loading

Logout succeed

Logout succeed. See you again!

ebook img

Evolutionary transition in symbiotic syndromes enabled diversification of phytophagous insects on PDF

pages18 Pages
release year2015
file size3.33 MB
languageEnglish

Preview Evolutionary transition in symbiotic syndromes enabled diversification of phytophagous insects on

TheISMEJournal(2015)9,2587–2604 ©2015InternationalSocietyforMicrobialEcology Allrightsreserved 1751-7362/15 www.nature.com/ismej ORIGINAL ARTICLE Evolutionary transition in symbiotic syndromes enabled diversification of phytophagous insects on an imbalanced diet Sailendharan Sudakaran1, Franziska Retz1, Yoshitomo Kikuchi2, Christian Kost3,4 and Martin Kaltenpoth1,5 1InsectSymbiosisResearchGroup,MaxPlanckInstituteforChemicalEcology,Jena,Germany;2Bioproduction Research Institute, National Institute of Advanced Industrial Science and Technology (AIST) Hokkaido, Sapporo, Japan; 3Experimental Ecology and Evolution Research Group, Max Planck Institute for Chemical Ecology, Jena, Germany and 4Institute of Microbiology, Friedrich Schiller University, Jena, Germany Evolutionary adaptations for the exploitation of nutritionally challenging or toxic host plants represent a major force driving the diversification of phytophagous insects. Although symbiotic bacteria are known to have essential nutritional roles for insects, examples of radiations into novel ecological niches following the acquisition of specific symbionts remain scarce. Here we characterized the microbiota across bugs of the family Pyrrhocoridae and investigated whether the acquisition of vitamin-supplementing symbionts enabled the hosts to diversify into the nutritionally imbalanced and chemically well-defended seeds of Malvales plants as a food source. Our results indicate that vitamin-provisioning Actinobacteria (Coriobacterium and Gordonibacter), as well as Firmicutes (Clostridium) and Proteobacteria (Klebsiella) are widespread across Pyrrhocoridae, but absent from the sister family Largidae and other outgroup taxa. Despite the consistent association with a specific microbiota, the Pyrrhocoridae phylogeny is neither congruent with a dendrogram based on the hosts’ microbial community profiles nor phylogenies of individual symbiont strains, indicating frequent horizontal exchange of symbiotic partners. Phylogenetic dating analyses based on the fossil record reveal an origin of the Pyrrhocoridae core microbiota in the late Cretaceous (81.2–86.5 million years ago), following the transition from crypt-associated beta-proteobacterial symbionts to an anaerobic community localized in the M3 region of the midgut. The change in symbiotic syndromes (that is, symbiont identity and localization) and the acquisition of the pyrrhocorid core microbiota followed the evolution of their preferred host plants (Malvales), suggesting that the symbionts facilitated their hosts’ adaptation to this imbalanced nutritional resource andenabledthe subsequentdiversification inacompetition-poor ecological niche. TheISME Journal (2015) 9, 2587–2604; doi:10.1038/ismej.2015.75; published online29 May2015 Introduction race, with plants continuously evolving novel che- mical defenses or imbalanced nutritional composi- The evolutionary success of herbivorous insects and tiontoreduceherbivoreattacks,andinsectsadapting their diversification into a wide range of ecological by developing strategies to overcome defenses and niches is closely connected to the diversification of nutritional challenges. Thus, the diversification of their host plants (Ehrlich and Raven, 1964). Herbi- terrestrialplantsopenedupamultitudeofecological vores and plants engage in an evolutionary arms niches, permitting the adaptive radiation of herbi- vorous insects (Farrell and Mitter, 1994). This is probably best exemplified by the coevolution Correspondence: M Kaltenpoth, Department for Evolutionary between butterflies and their host plants, with the Ecology, Institute for Zoology, Johannes Gutenberg University diversification of several lepidopteran lineages fol- Mainz,Mainz,Germany. lowing their adaptation to a particular group of or C Kost, Experimental Ecology and EvolutionResearch Group, chemically well-defended plants (Ehrlich and MaxPlanckInstituteforChemicalEcology,Hans-Knoell-Strasse8, 07745Jena,Germany. Raven, 1964), for example, Pieridae butterflies on E-mail:[email protected]@gmail.com their Brassicales host plants (Wheat et al., 2007). 5Current address: Department for Evolutionary Ecology, Institute However, host plant selection and exploitation as for Zoology, Johannes Gutenberg University Mainz, Mainz, anutritionalresourcearenotonlydeterminedbythe Germany. metabolic capabilities of the insects themselves, but Received 24 November 2014; revised 25 March 2015; accepted 3April2015;publishedonline29May2015 also their associated microbiota (Douglas, 2009; Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2588 Hosokawa et al., 2007). Microbial symbionts can for the functionality of the symbioses, the evolu- confer important ecological traits to their hosts, tionary consequences of changes in pentatomomor- including contributions to digestion (Breznak and phan symbiotic syndromes remain enigmatic. Brune, 1994; Warnecke et al., 2007; Lundgren and Among pentatomomorphan bugs, the Pyrrhocor- Lehman, 2010), detoxification (Dowd 1989; Genta idaeappeartobeexceptionalwithregardtoboththe et al., 2006) and nutrient provisioning (Borkott and localization of the symbionts and the microbiota Insam, 1990; van Borm et al., 2002). Consequently, composition. Previous studies on Pyrrhocoris suchsymbioticinteractionscanhaveacrucialrolein apterus and Dysdercus fasciatus revealed that they the evolutionary diversification of herbivorous harbor a distinct and stable microbiota consisting of insects by facilitating expansion into novel ecologi- obligate and facultative anaerobes including Actino- cal niches (Moran, 2007; Janson et al., 2008). bacteria (Coriobacterium glomerans and Gordoni- Accordingly, expansion of the host plant range bactersp.),Firmicutes(Clostridiumsp.)andGamma- and/or an increased diversification have been Proteobacteria (Klebsiella sp.). These bacteria are observed in gall midges after the acquisition of localizedintheventricoseregion(M3)ofthemidgut fungal symbionts (Joy, 2013). Furthermore, the (HaasandKönig,1987;Sudakaranetal.,2012;Salem replacement of an ancestral beta-proteobacterial et al., 2013), which is the main region for the symbiont in sharpshooters (Cicadellidae) with digestion of the ingested food particles (Silva and Baumannia—a symbiont with a comparatively large Terra, 1994; Kodrík et al., 2012). Concordantly, the genome (686kb) encoding for pathways to produce midgut crypts of Pyrrhocoris apterus and Dysdercus vitamins and cofactors in addition to amino acids— fasciatus are reduced in size and do not contain likely facilitated the shift from phloem sap as the any symbiotic microbes (Glasgow, 1914; Sudakaran main nutrient source to the even more nutritionally et al., 2012). Similar crypt morphologies have been imbalanced xylem sap (Takiya et al., 2006). How- reported for other genera such as Antilochus and ever, despite the wealth of information that is Probergrothius, suggesting that the M3-associated available on the benefits microbes can provide to microbial community may be widespread among theirinsecthosts,theroleofsymbiontsindrivingthe Pyrrhocoridae (Glasgow, 1914; Rastogi, 1964; Bentz diversification of insects and their expansion into and Kallenborn, 1995; Singh and Singh, 2001; Goel novel ecological niches remains poorly understood and Chatterjee, 2003). In Pyrrhocoris apterus and (Janson et al., 2008). Dysdercusfasciatus,thegutmicrobiotawasfoundto Within the megadiverse insect order Hemiptera, be vital for growth and survival of the host (Salem the infraorder Pentatomomorpha contains over et al., 2013), through the supplementation of 12500 species (Schaefer, 1993; Schuh and Slater, B vitamins by the dual actinobacterial symbionts 1995;Henry,1997),manyofwhichharborbeneficial C. glomerans and Gordonibacter sp. (Salem et al., symbiontsthatcontributesignificantlytohostfitness 2014).AsthepredominantfoodsourceofPyrrhocor- (Muller, 1956; Huber-Schneider, 1957; Schorr, 1957; idae, that is, seeds of the plant order Malvales Abe et al., 1995; Fukatsu and Hosokawa, 2002; (Kristenová et al., 2011), is deficient in B vitamins, Kikuchi et al., 2009; Tada et al., 2011; Salem et al., this symbiont-mediated nutritional upgrading plays 2013). Interestingly, symbiotic syndromes (that is, an important role by allowing the hosts to exploit identity and localization of the symbionts) vary a nutritionally inadequate diet (Salem et al., 2013). greatly among Pentatomomorpha, indicating fre- In this study, we aimed at elucidating the quent transitions during the evolutionary history of ecological and evolutionary implications of a major this group. The most common symbiont-bearing transition in symbiotic syndromes. Specifically, we organsacrossthesuperfamiliesLygaeoidea,Coreoidea testedthehypothesisthattheevolutionarytransition and Pentatomoidea are specialized sacs or tubular to a characteristic midgut core microbiota enabled outgrowths, called crypts or gastric ceca, in the the diversification of pyrrhocorid bugs on the posterior region of the midgut that harbor beneficial nutritionally imbalanced diet of Malvales seeds. symbionts belonging to the gamma- or beta- To this end, we characterized the microbiota across proteobacteria (Glasgow, 1914; Miyamoto, 1961; 25 species of Pyrrhocoroidea (22 Pyrrhocoridae and Buchner, 1965; Fukatsu and Hosokawa, 2002; threeLargidaespecies)throughacombinationof454 Prado and Almeida, 2009; Hosokawa et al., 2010; pyrosequencing and quantitative PCR. In addition, Kikuchi et al., 2011a,b). However, several other we reconstructed a dated phylogeny of the hosts symbiotic syndromes occur across Pentatomomor- through calibration with the fossil record and pha, including paired or unpaired bacteriomes with compareditwithadistancedendrogramofmicrobial intracellular symbionts in some Lygaeoidea community profiles, as well as strain-level phyloge- (Kuechleretal.,2012;Matsuuraetal.,2012),aswell nies of the two vitamin-provisioning actinobacterial as more complex microbial communities in midgut symbionts. The results allow us to assess regions devoid of crypts (in Pyrrhocoroidea; the distribution of the characteristic M3 midgut Sudakaran et al., 2012). Thus, evolutionary transi- microbiota across bugs of the superfamily Pyrrho- tions in symbiotic syndromes must have occurred corideaandtoidentifytheevolutionaryoriginofthis repeatedly in Pentatomomorpha. Although such symbiotic syndrome. Subsequently, a comparison transitions are expected to have major implications withtheageofMalvalesplantsallowedustotestthe TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2589 hypothesis that the acquisition of a specific micro- 16mM (NH ) SO and 0.01% Tween 20), 2.5mM 4 2 4 biota preceded the bugs’ diversification on this MgCl ,240μMdNTPs,0.8μMofeachprimerand0.5 2 nutrient-deficient food source. Furthermore, host– U of Taq DNA polymerase (VWR International symbiont co-cladogenetic analyses shed light on the GmbH,Darmstadt,Germany).Cycleparameterswere evolutionary stability and maintenance of the char- as follows: 3min at 94°C, followed by 35 cycles of acteristic core microbiota in Pyrrhocoridae. Taken 94°C for 40s, 55°C for 40s and 72°C for 40s, and together, the results provide novel insights into the a final extension step of 4min at 72°C. PCR evolutionary transitions and ecological relevance of products were then sequenced bidirectionally on an symbiotic microbial communities in the diverse ABI 3730xl capillary DNA sequencer (Applied insect order Hemiptera. Biosystems, Foster City, CA, USA). Protein-coding sequences (COI and COII) were curated and then aligned based on their amino-acid translation in Materials and methods Geneious Pro 5.4 (Biomatters, Auckland, New Zealand), whereas partial 18S rRNA sequences were Insect sample collection and DNA extraction alignedusingtheSINAaligner(Pruesseetal.,2012). For characterizing the microbial community and The individual alignments were concatenated and reconstructingsymbiontandhostphylogeniesacross usedforphylogeneticreconstructionwithmaximum the Pyrrhocoroidea superfamily and outgroup taxa, likelihood algorithms (ML) and Bayesian Inference live adult specimens of Pyrrhocoridae (22), Largidae (BI), respectively. An ML tree was computed with (3), Lygaeidae (2), Oxycarenidae (1) and Rhopalidae FastTree2.1usingtheGTRmodel,andlocalsupport (1) were collected from their respective habitats values were estimated with the Shimodaira–Hase- across four different continents (Supplementary gawa test based on 1000 resamplings without Table S1). Bugs were killed and preserved in 70% reoptimizing the branch lengths for the resampled ethanol until further analysis, and at least one alignments (Price et al., 2010). For BI (computed individual per species was kept in ethanol as a using MrBayes 3.1.2; Huelsenbeck and Ronquist, voucher specimen. Before DNA extraction, samples 2001), the data set was partitioned into the three were surface sterilized by rinsing with sterile Milli- genes, with six substitution types for the CO genes pore water, 1% sodium dodecyl sulfate, and then (GTR model), and one for the ribosomal gene (F81 again sterile Millipore water (Billerica, MA, USA). model). Owing to saturation in substitutions, third Up to six complete specimens per bug species (or codonpositionswere excluded from the analysis for fewer, if less than seven individual specimens were the two mitochondrial genes (COI and COII). The available), were homogenized under liquid nitrogen analysis was performed with four chains and a withsterilepestles.FortheJapanesebugspecimens, temperature of 0.2 for 10000000 generations, and however, only the already dissected midgut was we confirmed that the standard deviation of split available and used instead of whole individuals. frequencies was consistently below 0.01. Trees were DNA was extracted using the MasterPure DNA sampled every 1000 generations, and a ‘burn-in’ of Purification Kit (Epicentre Technologies, Madison, 1000 was used (=10%). We computed a 50% WI, USA) according to the manufacturer’s instruc- majorityruleconsensustreewithposteriorprobabil- tions. An additional lysozyme incubation step ities for every node. (30min at 37°C; 4μl of 100mgml–1 lysozyme, Sigma-Aldrich, St Louis, MO, USA) was included before proteinase K digestion to break up Gram- Dating of the host phylogeny positive bacterial cells (see Sudakaran et al., 2012). Divergence time estimations for the Pyrrhocoroidea Individual extracts were used for quantitative PCR superfamily were inferred using BEAST v1.8.0 (qPCR)analysis,aswellasforPCRandsequencingof (Drummond and Rambaut, 2007), by testing various host and symbiont genes for phylogenetic analysis. substitution models and parameter settings PooledDNAextractsfromeachspecieswereusedfor (see Supplementary Table S2 and S3) on a fixed 454 pyrosequencing of the associated bacterial input tree (the BI tree, see above). Two fossil communities. calibration points were used: (i) two Dysdercus fossils from Florissant beds in Colorado (37.0–33.1 million years ago (mya)) (Scudder, 1890), and (ii) Reconstruction of the host phylogeny a Pyrrhocoris tibialis fossil from Rott-am- The phylogenetic relationships among the Pyrrho- Siebengebirge in Germany (28.5–23.8mya) (Statz coridae, its sister family Largidae and outgroup taxa and Wagner, 1950). A hard upper boundary for the were reconstructed using PCR amplification and ageoftherootwassetto160mya,basedontotheage sequencing of two mitochondrial (cytochrome of the oldest Pentatomomorpha fossil, as well as the oxidase I and II) and one nuclear gene (18S estimated age of the Pentatomomorpha infraorder ribosomal RNA (rRNA)) for all host species using (~152.9mya, Upper Jurassic) (Li et al., 2012; Misof primers listed in Table 1. PCR was performed in a et al., 2014). Evaluation and comparison of model total reaction volume of 12.5μl, containing 1μl of parameters were performed using Tracer v1.5 template DNA, 1×PCR buffer (20mM Tris-HCl, (Drummond and Rambaut, 2007). The maximum TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2590 11 00 edmicrobiota Reference Lietal.,2005Lietal.,2005Lietal.,2005Lietal.,2005Lietal.,2005Lietal.,2005Lietal.,2005Lietal.,2005Simonetal.,1994Simonetal.,1994Kaltenpothetal.,2009Weisburgetal.,1991utin-Ganacheetal.,20utin-Ganacheetal.,20Sudakaranetal.,2012Sudakaranetal.,2012Sudakaranetal.,2012Sudakaranetal.,2012ThisstudyThisstudyThisstudyKaltenpothetal.,2009Ishaketal.,2011Ishaketal.,2011 ciat BoBo o ss e a Us 111111111122223333333344 r ei dth gth 433235008001890000098998 n n 222222221222112222211111 a e a L e d oi v. rrhocor Fwd./re Fwd.Fwd.Rev.Rev.Fwd.Rev.Fwd.Rev.Rev.Fwd.Fwd.Rev.Fwd.Rev.Fwd.Rev.Fwd.Rev.Rev.Fwd.Fwd.Rev.Fwd.Rev. encing. y u P q (PCR,cloning/sequencing,454pyrosequencing)andquantification(qPCR)of ′–4′TargetgenePrimernamePrimersequence(53) 18SrRNAPyr18S_2FGGGAGGTAGTGACAAAAAATAACG18SrRNAPyr18S_4FATCCTTTAACGAGGATCTATTGG18SrRNAPyr18S_3RACATACTTGGCAAATGCTTTCGC18SrRNAPyr18S_4RGTTAGAACTAGGGCGGTATCTGCOIC1-J-2183-FCAACATTTATTTTGATTTTTTGGCOITL2-N-3014-RTCCAATGCACTAATCTGCCATATTACOIC1-J-2530-FGGAGTAATTCTAGCCAACTCCOIC1-N-2609-RGAATACTGCTCCTATGGATACOIITK-N3796_revACTATTAGATGGTTTAAGAGCOIITL-J3033_fwdTCTAATATGGCAGATTAGTGCA16SrRNACor-2FGGTAGCCGGGTTGAGAGACC16SrRNArP2ACGGCTACCTTGTTACGACTT16SrRNAM13FTGTAAAACGACGGCCAGT16SrRNAM13RGGAAACAGCTATGACCATG16SrRNAClostridium_1050-fwdCTCGTGTCGTGAGATGTTGG16SrRNAClostridium_1248-revGCTCCTTTGCTTCCCTTTGT16SrRNAKlebsiella_250-fwdCAGCCACACTGGAACTGAGA16SrRNAKlebsiella_453-revGTTAGCCGGTGCTTCTTCTG16SrRNAD.fas_Egg.2R_qPCCCGTATCTCAGTCCCAATGT16SrRNAAct-2FGCGAACGGGTGAGTAACAC16SrRNAGray519FCAGCMGCCGCNGTAANAC16SrRNACor-1RACCCTCCCMTACCGGACCC16SrRNAGray28FGAGTTTGATCNTGGCTCA16SrRNAGray519RGTNTTACNGCGGCKGCTG PCR;Rev.,reverse;rRNA,ribosomalRNA.es,(2)cloning/sequencingofCoriobacteriaceaesymbionts,(3)qPCRand(4)454se acterization onibacter quantitativegofhostgen echar /Gord qPCR,uencin Table1Primersusedforth TargetTargettaxon HostsHeteropteraHeteropteraHeteropteraHeteropteraHeteropteraHeteropteraHeteropteraHeteropteraHeteropteraHeteropteraSymbiontsCoriobacteriumEubacteriaEubacteriaEubacteriaClostridiumClostridiumKlebsiellaKlebsiellaGordonibacterGordonibacterCoriobacteriumCoriobacteriumEubacteriaEubacteria Abbreviations:Fwd.,forward;Use:(1)amplificationandseq TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2591 clade credibility (consensus) tree was inferred with Quantification of core microbes TreeAnnotator using a burn-in of 5,000 and qPCRswereperformedforthefourdominantbacterial a posterior probability limit of 0.5 (Drummond and symbionts in Pyrrhocoridae (Coriobacterium glomer- Rambaut, 2007). The consensus tree was visualized ans,Gordonibactersp.,Clostridiumsp.andKlebsiella with FigTree v1.3.1 (http://tree.bio.ed.ac.uk/soft sp.), using specific 16S rRNA primers (Table 1) on a ware/figtree/), including highest posterior density RotorgeneQcycler(Qiagen,Hilden,Germany)infinal (HPD) intervals. reaction volumes of 25μl, containing 1μl of template DNA (usually a 1:10 dilution of the original DNA Characterization of microbial community profiles extract), 2.5μl of each primer (10μm) and 12.5μl of Bacterial tag-encoded FLX amplicon pyroseqencing SYBR Green Mix (Rotor-Gene SYBR Green kit, (bTEFAP) was performed to characterize the micro- Qiagen). Standard curves were established using bial community composition of members belonging 10−8–10−2 ng of specific PCR product as templates to Pyrrhocoridae, Largidae and outgroup taxa. DNA for the qPCR. A NanoDrop 1000 spectrophotometer was sent to external service providers (Research & (Peqlab Biotechnology Limited, Erlangen, Germany) TestingLaboratories,Lubbock,TX,USA,orMRDNA was used to measure DNA concentrations for the Lab, Shallowater, TX, USA), and amplification was templatesofthestandardcurve.PCR conditionswere achieved using the 16S rRNA primers Gray28F and as follows: 95°C for 5min, followed by 35 cycles of Gray519R (Table 1) (Ishak et al., 2011, Sun et al., 60°C for 30s, 72°C for 20s and 95°C for 15s; then a 2011). Sequencing libraries were generated through melting curve analysis was performed by increasing one-step PCR with 30 cycles, using a mixture of Hot the temperature from 60°C to 95°C within 20min. Start and HotStar high-fidelity Taq polymerases The efficiencies of all four quantitative PCR assays (Qiagen, Valencia, CA, USA). Sequencing extended were confirmed to be 499%. Based on the standard from Gray28F, using a Roche 454 FLX instrument curves, the 16S copy numbers of the four dominant (Branford, CT, USA) with Titanium reagents and symbiontscouldbecalculatedforeachindividualbug procedures. All low-quality reads (quality cut-off from the qPCR threshold values (Ct) by the absolute =25) and sequences o200bp were removed follow- quantification method (Lee et al., 2006, 2008), taking ing sequencing, which left between 1990 and 30361 the dilution factor and the absolute volume of DNA sequences per sample for subsequent analysis. extract into account. The absolute 16S copy numbers Processing of the high-quality reads was performed were log transformed and then used to visualize the using QIIME (Caporaso et al., 2010b). Sequences were quantitative differences of the bacterial symbionts clustered into operational taxonomic units (OTUs) across different host genera using box plots. using multiple OTU picking in combination with chimera checking using usearch (Edgar, 2010) fol- lowed by cdhit (Fu et al., 2012) with 97% similarity Symbiont (Coriobacteriaceae) strain-level phylogenies cut-offs. For each OTU, one representative sequence In order to reconstruct strain-level phylogenies for was extracted (the most abundant) and aligned to the the two actinobacterial symbionts Coriobacterium Greengenes core set (available from http://greengenes. and Gordonibacter, we followed two different stra- lbl.gov/)usingPyNast(Caporasoetal.,2010a),withthe tegies, based on (i) the bTEFAP sequencing data minimum sequence identity set to 75%. Taxonomy alone, and (ii) a combination of bTEFAP sequences was assigned using the Ribosomal Database Project and Sanger sequencing of cloned 16S rRNA ampli- (RDP) classifier (Wang et al., 2007), with a minimum cons. For the first approach, OTUs were picked confidence to record an assignment set to 0.80. individually for each host species, using the para- AnOTUtablewasgenerateddescribingtheabundance meters as described above. This was necessary to of bacterial phylotypes within each sample conserve differences among symbiont strains that (Supplementary Table S4). The table was then manu- were below 3% sequence divergence, which would ally curated by removing low-abundance OTUs be lost in the combined OTU picking strategy used (o0.1%ineachofthesamples)andthroughBLASTn for assessing the general microbial community of the representative sequences (see Supplementary composition in Pyrrhocoridae. For each OTU, the Data S1) against the NCBI and RDP databases. To longest representative sequence was extracted, and visualize the results, OTUs with the same genus-level sequences affiliated with the family Coriobacteria- assignments were combined based on the BLASTn ceaewereextractedafterRDPandBLASTclassifica- results. The genus-level table was used to construct tion (see Supplementary Data S2). The resulting heatmapsusingtheRpackage‘gplots(heatmap.2)’.For representative sequences were aligned to reference beta-diversityanalysisandUPGMAclustering,theraw sequences of all Coriobacteriaceae type strains OTU table was subsampled to the depth of 1500 obtained from the RDP (Cole et al., 2014) using the sequences per sample, and distance matrices were SINAaligner(Pruesseetal.,2012),andphylogenetic calculated using Bray–Curtis and Jaccard metrics. For relationships were computed using ML as described visualization, two-dimensional principal coordinate for the reconstruction of the host phylogeny. analysis plots and dendrograms based on UPGMA For the second approach, the bTEFAP data were clusteringwereconstructedbasedonthebetadiversity complemented byacloning/sequencingapproachin distance matrices. order to obtain longer and hence more informative TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2592 reads for phylogenetic analysis. For this purpose, with the resulting distribution of codiversification PCR amplifications of the 3′-region of the 16S events in the randomized data set. For Parafit rRNA of both Coriobacteriaceae symbionts (that is, analysis,ahostdistancematrixwascomputedusing Coriobacterium glomerans and Gordonibacter sp.) theRpackage‘Ape(cophenetic.phylo)’basedonthe were carried out with the primers Cor-2F and rP2 phylogenetic tree, and symbiont distance matrices using a Biometra thermocycler (Analytik Jena, Jena, were computed in BioEdit 7.0.5.3 (Hall, 1999) based Germany) in total reaction volumes of 12.5μl on the concatenated alignments. Permutation tests containing 1μl of template DNA, 1×PCR buffer (1000replicates)wererunasimplementedinParaFit (20mM Tris-HCl, 16mM (NH ) SO and 0.01% (Legendreetal.,2002).Inordertoassessthepossible 4 2 4 Tween 20), 2.5mM MgCl , 240μM dNTPs, 0.8μM obscuring effect of interspecific predation on co- 2 of each primer and 0.5U of Taq DNA polymerase phylogeneticpatterns,werepeatedtheanalysesafter (VWR International GmbH). Cycle parameters were omission of known carnivorous host taxa (Antilo- as follows: 3min at 94°C, followed by 35 cycles of chusspp.,Dindymuslanius)thatmayhaveacquired 94°C for 40s, 68°C for 40s and 72°C for 40s, and a the Coriobacteriaceae symbionts horizontally via final extension step of 4min at 72°C. PCR products feeding on heterospeficic pyrrhocorid bugs. were cloned into Escherichia coli using the Strata- Clone PCR Cloning Kit (Stratagene, Agilent Tech- Results nologies, Santa Clara, CA, USA) according to the manufacturer's instructions. Transformed E. coli Host phylogeny and divergence time estimates cells were grown on LB agar containing 10mgml–1 To elucidate the evolutionary origin of the Pyrrhocor- ampicillin and 2% 5-bromo-4-chloro-indolyl- idae–microbiotaassociation,thephylogeneticrelation- β-d-galactopyranoside (X-gal) (Sigma-Aldrich) for ships across bugs of the Pyrrhocoroidea superfamily blue/white screening. Colony PCR was performed were reconstructed. The combination of partial 18S on eight randomly selected transformants for each rRNA, COI and COII gene sequences resolved most of insect host with vector primers M13F and M13R thetaxonomicrelationshipswithinthePyrrhocoroidea (Table 1) using the above-mentioned reaction mix (Figure 1b and Supplementary Figure S1), and and cycling conditions, except that an annealing divergence time estimations based on two fossil temperature of 55°C was used. PCR products were calibration points and a hard lower boundary for the checked for the expected size on a 1.5% agarose gel root age yielded consistent age estimates for selected (130V, 30min) and purified using the peqGOLD nodesofinterestacrossarangeofdifferentsubstitution MicroSpin Cycle Pure Kit (Peqlab Biotechnologies models(GTR+I+G,HKY+G,HKY+I+G,TN93+G,TN93 GmbH, Erlangen, Germany) before sequencing with +I+G)andparametersettings(SupplementaryTableS2 M13 primers. Nearly full-length Coriobacterium and S3). Omitting the Pyrrhocoris tibialis fossil glomerans and Gordonibacter sp. 16S rRNA calibration point did not affect age estimates, whereas sequences from different Pyrrhocoridae were omitting either the Dysdercus fossil calibration or the obtained by combining the short sequences from root boundary resulted in significantly increased age OTUs picked for each individual species with estimates (Supplementary Table S3). Based on the bTEFAP and the sequences obtained by PCR/cloning tracer analysis of effective sample sizes and marginal for the respective OTUs. In cases with multiple likelihood values, the TN93+I+G model with two Coriobacterium (for Scanthius aegypticus, Scanthius codon partitions for the protein-coding genes (1+2, obscurus, Pyrrhocoris apterus, Pyrrhocoris sibiricus and 3), estimated base frequencies, and a relaxed and Dysdercus fasciatus) or Gordonibacter OTUs uncorrelated lognormal clock model yielded the most (for Scanthius aegypticus and Dysdercus fasciatus) robust results. perhostspecies,themostabundantOTUwaschosen, The phylogenetic analyses revealed an estimated and the identity of bTEFAP and cloned sequences age of 135.7mya for the superfamily Pyrrhocoroidea wasconfirmedintheoverlappingregiontoreducethe (95% HPD interval: 104.4–159.9mya, Figure 1b). risk of chimera formation. Sequence alignment and The families Pyrrhocoridae and Largidae formed phylogenetic tree reconstruction using ML and BI monophyletic sister taxa that split about 125.4mya were done as described above. (95% HPD interval: 92.9–154.6mya; Figure 1b). Within the Pyrrhocoridae family, the genus Prober- Cophylogenetic analysis of host and symbiont grothius diverged from the common ancestor of all To test for codiversification between hosts and their other taxa about 86.5mya (95% HPD interval: 63.1– Coriobacteriaceae symbionts, the phylogenies of the 109.3mya). Around 81.2mya (95% HPD interval: two Coriobacteriaceae symbionts (based on the 58.4–102.2mya), the clade Dindymus+Antilochus bTEFAP data alone or the combination with clon- split from the group comprising Dysdercus, Derma- ing/sequencing data) were compared with the host tinus, Scanthius, Pyrrhocoris, the unknown pyrrho- phylogeny using Treemap 3 (Page RDM, 1995) and corid taxon, and Cenaeus. Parafit (Legendre et al., 2002). In Treemap, the positions of taxa were randomized on the host and Microbial community composition of pyrrhocorid bugs symbiont trees (1000 replicates), and the number of The microbiota of several species of Pyrrhocoridae observed codiversification events was compared (n=22)andLargidae(n=3),aswellasoutgrouptaxa TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2593 Figure1 Dated host phylogeny andmicrobiota profile of 22 species within the family Pyrrhocoridae as well as outgroups(Largidae, Lygaeidae, Oxycarenidae and Rhopalidae). (a) Photographs of selected Pyrrhocoridae host species: adult and fifth instar nymph of Pyrrhocoris apterus, adult Dysdercus cingulatus, adult and nymphs of Dysdercus fasciatus, and a mating pair of Probergrothius sanguinolens (from left to right). (b) Phylogenetic relationships of the hosts (Pyrrhocoridae n=22, Largidae n=3, Lygaeidae n=2, Oxycarenidaen=1, Rhopalidaen=1species),reconstructedusingpartial18SrRNA,cytochromeoxidaseIandcytochromeoxidaseII genesequences.DivergencetimeestimateswerederivedusingBEASTanalyses(TN93+I+Gmodel).Selectednodeagesareshowninmya with95%HPDintervalbars.Dashedbranchesrepresentpyrrhocoridtaxawithoutthecharacteristiccoremicrobiota.Thegreencolored barindicatestheestimatedoriginofthehostplantorderMalvales(72–96mya)(Wangetal.,2009).(c)2DPrincipalCoordinateAnalysis (PCoA)showingtheclusteringofhostspeciesbasedontheirmicrobialcommunityprofilesusingBray–Curtis(left)andJaccard(right) distancematrices,respectively.Colorsforindividualsamplescorrespondtothecoloringoftaxainb.(d)Relativeabundanceofmicrobial taxa as obtained from 454 pyrosequencing of 16S rRNA amplicons (305,179 reads in total), represented as a heatmap based on log- transformedvalues.OTUswerecombinedonthegenuslevelforbettervisualization,andonlygenerathatamountto41%ofthemicrobial communityinatleastoneofthehostspeciesaredisplayed.Thedendrogramabovetheheatmaprepresentstheclusteringofmicrobialtaxa accordingtotheirdistributionandabundanceacrosshostspecies.Notethedistinctclusteringofthefourcoremicrobialtaxaassociated withPyrrhocoridae. TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2594 (n=4) were characterized using 454 amplicon Phylogenetic analysis of the Coriobacteriaceae pyrosequencing of bacterial 16S rRNA (bTEFAP), symbionts which yielded a total of 305179 sequences. After The Pyrrhocoridae core microbiota contains two removing singletons, chimeric sequences and OTUs actinobacterial symbionts that were previously below 0.1% abundance, the sequences were clus- shown to be essential for growth and survival in tered into 356 OTUs. Bray–Curtis and Jaccard P. apterus and D. fasciatus through the supplemen- clusteringofthehostspeciesbasedontheirbacterial tation of B vitamins (Salem et al., 2013, 2014). The community profiles revealed a well-defined cluster phylogeny of both Coriobacteriaceae symbionts was containing the genera Dysdercus, Scanthius, Pyrrho- reconstructed based on the set of short read coris, Dindymus, Antilochus and the unknown sequences from bTEFAP representing the Coriobac- Pyrrhocoridae species, asecond cluster with Prober- teriaceae symbiont OTUs from each pyrrhocorid grothius, Dermatinus and Cenaeus, and separate species (Figure 3). In addition, we amplified and clusters for members of the Largidae family and the sequenced the symbionts’ 3’-region of the 16S rRNA outgroup composed of other Pentatomomorphan gene sequences from 13 different host species, as bugs (Oxycarenus hyalinipennis, Leptocoris augur, well as only Coriobacterium glomerans from Lygaeus equestris and Spilostethus hospes), respec- Dysdercus decussatus, and only Gordonibacter sp. tively (Figure 1c). UPGMA dendrograms of the from two Probergrothius species (that is, P. nigricor- bacterial communities associated with the host nis and P. sanguinolens). Subsequently these species computed using the beta diversity matrices sequences were combined with the bTEFAP repre- (Bray–Curtisand Jaccard) yielded qualitatively simi- sentative sequences to enhance the resolution of the lartopologieswiththemajorgroupingsbeinglargely phylogenetic tree (Supplementary Figure S3). The identical (Supplementary Figure S2). phylogenetic analyses revealed that the symbiotic Combining OTUs on the genus level revealed that Coriobacterium glomerans and Gordonibacter sp. themicrobiotaofPyrrhocoridaebugswasdominated strainsformtwodistinctmonophyleticcladeswithin by four core bacterial taxa: Coriobacterium glomer- thefamilyCoriobacteriacae,whichisconsistentwith ans, Gordonibacter sp. (Actinobacteria), Clostridium a single acquisition event for each symbiont and sp. (Firmicutes) and Klebsiella sp. (Proteobacteria) subsequenthost–symbiontcoevolution(Figure3and (Figure 1d). These taxa were consistently present Supplementary Figure S3). A possible exception are across Pyrrhocoridae in abundances ranging from the Gordonibacter symbionts of the basal pyrrho- 104 to 108 16S rRNA gene copies per individual corid genus Probergrothius, which group within the (Figure 2), with the exception of the genera Prober- monophyletic symbiont cluster in the combined grothius,DermatinusandCenaeus,whichlackedthe phylogeny (Supplementary Figure S3), yet fall out- Coriobacteriaceae symbionts (Figures 1d and 2). side when only the bTEFAP sequences are consid- Furthermore, although OTUs associated with the ered (Figure 3). Interestingly, several host species genera Clostridium and Klebsiella were present in contained two or more dominant OTUs for one or most species of thesethree hostgenera,qPCR assays both of the actinobacterial symbionts. Specifically, specific for the Pyrrhocoridae-associated Clostri- more than one Coriobacterium OTU was observed dium and Klebsiella OTUs were negative for all for Scanthius aegypticus, Scanthius obscurus, Pyr- samplesexcepttwooftheProbergrothiusspecimens, rhocoris apterus, Pyrrhocoris sibiricus and Dysder- indicating that the Clostridium and Klebsiella OTUs cus fasciatus, whereas two or more Gordonibacter associated with these three genera differ from those OTUs were detected for Scanthius aegypticus and of the other Pyrrhocoridae (Figure 2). Thus, the host Dysdercus fasciatus. For Pyrrhocoris apterus and genera Probergrothius, Dermatinus and Cenaeus Dysdercus fasciatus, the occurrence of two distinct lacked the microbiota that is characteristic for other Coriobacterium sequences, respectively, was pre- Pyrrhocoridae, which is also reflected in their viously confirmed using cloning and sequencing separate clustering in the principal coordinate (Kaltenpoth et al., 2009). Thus, the multiple analyses (Figure 1c). Coriobacterium and Gordonibacter OTUs observed The microbiota of members of the family Largidae here for several host species likely reflect true (the sister taxon to the Pyrrhocoridae) was dominated symbiont microdiversity rather than 454 sequencing by Burkholderia and completely lacked the artifacts. Although at present we cannot exclude the Pyrrhocoridae-associated core microbes (Figures 1d possibility that the multiple Coriobacteriaceae and2).Similarly,thecoremicrobiotawasabsentfrom sequencesfoundinindividualPyrrhocoridaespecies otherpentatomomorphanoutgroupspecies:themicro- represent divergent 16S rRNA copies within the biota of both Oxycarenus hyalinipennis (Oxycareni- same symbiont genome, the presence of multiple dae) and Leptocoris augur (Rhopalidae) was distinct strains seems much more likely given the dominated by Wolbachia sp. and Bartonella sp., highdegreeofsimilarityofthetwo16SrRNAcopies whereas the Lygaeidae species Lygaeus equestris and (99.72%) in the sequenced genome of C. glomerans Spilostethus hospes contained consortia of Trabul- isolated from P. apterus (Stackebrandt et al., 2013). siella sp. and Stenotrophomonas sp. (L. equestris), or In addition to the occurrence of multiple OTUs Wolbachia sp. and Rickettsia sp. (S. hospes), within individual host species, the incongruence of respectively. thephylogeniesofbothCoriobacteriaceaesymbionts TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2595 Figure 2 Evolutionary transitions in symbiotic syndromes in Pyrrhocoroidea, and abundance of core microbial taxa. (a) Schematic phylogenyofPyrrhocoridaeandLargidaegenera(adaptedfromFigure1b).Pyrrhocoridaetaxawithcoremicrobiotaaregiveninblack, thosetaxawithoutthecoremicrobiotaareindarkgray,andtheLargidaewithcrypt-associatedsymbiontsareinlightgray.Reconstructed evolutionarytransitionsinsymbioticsyndromesareindicatedonthephylogeny.Numbersofvalidlydescribedextantspeciesaregiven behindeachgenusname(fromHussey,1929).(b)Abundanceofthefourcoresymbionttaxa(Coriobacteriumglomerans,Gordonibacter sp., Clostridium sp. and Klebsiella sp.) across multiple specimens of the nine different genera of Pyrrhocoridae (Dysdercus (n=37), Dermatinus(n=2), Scanthius(n=5), Pyrrhocoris(n=7), unknownPyrrhocoridae (n=6), Cenaeus(n=5), Dindymus (n=6), Antilochus (n=7)andProbergrothius(n=23))andtwogeneraofLargidae(Physopelta(n=4)andLargidae(n=1)).Abundancewasassessedas16S rRNAgenecopynumbersusingqPCR,basedononetosixreplicateindividualsperhostspecies,whichwerethencombinedonthegenus level.Linesrepresentmedians,boxescomprisethe25–75percentilesandwhiskersdenotetherange. withthePyrrhocoridaehostphylogeny(Coriobacter- apparently played an important role during the ium glomerans: Parafit: P=0.974, TreeMap: evolutionofthissymbiosis.AstheCoriobacteriaceae P=0.345; Gordonibacter sp.: Parafit: P=0.978, Tree- symbionts are localized in the same region of the Map: P=0.449) (Supplementary Figure S3) suggest midgutandcanbeco-transmittedbothverticallyand horizontal exchange of symbionts between host horizontally (Kaltenpoth et al., 2009), we also tested species.Giventhesymbiontmicrodiversityobserved for co-cladogenesis of the two symbiont lineages. in the bTEFAP data, we paid special attention to Randomization of phylogenetic trees or distance avoid the generation of possible chimeric sequences matrices and subsequent statistical evaluation, how- when combining bTEFAP reads and sequences ever, yielded no evidence for co-cladogenesis obtained after cloning of PCR amplicons. Owing to betweenCoriobacteriumglomeransandGordonibac- the high similarity of different symbiont strains, ter sp. strains across host taxa (Parafit: P=0.898, however,thepossibilityofchimeraformationforthe TreeMap: P=0.251). symbionts of individual host taxa cannot be com- pletely ruled out, which may hinder accurate co- phylogenetic analyses. To exclude the possibility Discussion that co-phylogenetic patterns were additionally obscured by interspecific predation among pyrrho- In this study, we characterized the microbiota corid bugs resulting in transient Coriobacteriaceae associated with bugs of the hemipteran families being picked up in the bTEFAP sequences, we Pyrrhocoridae and Largidae, and investigated the repeated the analyses after excluding known pre- origin and evolutionary dynamics of the host– datory taxa (Antilochus spp., Dindymus lanius). microbiota association on both the community and Although some symbiont taxa clustered according strain level. The results provide insights into an to their host genera (particularly Pyrrhocoris and evolutionary transition from individual crypt- Scanthius for Gordonibacter, and Dysdercus for associated symbionts to a more complex microbiota Coriobacterium), the tests for co-cladogenesis that is localized in the insect’s midgut. This transi- remained nonsignificant. Thus, although the Pyr- tion coincided with the evolution of the hosts’ rhocoridae maintain a specific microbiota, horizon- preferred food plants and preceded the major tal transmission between co-occurring species radiation of pyrrhocorid bugs, highlighting the TheISMEJournal Symbiont-enabledradiationofphytophagousinsects SSudakaranetal 2596 possible importance of the microbial community in Malvales, with a few notable exceptions such as adapting to novel ecological niches. Probergrothius angolensis, which feeds on seeds of the ancient gymnosperm Welwitschia mirabilis (Wetschnig and Depisch, 1999). Despite being Nutritional contributions of the core microbiota phylogenetically distant, these host plants share associated with pyrrhocorid host similar phytochemical defenses, particularly cylco- Members of the Pyrrhocoridae are predominantly propenoic fatty acids (CPFAs) (Allen et al., 1967). phytophagous, feeding on seeds of the plant order These compounds are known to be toxic to insects Figure3 Cophylogeneticanalysisof(a)thedualactinobacterialsymbionts(CoriobacteriumglomeransandGordonibactersp.)and(b) their Pyrrhocoridae hosts. The symbiont phylogeny is based on partial 16S rRNA bTEFAP sequences from OTUs picked for each individualspecies(seeSupplementaryDataS2).ColorsforindividualsymbiontstrainscorrespondtothecoloringofhosttaxainFigure 1b.ForeachCoriobacteriaceaeOTU,therelativeabundance(inrelationtotherespectivehost’scompletemicrobialcommunity)isgivenin bracketsbehindthestraindesignation.Host–symbiontassociationsareshownbyconnectinglines.Valuesatthenodesrepresentlocal supportvaluesfromtheFastTreeanalysis(GTRmodel). TheISMEJournal

See more

The list of books you might like