Logout succeed
Logout succeed. See you again!

Four new species and a new genus of Antarctic sea cucumbers with taxonomic reviews of Cladodactyla, Pseudocnus, Paracucumidae and Parathyonidium (Echinodermata: Holothuroidea: Dendrochirotida) PDF
Preview Four new species and a new genus of Antarctic sea cucumbers with taxonomic reviews of Cladodactyla, Pseudocnus, Paracucumidae and Parathyonidium (Echinodermata: Holothuroidea: Dendrochirotida)
Memoirs of Museum Victoria 72: 31–61 (2014) Published December 2014 ISSN 1447-2546 (Print) 1447-2554 (On-line) http://museumvictoria.com.au/about/books-and-journals/journals/memoirs-of-museum-victoria/ Four new species and a new genus of Antarctic sea cucumbers with taxonomic reviews of Cladodactyla, Pseudocnus, Paracucumidae and Parathyonidium (Echinodermata: Holothuroidea: Dendrochirotida) P. Mark O’LOughLin1,* (http://zoobank.org/urn:lsid:zoobank.org:author:97B95F20-36CE-4A76-9D1B-26A59FBCCE88), MeLanie Mackenzie2 (http://zoobank.org/urn:lsid:zoobank.org:author:5E3E21B9-E3DC-4836-8731-D5FD10D00CBF), gustav PauLay3 (http://zoobank.org/urn:lsid:zoobank.org:author:A2F155E4-7958-4E63-B36A-CAB23F190A07) and didier vandensPiegeL3 (http://zoobank.org/urn:lsid:zoobank.org:author:CE8C3D01-28AD-43F7-9D4F-04802E68CB1A) 1 Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (pmoloughlin@ edmundrice.org) 2 Marine Biology Section, Museum Victoria, GPO Box 666, Melbourne, Victoria 3001, Australia (mmackenzie@museum. vic.gov.au) 3 Florida Museum of Natural History, University of Florida, Gainesville, FL 32611–7800, USA ([email protected]) 4 Biological Collection and Data Management Unit, Royal museum for central Africa, B–3080, Tervuren, Belgium ([email protected]) * To whom correspondence and reprint requests should be addressed. E-mail: [email protected] http://zoobank.org/urn:lsid:zoobank.org:pub:A7DD4099-9D59-44F5-81CB-4CD95CA1AFD5 Abstract O’Loughlin, P. M., Mackenzie M., Paulay, G. and VandenSpiegel, D. 2014. Four new species and a new genus of Antarctic sea cucumbers with taxonomic reviews of Cladodactyla, Pseudocnus, Paracucumidae and Parathyonidium (Echinodermata: Holothuroidea: Dendrochirotida). Memoirs of Museum Victoria 72: 31–61. Four new species of Antarctic sea cucumbers are described, three with author O’Loughlin: Crucella susannae, Euthyonidiella huwi, Laevocnus katrinae; and Laevocnus leachmani with authors Davey and O’Loughlin. Pseudocnus Panning is reviewed, and Antarctic species separated into new genus Laevocnus O’Loughlin. We raise the three sub- species of Pseudocnus dubiosus, viz. dubiosus (Semper), koellikeri (Semper) and leoninus (Semper), to species status. We refer Cucumaria croceoida Vaney to the synonymy of Cladodactyla crocea (Lesson). We synonymize Dendrelasia O’Loughlin with Cladodactyla Brandt, and re-describe the reassigned Cladodactyla sicinski (O’Loughlin). This species broods in a dorsal marsupium. The diagnoses of genus Parathyonidium Heding and species Parathyonidum incertum Heding are reviewed. The type specimens for Parathyonidium incertum are listed. Parathyonidium incertum Heding is the only known Antarctic holothuroid that is a coelomic brooder. The Paracucumidae Pawson and Fell is reviewed. Phylogenetic trees are given for species in the genera Cladodactyla, Heterocucumis, Staurocucumis, Laevocnus, Crucella and Paracucumis. Tables are provided for the species of Cladodactyla and Pseudocnus. Keys are included for the species of genus Laevocnus and family Paracucumidae. Keywords B ransfield Strait; South Shetland Islands; Shag Rock; South Georgia; Cladolabidae; Cucumariidae; Paracucumidae; Cladodactyla; Crucella; Dendrelasia; Euthyonidiella; Laevocnus; Paracucumis; Pseudocnus; coelomic brood protection; new genus; new species; synonym. Introduction sequence data are providing insight into additional cryptic species and synonymies, as evidenced in O’Loughlin et al. O’Loughlin et al. (2010) provided a comprehensive overview (2010). Recent Antarctic expeditions have continued to collect of the especially diverse Antarctic sea cucumber species with specimens of unknown species of sea cucumbers. a list of 187 (including 51 until then not described). Three The BAS BIOPEARL I expedition in 2006, under the subsequent papers by O’Loughlin and VandenSpiegel (2010) on apodids, O’Loughlin and Whitfield (2010) on psolids, and leadership of Katrin Linse on the RRS James Clark Ross (JR O’Loughlin et al. (2013) on new species from Admiralty Bay 144) to the Scotia Sea, sampled the shelf (200 and 500 m) and in the South Shetland Islands have furthered our knowledge of slope (1000 and 1500 m) of the Falkland Trough, Livingstone Antarctic sea cucumbers. This fauna is predominantly Island, Deception Island, Elephant Island, the South Orkney endemic to south of the Antarctic Convergence. mtDNA Islands, Southern Thule, South Georgia and Shag Rock. The 32 P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel Linse et al. 2008 BIOPEARL II expedition (JR 179) sampled We have reviewed the five relevant genera while describing from 500 to 2500 m in the southern Bellingshausen and new species of Cladodactyla, Crucella Gutt, 1990, Amundsen Seas. The many sea cucumber specimens were sent Euthyonidiella Heding and Panning, 1954 and Pseudocnus, on loan to Museum Victoria and were identified by Mark and report brood-protecting by Parathyonidium incertum. O’Loughlin, Melanie Mackenzie and Emily Whitfield. Two This systematic paper is based primarily on morphological new Antarctic holothuroid species from these collections are observations, and shows generally good congruence and described in this work. support from emerging genetic data. However, there are some An IPY–CAML expedition was conducted by NIWA from conflicts between morphological indicators for generic referral 29 January to 22 March 2008 on RV Tangaroa with and genetic data. We anticipate further genetic data and future expeditioner Niki Davey able to focus on sea cucumbers as comprehensive reviews of the relevant generic assignments, part of her role. This voyage sampled in the Ross Sea and and await additional insight into morphology and genetic associated seamounts and abyssal plains. One of the new congruence before further generic re-assignments. Pseudocnus Panning, 1949 species in this work (with authors Davey and O’Loughlin) was collected during this voyage and Methods is included here because of our extensive review of genus Scanning electron microscope (SEM) images were taken by Pseudocnus. A paper on other new sea cucumber species from Didier VandenSpiegel after clearing the ossicles of associated this expedition and a comprehensive overview of Ross Sea soft tissue in commercial bleach, air-drying, mounting on holothuroids is in preparation (Davey et al.). A sea cucumber aluminium stubs, and coating with gold. Observations were specimen was passed on to us from CEAMARC RSV Aurora made using a JEOL JSM-6480LV SEM. Measurements were Australis Voyage 3 off Adelie and George V Lands in 2007 / made with Smile view software. Tissues were sent to Gustav 2008. This single specimen is assigned to the same new Paulay (UF) for sequencing and the specimen locations, tissue Pseudocnus species found in the Ross Sea. codes, catalogue numbers and GenBank Accession numbers are In March and April 2012 Susanne Lockhart (NOAA’s US recorded in Appendix 1. A 655 bp portion of the mitochondrial AMLR Program) participated in Expedition ANT–XXVIII/4 on gene cytochrome oxidase subunit 1 (COI) was sequenced from RV Polarstern in the region of the Antarctic South Shetland selected specimens using the echinoderm barcoding primers Islands at shelf depths of about 50–500 m in support of the CCAMLR initiatives to detect Vulnerable Marine Ecosystems. COIceF (5’-ACTGCCCACGCCCTAGTAATGATATTTTT- The quantitative demersal finfish stock assessment survey TATGGTNATGCC-3’) and COIceR (5’-TCGTGTGTC- provided Susanne with a rare opportunity for a quantitative TACGTCCATTCCTACTGTRAACATRTG-3’) (Hoareau and assessment of Antarctic invertebrate abundance, distribution and Boissin 2010), as described in Michonneau and Paulay 2014. biomass. Trawl net dimensions were measured in situ using a Note that these echinoderm specific primers amplify positions ScanMar net monitoring sonar system. A comprehensive 242 to 898 in COI compared with positions 74 to 733 amplified invertebrate analysis from 64 successful trawls yielded 4,120 by Folmer primers. Sequences have been submitted to holothuroid specimens of which 217 lots with many hundreds of GenBank (See appendix). COI sequences were aligned by eye holothuroids were preserved and donated to Museum Victoria and analyzed using Maximum Likelihood with 100 bootstrap for determination. Up to 1425 sea cucumber specimens were replicates, implemented in MEGA (Tamura et al. 2013). taken per station indicating a density of up to 87,119 holothuroid Photos of most specimens were taken in Museum Victoria specimens per square nautical mile. The subsequent identification by Melanie Mackenzie, in collaboration with Mark of all specimens in Museum Victoria by Mark O’Loughlin, O’Loughlin, using a Nikon D300S digital camera with 60 mm Melanie Mackenzie and Emily Whitfield revealed new species Nikkor macro lens for large specimens, and a Leica DC500 of which one is described here. Further papers will describe high resolution digital camera system with Auto Montage other new species and quantitative outcomes from this survey. software for small specimens. The photo of Laevocnus In O’Loughlin et al. (2013) new genus and species leachmani Davey and O’Loughlin sp. nov. was taken by Peter Dendrelasia sicinski O’Loughlin were described for a single Marriot (NIWA) using a Nikon DX camera with a 60 mm specimen from Admiralty Bay in the South Shetland Islands. macro lens. The photo of a live in situ brood-protecting Amongst the many sea cucumbers collected by Susanne specimen of Cladodactyla crocea (Lesson, 1830) in the Lockhart around the South Shetland Islands (see above) there Falkland Islands was provided by Paul Brickle (SMSG). are many larger specimens that are conspecific with the Photos of live specimens of Cladodactyla sicinski (O’Loughlin, smaller type specimen of Dendrelasia sicinski and that are 2013) and Crucella susannae O’Loughlin sp. nov. were taken also morphologically referable to Cladodactyla Brandt, 1835. on the RV Polarstern and provided by Susanne Lockhart We clarify these systematic issues. (NOAA’s US AMLR). The photo of a live in situ specimen of O’Loughlin (1994) summarized knowledge on brood- Cladodactyla sicinski in Fildes Bay in the South Shetland protecting and fissiparous cucumariids, and O’Loughlin et al. Islands was taken by Dirk Schories (UACh). (2009a) described additional examples. Reference was made in the recent paper to a species of brood-protecting Abbreviations Parathyonidium Heding, 1954 (in Heding and Panning, 1954) AAD A ustralian Antarctic Division that is determined and discussed here as Parathyonidium incertum Heding, 1954 (in Heding and Panning, 1954). AMLR A ntarctic Marine Living Resources Four new species and a new genus of Antarctic sea cucumbers 33 ANARE A ustralian Antarctic Research Expedition Order Dendrochirotida Grube, 1840 BAS B ritish Antarctic Survey Remarks. Smirnov (2012) established suborder Cucumariina for dendrochirotid families with the calcareous ring lacking BENTART I ntegrated study of the benthonic biodiversity of segmented posterior prolongations. These included Bellingshausen Sea and Antarctic Peninsula Cucumariidae Ludwig, 1894, Paracucumidae Pawson and Fell, (Spain) 1965, and Thyonidiidae Heding and Panning, 1954 that was BIOPEARL B IOdiversity dynamics: Phylogeography, raised to family status by Smirnov (2012). No suborder was Evolution And Radiation of Life nominated for dendrochirotid families excluded from Cucumariina. These include Cladolabinae Heding and CCAMLR C ommission for the Conservation of Antarctic Panning, 1954 that was also raised to family status in Smirnov Marine Living Resources (2012). We do not nominate suborders of Dendrochirotida in this work. CEAMARC C ollaborative East Antarctic Marine Census ICZN T he International Commission on Zoological Family Cladolabidae Heding and Panning, 1954 sensu Nomenclature, or the International Code of Smirnov 2012 Zoological Nomenclature, as appropriate. Diagnosis (after Smirnov 2012). Tentacles 15–20 arranged in 2 IPY–CAML I nternational Polar Year–Census of Antarctic or 3 circles (10+5, 10+10, 10+5+5); tube feet arranged along Marine Life radii or scattered over entire body; calcareous ring segments usually entire, high, not subdivided into pieces; radial plates MNCN M useo Nacional de Ciencias Naturales (Spain) with forked prolongations, medium length or short, usually MNHN M uséum national d’Histoire naturelle (Paris) entire or sometimes subdivided into a few very short pieces; sometimes short forked prolongations on inter-radial segments; MOLAF P refix code for tissues taken from specimens at ossicles tables with 2 pillars, disc with few perforations and NMV sometimes reduced making tables rod-like, convex cross-like MOLG P refix code for tissues taken from NIWA spined plates, and rosettes. specimens in the University of Genoa Remarks. Smirnov (2012) raised the subfamily Cladolabinae MOLN P refix code for tissues taken from NIWA Heding and Panning, 1954 to family status, and offered his specimens opinion that “quite possibly the family is polyphyletic”. MOLSI P refix code for tissues taken from Smithsonian Euthyonidiella Heding and Panning, 1954 Institution specimens Diagnosis (after Heding and Panning 1954). Tentacles 15–20; NDMQ P refix code for tissues taken by Niki Davey from tube feet in radial or scattered arrangement; calcareous ring Macquarie Island specimens radial plates with paired long undivided posterior prolongations; ossicles tables with 2 pillars. NHMUK B ritish Museum of Natural History (registration number prefix NHMUK) Type species. Euthyonidiella kyushuensis Heding and Panning, 1954 (type locality southern Japan) (by original designation) NIWA N ew Zealand National Institute of Water and Atmospheric Research Ltd. (est. 1992) Assigned species and type localities. Euthyonidiella ambigua (Heding, 1942) (Tanzania); E. dentata Cherbonnier, 1961 NMV M useum Victoria (registration number prefix F) (Brazil); E. destichada (Deichmann, 1930) (Caribbean Sea); E. NOAA U nited States National Oceanic and Atmospheric dubia Cherbonnier, 1958 (Sierra Leone); E. huwi O’Loughlin Administration sp. nov. (below; Shag Rock); E. kyushuensis Heding and Panning, 1954 (Kyushu); E. trita (Sluiter, 1910) (Caribbean SMSG S hallow Marine Survey Group (Falkland Islands) Sea); E. tungshanensis (Yang, 1937) (Fujian Sea); E. zacae UACh U niversidad Austral de Chile (Deichmann, 1938) (Galapagos). UF F lorida Museum of Natural History, University Remarks. The species assigned to Euthyonidiella are quite of Florida similar morphologically with the exception of Phyllophorus tungshanensis Yang, 1937 (assigned to Euthyonidiella by Liao USNM U nited States National Museum of Natural and Clark 1995), and Euthyonidiella dubia Cherbonnier, 1958. History, Smithsonian Institution We question these two assignments. A specimen from NW Australia collected at 184–187 m depth (NMV F149748; UF ZMUC N atural History Museum of Denmark (Zoology); tissue sequence code MOL AF 408) morphologically closely Zoological Museum, University of Copenhagen resembles both Euthyonidiella kyushuensis from south Japan Numbers in brackets after registrations refer to numbers of and Euthyonidiella ambigua from east Africa. This specimen specimens in lots. is provisionally determined as Euthyonidiella kyushuensis. 34 P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel Euthyonidiella huwi O’Loughlin sp. nov. CATTATAGAGGAAAGCAAGAACCCTTCGGATATT- TAGGTATGGTCTATGCAATGGTAGCCATAGGTATTT- Zoobank LSID. http://zoobank.org:act:8DD8AA4E-E46C-4FDE- TAGGATTTTTAGTTTGAGCCCAC 8A14-F796CA2B0427 Distribution. Western Antarctica, Shag Rock, 54°S 41°W, 206 m. Figure 1 Etymology. Named for Huw Griffiths (British Antarctic Material examined. Holotype. Western Antarctica, Shag Rock, Survey), in appreciation of his role in the BAS BIOPEARL 53º38'S 40º54'W, 206 m, BAS BIOPEARL I stn SR–EBS–4, 11 Apr 2006, NMV F168650 (UF tissue sequence code MOL AF 816). expeditions, his contribution to collecting the specimens Paratypes. Type locality and date, NMV F189889 (3 small studied here, and with gratitude for his gracious collaboration juveniles); NHMUK 2010.137–138 (2). in Antarctic holothuroid research. Other material (not Euthyonidiella huwi). Euthyonidiella Remarks. Euthyonidiella huwi O’Loughlin sp. nov. is kyushuensis Heding and Panning, 1954. NW Australia, 17º29'S distinguished from the other species of Euthyonidiella by a 120º28'E, 184–187 m, RV Southern Surveyor, SS05/2007 stn 91, 20 Jun 2007, NMV F149748 (1) (UF tissue sequence code MOL AF 408). combination of: predominantly radial occurrence of tube feet; table discs that sometimes have more than eight perforations; Description. Body cylindrical, slightly pentagonal in transverse relatively short posterior prolongations on the radial plates of section, rounded anterior and posterior, up to 7 mm long the calcareous ring. The provisionally determined specimen of (tentacles deeply withdrawn), up to 2 mm diameter; thin Euthyonidiella kyushuensis from NW Australia and calcareous body wall with surface bristle of table spires; 20 Euthyonidiella huwi from Antarctica are sister taxa among 19 dendritic tentacles, 5 pairs large, 5 pairs very small, latter sequenced sclerodactylids sensu lato based on CO1 sequences, probably in slightly inner ring; tube feet in irregular single to although they are quite divergent from each other (K2P double radial series, some spread inter-radially; calcareous ring pairwise distance = 0.20). We observed that the calcareous ring high, not segmented; anterior end of radial plates with deep of a 2 mm long juvenile of Euthyonidiella huwi lacked posterior division at muscle attachment and with lateral notch, posterior prolongations. We recognize that the relatively short posterior prolongations short, forked, not segmented (ring of 2 mm long prolongations in the 7 mm long holotype may represent paratype specimen lacking posterior prolongations); inter- ontogenetic change, as may the sometimes more numerous radial plates with anterior taper, blunt posterior, lacking perforations in the table discs and predominantly ambulacral posterior prolongations; short stone canal with bean-shaped occurrence of the tube feet. We acknowledge the unsatisfactory madreporite free in coelom; single tubular polian vesicle. element in describing a new species from a few small specimens Body wall with abundant irregular tables: discs round to that may represent developmental stages, but we judge that it is slightly oval, margins lobed around perforations, 2 large central important to establish the occurrence of genus Euthyonidiella perforations, frequently 6 (up to 14) additional perforations, Heding and Panning in Antarctica. perforations most numerous in smallest specimens, discs predominantly 70 µm long, up to 90 µm long; spires with 2 Family Cucumariidae Ludwig, 1894 pillars up to 40 µm long, spinous distally, sometimes with connecting bridges distally, distal bridges sometimes with Subfamily Cucumariinae Ludwig, 1894 sensu Panning 1949 spines on mid-bridge. Tentacles with irregular thick elongate Diagnosis. Ten dendritic tentacles; calcareous ring lacking perforated plates, up to 88 µm long. Peri-anal body wall with segmented posterior prolongations; ossicles in the body wall abundant tables and internal thick knotted scale-like ossicles. perforated plates, sometimes rods, never cups or tables. Colour (preserved). White. Cladodactyla Brandt, 1835 COI DNA barcode of holotype: AATAAT- GATCGGGGGGTTTGGGAACTGATTAATCCCAC- = Dendrelasia O’Loughlin (in O’Loughlin et al., 2013): 69–70 TAATGATTGGAGCACCAGACATGGCTTTTCCC- (new synonymy) CGAATGAAAAAAATGAGATTCTGACTAATCCCCCC- Table 1; figure 2 CTCATTTATTTTACTCTTAGCTTCAGCAAGAGTA- GAAAGAGGGGCAGGAACTGGTTGGACGGTATACC- Diagnosis (sensu stricto – see Remarks). Ten equal tentacles; CCCCTCTTTCAAGAAAAATAGCTCACGCAGGAG- calcareous ring calcified and evident in small specimens but GCTCAGTTGACTTAGCAATATTTTCCCTTCAC- de-calcified and no longer evident in larger specimens; tube CTAGCGGGAGCCTCATCAATTCTAGCTTC- feet restricted to radii; dorso-lateral radial body wall thick, TATAAAATTTATAACTACAATAATAAAAATGC- soft, “spongy”; external dorsal marsupium created by elongate GAACCCCAGGGGTAAGTTTTGACCGACTATCC- indentation / invagination between dorso-lateral radii, radial CTATTTGTGTGGTCAGTATTTATTACAGC- edges may close over a protective chamber, anterior mid-dorsal CTTTCTTCTACTTCTGAGACTCCCAGTATTAGC- gonoduct opening in marsupium; hermaphroditic; tube feet on CGGGGCTATAACCATGTTACTAACTGATCGTAAT- bivium smaller and more numerous than on trivium; respiratory ATTAATACAACGTTTTTTGACCCTGCGG- trees arise from 3–4 basal sources, each with dendritic GAGGGGGTGATCCCATATTATTTCAACATCTATTCT- branches; mid-body wall ossicles absent in larger specimens; GATTCTTTGGTCATCCAGAAGTGTACATTCTAATCT- peri-anal ossicles include prominently spinous, single-layered, TACCAGGCTTCGGTATGATTTCCCATGTCATTGCT- perforated plates. Four new species and a new genus of Antarctic sea cucumbers 35 Table 1. Species currently assigned to Cladodactyla, occurrence, and contrasting morphological characters. Dorsal Species Occurrence marsupium Tentacles Calcareous ring Body wall ossicles C. brunspicula Thandar, 2008 South Africa Lacking 10 equal; calcified plates with small to filled perforations with rosettes C. crocea (Lesson, 1830) Falkland Islands Present 10 equal, lacking not calcified in lacking in larger rosettes larger specimens specimens C. monodi Cherbonnier, 1950 Cameroon Lacking 2 small ventral, calcified perforated plates lacking rosettes C. senegalensis Panning, 1940 Senegal Lacking 2 small ventral; calcified perforated plates lacking rosettes C. sicinski (O’Loughlin, 2013) South Shetland Present 10 equal, lacking not calcified in lacking in larger Islands rosettes larger specimens specimens Figure 1. Holotype of Euthyonidiella huwi O’Loughlin sp. nov. (NMV F168650). a, preserved holotype; b, photo of calcareous ring, single polian vesicle (lower right), madreporite and stone canal (upper right) (insert: drawing of radial (bottom) and inter-radial (top) plates of the calcareous ring); c, SEM images of ossicles from the tentacles; d, SEM images of table ossicles from mid-body wall (insert: drawing of one common form of variable table discs). 36 P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel Figure 2. Maximum likelihood tree for Cladodactyla–Heterocucumis–Staurocucumis clade, based on COI sequences, T92+G+I model, 100 bootstrap replicates, Laevocnus laevigatus as outgroup. Filled circles >0.95 bootstrap support; hollow circles >0.70 bootstrap support. Four new species and a new genus of Antarctic sea cucumbers 37 Type species. Holothuria crocea Lesson, 1830 (type locality May 2004, NMV F160031 (1) (UF tissue code MOL AF542); Falkland Islands (Malvinas)) (by subsequent designation Falkland Is, Challenger stn 315, 51°40'S 57°50'W, 9–22 m, 26–28 Jan (Panning 1940: 170)) 1876, USNM E10614 (2); Tierra del Fuego, Cape Penas, Eltanin stn 966, 53°40'S 66°20'W, 81 m, 10 Feb 1964, USNM E33519 (46). Remarks. The availability of numerous larger specimens of Description. Body cylindrical, rounded orally and anally, up “Dendrelasia” sicinski from the South Shetland Islands has to 100 mm long 30 mm diameter (live, in Wyville Thompson enabled us to judge that Dendrelasia is a junior synonym of 1878; 47 mm long preserved, in Ekman 1925); body wall soft, Cladodactyla (see below). We formalize the synonymy here. leathery, dorso-lateral radial body wall thick, soft, “puffy”; We base our sensu stricto diagnosis of Cladodactyla on the dorsal marsupium created by elongate indentation / two species that we consider to be Cladodactyla in confidence: invagination between dorsal radii; 10 equal tentacles; ring not C. crocea and C. sicinski. The differences (Table 1) in the calcified in larger specimens; tube feet restricted to radii in presence or absence of a dorsal external marsupium, tentacle paired zig-zag rows, smaller and more numerous in dorso- arrangement, calcification in the calcareous ring, and ossicle lateral than in ventral radii, outer ventro-lateral rows of tube forms, and the broad geographic distribution of the other feet fewer and more spaced, dorsal tube feet absent in small included species, lead us to suspect that Cladodactyla as specimens, often withdrawn into pits in preserved specimens; currently circumscribed may not be monophyletic. dorso-lateral radial tube feet do not cross inter-radius at COI sequence data from several hundred dendrochirotids anterior and posterior ends of marsupium; single polian (Michonneau et al. in prep.) recovers these two species of vesicle; paired, unbranched tufts of hermaphroditic gonad Cladodactyla in a clade with Staurocucumis (including tubules, genital papilla anterior mid-dorsal in marsupium; 2 Abyssocucumis, considered generically distinct by some respiratory trees, each divided basally into 2 sub-equal or (Hansen 1988, O’Loughlin 2002) but not others (Massin & unequal dendritic branches creating 4 trees, extending about Hendrickx 2011)) and Heterocucumis, with modest support. two-thirds length of coelom. An analysis of this clade (Fig. 2), including samples of the type Mid-body wall ossicles absent from largest specimens; in species of all four genera: Cladodactyla crocea, Staurocucumis smaller specimens ossicles absent from marsupium wall but liouvillei, Abyssocucumis abyssorum, Heterocucumis mid-lateral body wall with thick rods and spinous plates, rods steineni, fails to recover these genera as monophyletic, and frequently with single to numerous distal perforations, includes a subclade with 96% bootstrap support that has species of Staurocucumis, Heterocucumis, and Cladodactyla frequently with distal and lateral spines and branches, plates intermixed. Revising the generic limits of this lineage is irregularly oval to round, with two larger central perforations, beyond the scope of this paper. We note however that surface and margin with sharp spines, rods and plates Cladodactyla, as the senior generic name in this assemblage, intergrade, up to 296 µm long. Dorsal tube foot endplates up to is clearly appropriate for C. crocea and C. sicinski. 280 µm diameter, endplate support ossicles curved, distally perforate, spinous rods up to 136 µm long. Ventral tube feet endplates with irregular perforations, diameter about 360 µm, Cladodactyla crocea (Lesson, 1830) endplate support rods as in body wall but curved, about 168 Figures 2, 3, 4; table 1 µm long. Tentacle ossicles irregular thick rods with distal and sometimes lateral perforated extensions, with marginal Holothuria (Cucumaria) crocea Lesson, 1830: 153–154, pl. fig. 1. denticulations around perforated parts, up to 272 µm long. Cladodactyla crocea.—Brandt, 1835: 43.—Wyville Thomson, Introvert lacking ossicles. Peri-anal body wall ossicles spinous 1878: 57–61, fig. 1.—Panning, 1957: 27–29, figs 10–13. rods and plates as in body wall, up to 176 µm long, and some Cucumaria crocea.—Théel, 1886: 58–61, pl. 3 fig. 5, pl. 12 figs 1, larger oval plates with spinous margin, plates up to 240 µm 2 (see Remarks).—Ludwig, 1898: 15–24, pl. 1 figs 6–13.—Vaney, long, no spinous crosses detected. 1908a: 296.—1908b: 23–24.—Ekman, 1925: 75–81, figs 15, 16. Cucumaria croceoida Vaney, 1908a: 299.—1908b: 31, pl. 5 figs Colour. Live: body orange yellow, tentacles white. Preserved: 64–66. body pale brown to grey to cream to pink with brown spots Cucumaria crocea var. croceoides.—Ekman, 1925: 81–85, fig. variably evident. 17. Distribution. South-west Atlantic Ocean, Falkland Islands Material examined. South-west Atlantic Ocean, Falkland Islands, (Malvinas), Burdwood Bank, Tierra del Fuego, 0–303 m. Discovery Expedition, RRS William Scoresby, WS stn 231, 50°10'S 58°42'W, 159–167 m, 4 Jul 1928, NHMUK 2013.1 (1); W of Falkland Remarks. The synonymy above is selective and does not Is, WS stn 867, 51°10'S 64°16'W, 148–150 m, 30 Mar 1932, NHMUK include the comprehensive list of early references provided by 2013.2 (1); WS stn 869, 52°16'S 64°14'W, 187 m, 31 Mar 1932, Ludwig 1898. Théel (1886) provided good illustrations (pl. 3 NHMUK 2013.3 (1); Falkland Is, US AMLR 2004 Icefish stn 17– fig. 5) of the ossicles of Cladodactyla crocea but reported OT20, 52°22'S 58°52'W, 78 m, S. Lockhart, 31 May 2004, NMV them as Cucumaria laevigata, and wrongly reported two F105017 (4) (UF tissue sequence codes MOL AF 501, 502); Icefish stn small ventral tentacles for Cladodactyla crocea. Lampert 18–OT14, 52°08'S 58°05'W, 93 m, S. Lockhart, 28 May 2004, NMV (1886) was confused in his discussion of Cucumaria crocea F106967 (3) (UF tissue sequence code MOL AF 504); Icefish stn 21– OT16, 52°43'S 59°97'W, 120 m, S. Lockhart, 30 May 2004, NMV and illustrated ossicles of Pentactella laevigata Verrill, 1876. F105002 (3) (UF tissue sequence code MOL AF 503); Burdwood Cladodactyla crocea is distinguished from the other Bank, Icefish stn 5–BT4, 54°47'S 59°18'W, 303 m, S. Lockhart, 21 Cladodactyla species by the combination of: presence of a 38 P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel Figure 3. Cladodactyla crocea (Lesson, 1830). a, in situ photo of lateral view of live specimen with juveniles on the dorsal marsupium (Falkland Islands; photo by SMSG); b, dorsal view of 35 mm long preserved specimen showing thickened marsupial dorsal radial rims with numerous very small tube feet (NMV F105017); c, dorsal view of 8 mm long preserved specimen showing invaginated marsupium with enclosed embryos (NMV F160031). Four new species and a new genus of Antarctic sea cucumbers 39 Figure 4. SEM images of ossicles from specimens of Cladodactyla crocea (Lesson, 1830). Main figure with spinous rods and plates from the dorso-lateral body wall of a 15 mm long specimen (NMV F105002); top left box with spinous rods from the lateral body wall of a 28 mm long specimen (NMV F106967). 40 P.M. O’Loughlin, M. Mackenzie, G. Paulay & D. VandenSpiegel dorsal external marsupium; dorso-lateral radial tube feet Tentacle ossicles predominantly perforated plates, some rods; series not continuous anteriorly and posteriorly across the plates thin, irregular, with denticulate margins, sometimes dorsal inter-radius to create a complete border to the with fine surface spines, and larger central perforations; rods marsupium; 10 equal tentacles; tentacle ossicles rods not frequently with distal and lateral perforate developments and plates; absence of introvert ossicles; presence of tube feet denticulate margin; plates and rods both up to 200 µm long. support rod ossicles; lack of spinous crosses in the peri-anal Introvert lacking ossicles. Dorsal tube feet endplates up to 480 body wall. µm diameter; tube foot support plates oval to sub-rectangular Ekman (1925) found variations in body wall ossicle form, to pear-shaped to half-moon shaped, 2 large perforations and in the presence or absence of ossicles, in specimens that he centrally, margin denticulate to spinous to smooth, some with judged to be Cucumaria crocea and Cucumaria croceoida fine surface spines, up to 160 µm long. Ventral tube foot Vaney, 1908. Ekman could distinguish two groups, but endplates up to 960 µm diameter, outer rim of endplate acknowledged that there was an overlap, and thus relegated comprises fused irregular branched rods, not perforations, Vaney’s species to a variety of Lesson’s. We observed similar central perforations slightly larger than outer ones, tube foot variations among specimens of Cladodactyla crocea, and thus support plates oval with surface and marginal spinelets, judge that the variety croceoides should not have formal status surface sometimes smooth, 4 large central perforations, 2 and refer it to the synonymy of Cladodactyla crocea. largest perforations adjacent, 2 smaller distal perforations, up to 208 µm long. Peri-anal body wall with plates, crosses, rods; Cladodactyla sicinski (O’Loughlin, in O’Loughlin et al., 2013) single-layered perforated anal plates up to 320 µm wide, plates irregularly oval with marginal spines or denticulations, with or Dendrelasia sicinski O’Loughlin (in O’Loughlin et al.), 2013: lacking surface spines, frequently 4 large central perforations 70–73, figs 1–3. in cross formation as described above; amongst the body wall Figures 2, 5, 6, 7, 8; table 1 ossicles small clusters of irregular distally spinous crosses of variable rod thickness, arms frequently bifid, sometimes with Material examined. Holotype of Dendrelasia sicinski. Western branches joined to create 8 perforations and slightly concave Antarctica, South Shetland Islands, King George Is, Admiralty Bay, 200–250 m, P. Presler and J. Siciński, 1 Mar 1980, NMV F189855. sub-rectangular plates, crosses up to 112 µm long; rare spinous Other material. Western Antarctica, Elephant I., 61.26°S 54.90°W, or denticulate rods, with or without distal perforations, up to 158 m, RV Polarstern ANT–XXVIII/4 stn 191, 18 Mar 2012, NMV 96 µm long; all three peri-anal ossicle forms inter-grade. F193767 (1); 61.20°S 54.90°W, 63 m, Polarstern ANT–XXVIII/4 stn Colour. Live: body and tentacles pale yellow, oral disc red. 190, 18 Mar 2012, NMV F193770 (1); 61.34°S 55.49°W, 155 m, stn 195, 19 Mar 2012, NMV F193768 (1); 60.88°S 55.45°W, 243 m, stn Preserved: body variably off-white to pale grey-brown; tentacle 208, 21 Mar 2012, NMV F193769 (1); 60.98°S 55.69°W, 92 m, stn 229, discs with paired brown markings anterior to each tentacle, 24 Mar 2012, NMV F193771 (5); 61.14°S 55.69°W, 78 m, stn 230, 24 sometimes fine brown spotting on the oral disc. Mar 2012, NMV F193766 (1) (UF tissue sequence code MOL AF Distribution. Western Antarctica, South Shetland Is, Elephant 1298); South Shetland Is, 62.33°S 60.49°W, 119 m, stn 253, 29 Mar 2012, NMV F193772 (3) (UF tissue sequence code MOL AF 1300). I., 63–250 m. Description (emended). Body fusiform, cylindrical in mid- Remarks. The SEM images of peri-anal ossicles in the recent body, tapers roundly at both ends; preserved body up to 70 mm Susanne Lockhart collection of larger specimens of a species long, 28 mm diameter; body wall thin to thick, soft, leathery; of Cladodactyla from the South Shetland Islands are distinctive. 10 equal dendritic tentacles; calcareous ring evident and They are identical in general shape and form with the peri-anal calcified in small specimens, but becoming decalcified in 15 ossicles from a smaller specimen from Admiralty Bay in the mm long specimen, and thus no longer evident in larger South Shetland Islands illustrated in O’Loughlin et al. 2013 for specimens; dorso-lateral radial body wall thick, soft; tube feet the new genus and species Dendrelasia sicinski O’Loughlin, on dorso-lateral radii in paired close zig-zag rows on each 2013. The small specimen from Admiralty Bay is radius, series extended across dorsal inter-radius anteriorly and morphologically conspecific with the larger specimens of the posteriorly to border an external brood-protecting marsupium, recent Lockhart collection. Dendrelasia is a junior synonym of dorso-lateral radial tube feet smaller and more numerous than Cladodactyla. ventral tube feet, tube feet on dorso-lateral radii may be In specimens of Cladodactyla sicinski there is a distinct withdrawn into pits; tube feet on trivium larger and fewer than dorsal external marsupium. Indentations present in the soft on bivium, ventral radial series in paired zig-zag rows, fewer in inter-radial dorsal body wall within the marsupium suggest a outer rows of ventro-lateral series; shallow median groove in prior presence of embryos or juveniles. Cladodactyla sicinski flat longitudinal muscles; single polian vesicle; paired, un- is distinguished from the other Cladodactyla species by the branched tufts of hermaphroditic gonad tubules, gonoduct combination of: presence of a dorsal external marsupium; opens at pore in mid-anterior marsupium; lacking male genital dorso-lateral radial tube feet series continuous anteriorly and papilla; respiratory trees arise from 3–4 basal sources, each posteriorly across the dorsal inter-radius to create a complete with dendritic branches, extending about half length of coelom. border to the marsupium; 10 equal tentacles; tentacle ossicles Larger specimens lack mid-dorsal and mid-ventral body predominantly plates; absence of ossicles in the introvert; wall ossicles; 15 mm long specimen with prominently spinous presence of tube feet support plate ossicles; presence of rod, X-shape, Y-shape and branched forms up to 136 µm long. spinous crosses in the peri-anal body wall.