> NUMBER OF SEQ ID NOS: 88 <2lO> SEQ ID NO 1 <2ll> LENGTH: 233 <2l2> TYPE: PRT US 8,426,186 B2 15 16 —cont inued <2l3> ORGANISM: Potato Virus <220> FEATURE: <223> OTHER INFORMATION: NIa protease <400> SEQUENCE: 1 Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 15 Val Ile Cys Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn His Leu Phe 35 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg 65 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile 105 11O Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp 145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Asn Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr 225 230 SEQ ID NO 2 LENGTH: 233 TYPE: PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Potato virus C151S Mutant <400> SEQUENCE: 2 Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 15 Val Ile Cys Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn His Leu Phe 35 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg 65 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Cys Leu Ile US 8,426,186 B2 17 18 —cont inued 100 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Ser Gly Ser Pro Ile Val Ser Thr Thr Asp 145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr 225 230 SEQ ID NO 3 LENGTH: 233 TYPE: PRT ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Potato Virus C11OS Mutant <400> SEQUENCE: 3 Ser Thr Ser Met Phe Arg Gly Val Arg Asp Tyr Asn Pro Ile Ser Ser 1 5 15 Val Ile Cys Leu Glu Asn Glu Ser Glu Gly Arg Thr Thr Gln Leu 25 30 Phe Gly Leu Gly Phe Gly Pro Phe Ile Ile Thr Asn His Leu Phe 35 45 Val Arg Asn Asn Gly Ser Leu Thr Val Arg Ser Gln Met Gly Val Phe 50 55 60 Lys Val Asn Ser Thr Val Thr Leu Gln Met Arg Pro Val Glu Gly Arg 65 80 Asp Val Leu Ile Ile Lys Met Pro Lys Asp Phe Pro Pro Phe Pro Gln 95 Arg Leu Lys Phe Arg Gln Pro Thr His Ser Glu Lys Val Ser Leu Ile 105 110 Leu Thr Asn Phe Gln Gln Lys Ser Ser Ser Ser Met Val Ser Glu Thr 115 120 125 Ser His Ile Ile Pro Lys Glu Asn Thr Tyr Phe Trp Lys His Trp Ile 130 135 140 Ser Thr Lys Glu Gly His Cys Gly Ser Pro Ile Val Ser Thr Thr Asp 145 150 155 160 Gly Ala Ile Leu Gly Ile His Ser Leu Ser Asn Met Thr Asn Thr Ser 165 170 175 Tyr Phe Ala Cys Phe Pro Lys Gly Phe Thr Glu Thr Tyr Leu Ala 180 185 190 Thr Glu Ser Ala His Glu Trp Val Lys Gly Trp Lys Phe Asn Ala Ser 195 200 205 Asn Val Cys Trp Gly Ser Phe His Leu Gln Asp Ser Lys Pro Thr Lys 210 215 220 Glu Phe Lys Thr Val Lys Leu Val Thr 225 230

See more

The list of books you might like