loading

Logout succeed

Logout succeed. See you again!

ebook img

evolution of genomic abnormalities in relapsed acute lymphoblastic leukemia PDF

pages102 Pages
release year2008
file size2.9 MB
languageEnglish

Preview evolution of genomic abnormalities in relapsed acute lymphoblastic leukemia

www.sciencemag.org/cgi/content/full/322/5906/1377/DC1 Supporting Online Material for Genomic Analysis of the Clonal Origins of Relapsed Acute Lymphoblastic Leukemia Charles G. Mullighan, Letha A. Phillips, Xiaoping Su, Jing Ma, Christopher B. Miller, Sheila A. Shurtleff, James R. Downing* *To whom correspondence should be addressed. E-mail: [email protected] Published 28 November 2008, Science 322, 1377 (2008) DOI: 10.1126/science.1164266 This PDF file includes: Materials and Methods SOM Text Figs. S1 to S15 Tables S1 to S21 References SUPPLEMENTARY METHODS Cases and samples studied Sixty one cases of relapsed acute lymphoblastic leukemia treated at St Jude Children’s Research Hospital from 1988-2007 with cryopreserved peripheral blood or bone marrow samples obtained at both diagnosis and relapse were identified. The cohort comprised 47 B-progenitor (six high hyperdiploid, one TCF3-PBX1, five ETV6-RUNX1, five MLL-rearranged, four BCR-ABL1, and 26 with low hyperdiploidy, pseudodiploid or miscellaneous/normal karyotypes) and 14 T-lineage ALL cases (Supplementary Table 1). The study fulfilled requirements of the Declaration of Helsinki, and was approved by the St Jude Children’s Research Hospital Institutional Review Board. Sample preparation and DNA extraction. Samples with at least 80% blasts (as assessed by morphologic examination or immunophenotyping at the time of cryopreservation) were thawed, pelleted and DNA extracted without further processing. Diagnostic or relapse samples with less than 80% blasts were flow sorted to at least 90% blast purity prior to DNA extraction using FACSVantage SE (with DiVa option) flow cytometers (BD Biosciences, San Jose, CA) and fluorescein isothiocyanate labelled CD45, allophycocyanin labelled CD33, allophycocyanin labelled CD7 (Invitrogen (CALTAG), Carlsbad, CA) and phycoerythrin labelled CD3, CD5, CD13 CD19 antibodies (BD Biosciences). DNA was extracted from leukemic blasts using the DNA blood mini kit (Qiagen, Valencia, CA) or phenol/chloroform. DNA quality and integrity was assessed using a Nanodrop ND-1000 spectrophotometer (Wilmington, DE) or by agarose gel electrophoresis. Single nucleotide polymorphism microarray analysis 500ng of sample DNA was digested with NspI and StyI restriction enzymes and processed according to the manufacturer’s instructions for Affymetrix 250k Nsp and Sty arrays (14 diagnosis and relapse pairs) or Affymetrix SNP 6.0 arrays (47 pairs). For the 250k mapping arrays, SNP genotype calls were generated using the DM algorithm in GTYPE v 4.0 (Affymetrix). For 6.0 arrays, SNP genotype calls were generated using the birdseed v1 or v2 algorithms in Genotyping console v1 or v2.0 (Affymetrix). Genotyping using the birdseed algorithm was performed using at least 44 arrays in each analysis. 4 Array normalization and copy number inference was performed according to a previously published workflow (1, 2). Extraction and summarization of SNP/CNV probe hybridization intensities from CEL files was performed in dChip (3) using the PM/MM (250k arrays) or PM- only (6.0 arrays) model-based expression algorithms. Un-normalized data was exported from dChip and normalization performed using a “reference normalization” algorithm that uses only probes from chromosomes known or predicted to be diploid (based on SNP genotype frequency data) to guide array normalization. This approach normalizes each array independently without “borrowing” information across arrays, and results in more accurate downstream copy number inferences than alternative approaches (ref. (1) and SB Pounds et al., submitted). Normalized data were then viewed in dChip and regions of abnormal copy number identified computationally by circular binary segmentation (CBS) (4). CBS results were filtered to use only segments of at least 5 markers (SNP and/or CNV) with segment copy number means of >2.29 or <1.69 for downstream analysis. Notably, signals of both SNP and copy number variant probes on the 6.0 arrays were processed, normalized, and used for copy number inference simultaneously, thus maximizing the resolution of the arrays. SNP array CEL, CHP and TXT file data are available from the authors upon request. For samples with matched germline array data, segmentation was performed pairwise, with each diagnostic or relapse sample compared directly to the corresponding germline sample. For samples without a matched germline sample, segmentation was performed using a pool of germline samples run in the same SNP array batch (typically 7-12 germline samples in each batch). To distinguish somatic from inherited copy number variants, each identified region of copy number alteration was compared to a local database of over 300 reference samples, and public databases of copy number polymorphisms (http://projects.tcag.ca/variation/ and http://www.genome.ucsc.edu/). Copy number abnormalities in unpaired samples similar or matching those previously described or observed in our local repository were deemed inherited and excluded from subsequent analysis. To systematically identify copy number abnormalities acquired at relapse, we first identified all segments of CNA at diagnosis by comparing each diagnosis sample to the corresponding germline or pool of unpaired germline samples, and then identified all segments of CNA in relapse samples similarly. We then subtracted curated diagnosis segmentation data from curated 5 relapse segmentation data. As confirmation, circular binary segmentation was also performed pairwise by comparing the relapse sample directly to the corresponding diagnostic sample. Final lesion listings and tallies exclude DNA gains and losses arising from B- and T- cell antigen receptor gene rearrangements at 2p11.2 (IGK@), 7p14.1 (TRG@), 7q34 (TRB@), 14q11.2 (TRA@), 14q32.33 (IGH@) and 22q11.22 (IGL@). In order to perform unsupervised hierarchical clustering of copy number abnormalities, CBS segmentation data was filtered as described above, and then manually curated to exclude inherited copy number variants and segments arising from experimental artifact (e.g. inter-batch effects). To ensure data from the SNP 250k arrays (the annotations for which are based on the hg17 genome build) were comparable to data from the SNP 6.0 arrays (based on the hg18 genome build), genome coordinates of the segments from the SNP 6.0 arrays were converted to the corresponding hg17 genome coordinates using the command line liftOver tool available from UCSC genome browser (http://hgdownload.cse.ucsc.edu/admin/exe/). Curated CBS segments were then re-extrapolated into a genome-wide matrix of 615,000 probe-set features for all diagnosis and relapse cases. To reduce data set complexity and permit clustering, autosomal copy number data was binned into 500Kb sliding windows with 50% overlap between windows, resulting in a matrix of 10,746 rows (500Kb copy number bins) and 122 columns (61 diagnosis- recipient pairs). When deletions and gains were present in the same window, deletion was given precedence. Clustering was performed using the Pearson correlation similarity and Ward linkage clustering algorithm in GeneMaths XT v 2.1 (Applied Maths, Austin, TX). Pathway analysis of CNAs acquired at relapse Enrichment of genes involved by CNAs acquired at relapse in biological pathways was assessed using Fisher’s exact test. The pathways examined included the 147 canonical pathways defined by Ingenuity Pathway analysis (Ingenuity Systems, Redwood City, CA) and a B-lymphoid developmental pathway consisting of transcriptional regulators of normal lymphoid development (comprising IL7RA, SPI1, TCF3, IKZF1, IKZF2, IKZF3, EBF1, PAX5, LEF1, IRF4, IRF8, BCL11A, SOX4, STAT3, STAT5A, STAT5B, BLNK, RAG1, RAG2, MEF2C, CD79A, GAPBA). Relapse-CNAs were mapped to the genomic locations of each gene, including a window of 20kb proximal and distal to each gene. 6 To identify pathways most frequently affected by the relapse-CNAs, Fisher’s exact test was performed for the genes involved by CNAs for each case using a contingency table as follows: Genes involved by relapse Genes not involved by relapse CNAs for each case CNAs for each case Pathway X Number of genes in a given Number of genes in pathway pathway X involved by CNAs X not involved by CNAs at at relapse relapse Non-Pathway X Number of genes not in Number of genes not in pathway X, but involved by pathway X and not involved CNAs at relapse by CNAs at relapse Significantly enriched pathways for each case were identified, and the false discovery rate estimated using the method of Benjamini and Hochberg (5). Pathways below an FDR threshold of 30% were reported. The number of cases showing significant enrichment for each pathway was used to rank the pathways. Genomic quantitative real-time PCR Confirmation of copy number abnormalities using genomic quantitative real-time PCR (gqPCR) was performed for PAX5 and IKZF1 deletions as previously described. (1, 2). gqPCR for deletions involving ADD3, C20orf94, CDKN2A/B, the IKZF1 promoter region, IKZF2, IKZF3, and MKKS was performed using primers and probes detailed in Supplementary Table 2. Genomic PCR for lesion backtracking Lesion-specific qualitative genomic PCR assays were designed by tiling primers outward from the genomic locations of SNP array probes defining the minimal regions of deletion at 500-1500 bp intervals to beyond the next non-deleted probes up- and downstream of the deletion. Primers were designed using Primer3 (6), and a matrix of PCR reactions using all combinations of forward and reverse PCR primers used to amplify the region of genomic deletion. The genomic deletion breakpoints were defined by direct sequencing of PCR products. PCR was performed using 25-50ng genomic DNA in 25 l reaction volumes using the Advantage 2 PCR Kit (Clontech, Mountain View, CA), Mastercycler PCR machines (Eppendorf) and the following thermal cycling conditions: 5 cycles of 94°C for 30 sec and 72°C 3 min, followed by 5 cycles of 7 94°C for 30 sec, 70°C for 30 sec and 72°C 3 min, followed by 25 cycles of 94°C for 30 sec, 68°C for 30 sec and 72°C 3 min. Sequences of primers used for lesion-specific PCR are shown in Supplementary Table 3. 8 Supplementary Table 1. ALL samples examined by SNP array analysis *Published in refs (1, 2). 6.0, Affymetrix SNP 6.0 arrays; 500K, Affymetrix 250k Sty and Nsp arrays. TCF3-PBX1 cases are referred to as E2A-PBX1, and ETV6-RUNX1 as TEL-AML1 for consistency with sample naming in our previous publications. SNP Previously array Diagnosis ID published?* Remission sample ID data Relapse ID Hyperdip50-SNP-#27 Yes Hyperdip50-SNP-#27GL 6.0 Hyperdip50-SNP-#27R Hyperdip50-SNP-#51 No 6.0 Hyperdip50-SNP-#51R Hyperdip50-SNP-#52 No 6.0 Hyperdip50-SNP-#52R Hyperdip50-SNP-#53 No Hyperdip50-SNP-#53GL 6.0 Hyperdip50-SNP-#53R Hyperdip50-SNP-#54 No Hyperdip50-SNP-#54GL 6.0 Hyperdip50-SNP-#54R Hyperdip50-SNP-#55 No 6.0 Hyperdip50-SNP-#55R E2A-PBX1-SNP-#12 Yes E2A-PBX1-SNP-#12GL 6.0 E2A-PBX1-SNP-#12R TEL-AML1-SNP-#10 Yes TEL-AML1-SNP-#10GL 500K TEL-AML1-SNP-#10R TEL-AML1-SNP-#44 Yes TEL-AML1-SNP-#44GL 500K TEL-AML1-SNP-#44R TEL-AML1-SNP-#48 Yes TEL-AML1-SNP-#48GL 6.0 TEL-AML1-SNP-#48R TEL-AML1-SNP-#49 No TEL-AML1-SNP-#49GL 6.0 TEL-AML1-SNP-#49R TEL-AML1-SNP-#50 No 6.0 TEL-AML1-SNP-#50R MLL-SNP-#6 Yes MLL-SNP-#6GL 500K MLL-SNP-#6R MLL-SNP-#8 Yes MLL-SNP-#8GL 500K MLL-SNP-#8R MLL-SNP-#23 Yes MLL-SNP-#23GL 6.0 MLL-SNP-#23R MLL-SNP-#24 No MLL-SNP-#24GL 6.0 MLL-SNP-#24R MLL-SNP-#25 No MLL-SNP-#25GL 6.0 MLL-SNP-#25R BCR-ABL-SNP-#11 Yes 6.0 BCR-ABL-SNP-#11R BCR-ABL-SNP-#16 Yes BCR-ABL-SNP-#16GL 6.0 BCR-ABL-SNP-#16R BCR-ABL-SNP-#15 Yes BCR-ABL-SNP-#15GL 6.0 BCR-ABL-SNP-#15R BCR-ABL-SNP-#18 Yes BCR-ABL-SNP-#18GL 6.0 BCR-ABL-SNP-#18R Hyperdip47-50-SNP-#4 Yes Hyperdip47-50-SNP-#4GL 6.0 Hyperdip47-50-SNP-#4R Hyperdip47-50-SNP-#24 Yes 500K Hyperdip47-50-SNP-#24R Pseudodip-SNP-#2 Yes Pseudodip-SNP-#2GL 500K Pseudodip-SNP-#2R Pseudodip-SNP-#7 Yes Pseudodip-SNP-#7GL 500K Pseudodip-SNP-#7R Pseudodip-SNP-#18 Yes Pseudodip-SNP-#18GL 6.0 Pseudodip-SNP-#18R Pseudodip-SNP-#23 Yes 500K Pseudodip-SNP-#23R Other-SNP-#12 Yes Other-SNP-#12GL 500K Other-SNP-#12R Other-SNP-#13 Yes Other-SNP-#13GL 500K Other-SNP-#13R Other-SNP-#21 Yes Other-SNP-#21GL 6.0 Other-SNP-#21R Other-SNP-#27 No 6.0 Other-SNP-#27R Other-SNP-#28 No 6.0 Other-SNP-#28R Other-SNP-#29 No 6.0 Other-SNP-#29R Other-SNP-#30 No Other-SNP-#30GL 6.0 Other-SNP-#30R Other-SNP-#31 No 6.0 Other-SNP-#31R Other-SNP-#32 No Other-SNP-#32GL 6.0 Other-SNP-#32R 9 SNP Previously array Diagnosis ID published?* Remission sample ID data Relapse ID Other-SNP-#33 No Other-SNP-#33GL 6.0 Other-SNP-#33R Other-SNP-#34 No Other-SNP-#34GL 6.0 Other-SNP-#34R Other-SNP-#35 No Other-SNP-#35GL 32 Other-SNP-#35R Other-SNP-#36 No Other-SNP-#36GL 6.0 Other-SNP-#36R Other-SNP-#37 No Other-SNP-#37GL 6.0 Other-SNP-#37R Other-SNP-#38 No Other-SNP-#38GL 6.0 Other-SNP-#38R Other-SNP-#40 No Other-SNP-#40GL 6.0 Other-SNP-#40R Other-SNP-#41 No Other-SNP-#41GL 6.0 Other-SNP-#41R Other-SNP-#42 No Other-SNP-#42GL 6.0 Other-SNP-#42R Other-SNP-#43 No Other-SNP-#43GL 32 Other-SNP-#43R Other-SNP-#39 No Other-SNP-#39GL 6.0 Other-SNP-#39R T-ALL-SNP-#4 Yes T-ALL-SNP-#4GL 500K T-ALL-SNP-#4R T-ALL-SNP-#31 Yes T-ALL-SNP-#31GL 500K T-ALL-SNP-#31R T-ALL-SNP-#34 Yes T-ALL-SNP-#34GL 500K T-ALL-SNP-#34R T-ALL-SNP-#37 Yes T-ALL-SNP-#37GL 500K T-ALL-SNP-#37R T-ALL-SNP-#36 Yes T-ALL-SNP-#36GL 6.0 T-ALL-SNP-#36R T-ALL-SNP-#43 Yes T-ALL-SNP-#43GL 6.0 T-ALL-SNP-#43R T-ALL-SNP-#46 Yes T-ALL-SNP-#46GL 6.0 T-ALL-SNP-#46R T-ALL-SNP-#51 No 6.0 T-ALL-SNP-#51R T-ALL-SNP-#52 No 6.0 T-ALL-SNP-#52R T-ALL-SNP-#53 No T-ALL-SNP-#53GL 6.0 T-ALL-SNP-#53R T-ALL-SNP-#54 No T-ALL-SNP-#54GL 6.0 T-ALL-SNP-#54R T-ALL-SNP-#55 No T-ALL-SNP-#55GL 6.0 T-ALL-SNP-#55R T-ALL-SNP-#57 No T-ALL-SNP-#57GL 6.0 T-ALL-SNP-#57R T-ALL-SNP-#58 No T-ALL-SNP-#58GL 6.0 T-ALL-SNP-#58R 10 Supplementary Table 2. Genomic quantitative PCR primers Quantitative PCR primers were designed using Primer Express 3.0 (Applied Biosystems, Foster City, CA). Primers for CDKN2B exon 1 reaction 1 (C745-747) and exon 1 reaction 2 (C748-750) are alternative primer sets that are both located in exon 1 of CDKN2B. Primers for CDKN2A exon 2 reaction 1 (C769-771) are located in intron 1 immediately upstream of exon 2. Primers for CDKN2A exon 2 reaction 2 are located in intron 2 downstream of exon 2. F, forward primer; FAM, 6-carboxyfluorescein; MGB, minor groove binder; P, probe; R, reverse primer. Primer Description Sequence (5' → 3') C745 CDKN2B exon 1 F1 GACGACGGGAGGGTAATGAA C746 CDKN2B exon 1 R1 GGCGCACTCTCTCCTTCCT C747 CDKN2B exon 1 P1 FAM-AGCCCAGGTCTCC-MGB C748 CDKN2B exon 1 F2 CGTGGGAAAGAAGGGAAGAGT C749 CDKN2B exon 1 R2 GCGGCCCGGATAATCC C750 CDKN2B exon 1 P2 FAM-TCGTTAAGTTTACGGCCAAC-MGB C754 CDKN2B exon 2 F2 GCACTGGGTGAAAACTTTGCA C755 CDKN2B exon 2 R2 CCAGAGAGAGCAGAGTGGTCAGA C756 CDKN2B exon 2 P2 FAM-TAGGTGTTTCTTTAAATGGC-MGB C757 CDKN2A exon 1 beta F1 CCGCTTCCTAGAAGACCAGGTA C758 CDKN2A exon 1 beta R1 AACAAAACAAGTGCCGAATGC C759 CDKN2A exon 1 beta P1 FAM-AAAGGCCCTCGAAAAG-MGB C763 CDKN2A exon 1 alpha F1 CCAACGCACCGAATAGTTACG C764 CDKN2A exon 1 alpha R1 TTCCAATTCCCCTGCAAACTT C765 CDKN2A exon 1 alpha P1 FAM-CCGATCCAGGTGGGTAG-MGB C769 CDKN2A exon 2 F1 AAGAATGGATAGAGAACTCAAGAAGGA C770 CDKN2A exon 2 R1 CCCAGGTGTCTAATTACCCCTACA C771 CDKN2A exon 2 P1 FAM-ATTGGAAACTGGAAGCAA-MGB C772 CDKN2A exon 2 F2 ATTGGAAACTGGAAGCAA C773 CDKN2A exon 2 R2 GCTCTCAGGGTACAAATTCTCAGAT C774 CDKN2A exon 2 P2 FAM-CTCAGGTGAGGACTGAT-MGB C933 IKZF1 promoter F GATTTCCGCCAGGCTCAAG C934 IKZF1 promoter R CAATCAGCACACGGGACAAG C935 IKZF1 promoter P FAM-TTGGCCTCTTGGTTTC-MGB C1035 C20orf94 exon 2 F TCAGCCCATCTTTTTCCTGTATAAT C1036 C20orf94 exon 2 R TGCCATGGCTTATTGATTCCA C1037 C20orf94 exon 2 P FAM-TTTCTTAAAGGTCTGTAGTTACT-MGB C1038 MKKS exon 2 F CATGCAGTGCCGTCTGACA C1039 MKKS exon 2 R GATGTGAACGTCTGATTCTGATGAT C1040 MKKS exon 2 P FAM-TGAGCTAAGAAAAAAC-MGB C1054 IKZF3 (Aiolos) exon 1 F CCGCCCTTTGGAAAGTGATA C1055 IKZF3 (Aiolos) exon 1 R CCCCCATGTCTGACAACTCTTTA C1056 IKZF3 (Aiolos) exon 1 P FAM-CTTCTTCGCAATTTT-MGB C1057 ADD3 intron 1 F TGTGACTCCAAGGCTCTGAAAA C1058 ADD3 intron 1 R GCAGACTTCAGTGAGAGCAAACTG C1059 ADD3 intron 1 P FAM-TGTGTGGCAATATTAATGT-MGB C1060 IKZF2 (Helios) 5’ F GGGCCCCTCGACACTTG C1061 IKZF2 (Helios) 5’ R AGGGTGTTCCTCTTCCACTATCC C1062 IKZF2 (Helios) 5’ P FAM-CGAAAAAGAGTTTAAGAAAC-MGB 11 Supplementary Table 3. Primers used for backtracking of deletions identified at relapse on SNP array analysis. *Case Other-SNP-#28. **Case Other-SNP-#29. ***Case Other-SNP-#30 Primer Description Sequence (5' → 3') C1002 ADD3 F ggggagtgagaggttcctgcgctta C1008 ADD3 R cgcgcccggctaaatgacagttttt C874 C20orf94 F gataattcacccggcatttccccatc C872 C20orf94 R atgcccccgaggcctctctacaaact C966 IKZF2 (Helios) F tggaaaggccactggtcaatgttgtt C972 IKZF2 (Helios) R ctgtccattgggtgtgcttgaggtg C952 IKZF3 (Aiolos) F ggggtttcacaggtgtggaattgga C955 IKZF3 (Aiolos) R aggttgaggcggcaagtaagccttg C1083 ETV6 F* gcacctggccctgctatgactttca C1088 ETV6 R* tcaaggcatccagaagtgaaccagga C1138 ETV6 F** catggtctggacatggctgaggaaa C1140 ETV6 R** tccccacgcattctctctccatcat C1074 ETV6 F*** cccaccgttttgatgggcttatggt C1078 ETV6 R*** gaccagccctggcattctggttgta 12

See more

The list of books you might like