Logout succeed
Logout succeed. See you again!

Genes Required for Osmoregulation and Apical Secretion in Caenorhabditis elegans PDF
Preview Genes Required for Osmoregulation and Apical Secretion in Caenorhabditis elegans
Copyright(cid:2)2007bytheGeneticsSocietyofAmerica DOI:10.1534/genetics.106.066035 Genes Required for Osmoregulation and Apical Secretion in Caenorhabditis elegans Samuel Lie´geois,1 Alexandre Benedetto, Gre´goire Michaux,2 Guillaume Belliard and Michel Labouesse3 Institut deGe´ne´tiqueetde BiologieMole´culaireet Cellulaire,CentreNational delaRecherche Scientifique Institut Nationalde la Sante´ etdelaRechercheMe´dicale Universite´ Louis Pasteur BP.10142, 67400Illkirch,France Manuscript receivedSeptember 19, 2006 Accepted forpublicationNovember 23, 2006 ABSTRACT Fewstudieshaveinvestigatedwhetherornotthereisaninterdependencebetweenosmoregulationand vesicular trafficking. We previously showed that in Caenorhabditis elegans che-14 mutations affect osmo- regulation,cuticlesecretion,andsensoryorgandevelopment.Wereporttheidentificationofsevenlethal mutations displaying che-14-like phenotypes, which define four new genes, rdy-1–rdy-4 (rod-like larval lethalityanddye-fillingdefective).rdy-1,rdy-2,andrdy-4mutationsaffectexcretorycanalfunctionandcuticle formation.Moreover,rdy-1andrdy-2mutationsreducetheamountofmatrixmaterialnormallysecretedby sheathcellsintheamphidchannel.Incontrast,rdy-3mutantshaveshortcysticexcretorycanals,suggesting that it acts in a different process. rdy-1 encodes the vacuolar H1-ATPase a-subunit VHA-5, whereas rdy-2 encodesanewtetraspanprotein.WesuggestthatRDY-1/VHA-5actsupstreamofRDY-2andCHE-14insome tissues,sinceitisrequiredfortheirdeliverytotheepidermal,butnottheamphidsheath,apicalplasma membrane.Hence,theRDY-1/VHA-5traffickingfunctionappearsessentialinsomecellsanditsproton pumpfunctionessentialinothers.Finally,weshowthatRDY-1/VHA-5distributionchangespriortomolting inparallelwiththatofactinmicrofilamentsandproposeamodelformoltingwherebyactinprovidesaspatial cueforsecretion. THEabilitytocontrolsoluteandwaterbalancedur- whether or not there is a genetic basis for their inter- ing osmotic challenge is essential for cellular life dependence is largely unclear. (Yanceyet al. 1982). Most cellular functions, in partic- Anobviousapproachtoaddressingthisproblemisto ular vesicle trafficking, dependonthespecific balance find mutations that would affect both osmoregulation of inorganicions inthe cytosol and thelumen.For in- andtrafficking.IncontrasttoSaccharomycescerevisiaefor stance,lossoftheyeastendosomalNa1/H1exchanger which a wealth of information on the genetic control Nhx1alterscytoplasmicandluminalpH,withprofound of osmoregulation (Hohmann 2002) or trafficking consequences on the endocytic trafficking pathway (SchekmanandNovick2004)isavailable,lessisknown (Brettetal.2005).InCaenorhabditiselegans,disruption aboutmulticellularorganisms.ThenematodeC.elegans oftheepidermalchloridechannelgeneclh-1resultsin provides many powerful experimental advantages for asignificantlywiderbodyandanabnormalstructureof defining evolutionarily conserved genes, pathways, cuticularspecializationscalledalae,whicharesecreted and mechanisms that give rise to diverse physiological bytheepidermis(Petalcorinetal.1999).Conversely, processes(JorgensenandMango2002).Inparticular, manyanimalsandplantsrespondtotheneedtomodify C. elegans has helped define genes that contribute to their internal ion balance by regulating the trafficking osmotichomeostasis(Kaitnaetal.2002;Solomonetal. of certain ion transporters, channels, and exchangers. 2004; Lamitina and Strange 2005) and trafficking For instance, vasopressin triggers the fusion of sub- (Nurrish2002). apical vesicles containing the aquaporin-2 membrane WepreviouslyfoundthattheC.elegansproteinCHE- water channel with the apical plasma membrane of 14 is important for both osmoregulation and apical kidney-collecting-duct principal cells to mediate water trafficking(Michauxetal.2000).Aproportionofche-14 excretion (Nielsen et al. 1993, 1995). Although vesi- larvae dies with an appearance of rods that are filled cle trafficking and osmoregulation seem interwoven, with fluid, which resemble larvae observed after laser ablation of the kidney-like excretory cell (Nelson and Riddle 1984). In addition, transmission electron mi- croscopy(TEM)revealsthatche-14mutantsaccumulate 1Presentaddress:UPR9022,IBMC,67000Strasbourg,France. large vesicles in support cells of the amphid sensory 2Presentaddress:UMR6061,CS34317,35043RennesCedex,France. organs and dark material at the apical surface of the 3Correspondingauthor:IGBMC,1rueLaurentFries,BP.10142,67400 Illkirch,France. E-mail:[email protected] epidermis,whilethecuticlenormallysecretedapicallyis Genetics175:709–724(February2007) 710 S.Lie´geoisetal. muchthinnerthannormal(Michauxetal.2000).CHE- 76(e911);unc-24(e138)dpy-20(e1282);MT5813,nDf42/nT1[unc- 14ishomologoustoDispatched(Michauxetal.2000), (n754)] IV; 1/nT1 V. CB4856 is an isolate from a Hawaiian island that shows a uniformlyhigh density ofpolymorphisms aproteinrequiredforthereleaseoftheHedgehogmor- comparedwiththereferenceBristolN2strain(http://genomeold. phogeninDrosophila(Burkeetal.1999).However,the wustl.edu/projects/celegans/index.php?snp¼1)(Wicksetal. C.elegansgenomelacksacanonicalHedgehoghomolog 2001);RW7000isaBergeracstrainwithahighTc1copynumber and several additional components of the Hedgehog- (Williamsetal.1992).Descriptionofotherstrains,markers, signalingpathway,inparticularSmoothenedandCostal2, andrearrangementscanbeobtainedfromWormBase(http:// www.wormbase.org). Strains carrying genetic markers or defi- indicating that CHE-14 does not act in a Hedgehog- ciencieswereobtainedfromtheCaenorhabditisGeneticsCenter. patterningprocess. Mutagenesis and identification of rdy mutations: We pre- To address how CHE-14 might affect trafficking and viouslydescribedatrimethylpsoralen/UV(TMP/UV)clonal osmoregulation,wesoughttoidentifynewgenesacting screen(Michauxetal.2000),whichwasbasedontwosteps:(i) in the same process. Here we report the results of a identificationofF1platessegregatingrod-likelarvaefilledwith fluidand(ii)stainingoffluid-filledlarvaethatwerestilltouch screentouncovermutationsdisplayingche-14-likephe- sensitive with the lipophilic dye 3, 39-dioctadecyloxacarbo- notypes, which led to the identification of seven new cyanine(DiO)toretainplatesinwhichrod-likelarvaefailedto mutations. These mutations define four genes that we take up DiO. DiO normally stains 12 amphid and phasmid call rdy-1–4 (rod-like larval lethality and dye-filling de- sensory neurons, provided that their ciliated endings are fective), one of which corresponds to vha-5 and codes normalandcanaccesstheenvironmentthroughthechannel formedbythesurroundingsocketandsheathcells(Perkins foroneofthefourC.elegansa-subunitsofthevacuolar et al. 1986). Staining with DiO was performed as described H1-ATPase(V-ATPase)protonpump.TheV-ATPaseisa before(Michauxetal.2000).Of13,000haploidgenomes,19 multisubunitproteincomplexconsistingoftwodistinct F clones segregated dead rod larvae, among which 8 were 1 subcomplexes: the cytosolic V1 complex that catalyzes DiOstainingdefective,includingche-14(mc35)(Michauxetal. ATPhydrolysisandthetransmembraneV0complex,to 2000);larvaewithsignsofnecrosisunderdifferentialinterfer- which VHA-5 belongs, that is responsible for proton encecontrast(DIC)opticswerediscarded.Thesemutations, translocation (Nishi and Forgac 2002). While this whichdefinedfournewcomplementationgroups(rdy-1–rdy-4; seebelow),wereoutcrossedwithN2atleastfivetimespriorto work reports the actual molecular cloning of rdy-1 as further analyses. Their arrest stage was determined on the vha-5, we recently used vha-5 mutations to show in a basis of the somatic gonad morphology, the migration/di- parallelstudythattheV0sectoroftheV-ATPaseispres- visionofPcells,thedivisionofseamandintestinalnuclei,and ent at the limiting membrane of multivesicular bodies theappearanceofpostdeiridneurons. StrongRaspathwaymutants(let-60,mpk-1,let-23,sem-5)also (MVBs)andattheepidermisapicalmembrane,whereit display a rod-like larval lethality (Yochem et al. 1997). We allows the release of MVB internal vesicles (Lie´geois believe that rdy mutations do not affect the Ras pathway, as et al. 2006). In particular, using hypomorphic muta- dying let-23(sy10), mpk-1(ku1), and sem-5(n2019) larvae could tions,wecouldgeneticallyestablishthatVHA-5hastwo stilltakeupDiO(datanotshown). distinct and separable functions—one involved in pro- Geneticmappingandcomplementationtests:Detailsabout the assignment of rdy mutations to four complementation ton pumping within the entire V-ATPase complex and groups corresponding to rdy-1(mc37) and rdy-1(mc38) (LGIV), another involved in trafficking within the V0 complex rdy-2(mc39) and rdy-2(mc40) (LGV), rdy-3(mc41) (LGIII), rdy- alone(Lie´geoisetal.2006).Withthisrecentworkasa 4(mc42)andrdy-4(mc43)(LGII)andtheirmappingcanbefound background,herewemolecularlycharacterizeinparal- in the supplemental material at http://www.genetics.org/ lel the genes rdy-1/vha-5 and rdy-2, investigate their supplemental/. Transgenesis and complementation rescue: DNA was in- function in sensory organs, and compare the cellular jected into the syncytial gonads of hermaphrodites using in- role of rdy-2 to that of rdy-1/vha-5 in the epidermis. jectionmixesthatgenerallycontained10ng/mlconstructor We also test which protein among RDY-1, RDY-2, and 100 ng/ml cosmid, 100 ng/ml pRF4 as a transformation CHE-14actsupstreamoftheotherintheepidermisand marker (Mello et al. 1991), plus pBSKII plasmid to bring in support cells. Finally, to extend our previous con- thetotalDNAconcentrationto200ng/ml.DNAmixeswere injected into rdy-1(mc38)/unc-5(e53) or rdy-2(mc39)/sqt-3(sc63) clusions about the role of the V0 sector in cuticle se- him-5(e1467) unc-76(e911) animals; rescue was judged on the cretion (Lie´geois et al. 2006), we examine whether absenceofuncoordinated(Unc)animalsintheprogeny.For VHA-5expressionchangesduringmolting,asobserved rdy-1, we found that F35H10, one of the two cosmids in the formanygenesinvolvedincuticleformation. interval where rdy-1 was predicted to map, could rescue the lethalityofrdy-1(mc38).RNAinterference(RNAi)(Fireetal. 1998) against vha-5/F35H10.4, which was known to be ex- MATERIALS AND METHODS pressed in the excretory canal (Oka et al. 2001; Pujol et al. 2001),indicatedthatrdy-1correspondstovha-5.Forrdy-2,we C. elegans strains and maintenance: C. elegans strains were foundthatC50B8,F53F4,andaPCRfragmentspanningF53F4.4 handled and maintained at 20(cid:3) as described previously and F53F4.6 (10,785 bp; primers 59-TGCTTCTGCCTTCTC (Brenner 1974). The following strains were used: N2 (wild TCATTCand59-CATTTCAGGACGAATACTTCC),butnotPCR type);CB4856(wildtype);RW7000(wildtype);DH1206,rme- fragmentsspanningF53F4.1andF53F4.2(7773-bpfragment; 8(b1023) I; CB3823, eDf18/unc-24(e138) dpy-20(e1282) IV; primers59-GTCATAACAGCCTTAAACTACand59-GCATTTG KK627, itDf2 V/nT1[unc-?(n754) let-?] (IV;V); MT3751, dpy- TAGTGATTTCAAGG)orF53F4.3(4331-bpfragment;primers 5(e61) I; rol-6(e187) II; unc-32(e189)III; MT464, unc-5(e53) IV; 59-CGATGCTCCAATTAGTAAACC and 59-CTTGCAACACTC dpy-11(e224) V; lon-2(e678) X; sqt-3(sc63) him-5(e1467) unc- GAAAGCTTG),couldrescuethelethalityofrdy-2(mc39).After Controlof OsmoregulationandSecretion 711 digestionofthe10,785-bpPCRfragmentwithMscIorSalIand (Lie´geois et al. 2006) with rdy-2Tcfp (at 5 ng/ml) and che- gelpurification,the6985-bpSalI-cutfragmentcontainingonly 14Tyfp(at20ng/ml)constructsinvha-5(mc38)/unc-5(e53)ani- F53F4.6, but not the MscI-cut fragment containing F53F4.4, malsandselectedF transgenicanimalsthatdidnotsegregate 2 couldrescuethelethalityofrdy-2(mc39).Weconcludethatrdy- Uncs. To generate the vha-8Tvab-10 Tyfp construct, the p ABD 2correspondstothepredictedgeneF53F4.6. vha-8 promoter (primers 59-aaaagtggtaccAAAGTATTGTCCG RNA interference: Hermaphrodites were injected with CAAGGCAC and 59-ttcccatggtaccAGTCGTTAGTGGTTTTC double-strandedRNAtranscribedwiththemessagemachine CCTG; KpnI underlined) was cloned upstream of a cDNA T3kit(Ambion,Austin,TX)fromaPCRfragmentobtained encoding the first 290 residues of the spectraplakin VAB-10 withprimers(59-aattaaccctcactaaaggGAGCTCTCTGAAGTCT (Bosher et al. 2003) fused to the yellow fluorescent protein TGTGG and 59-aattaaccctcactaaaggCAGAACTCAAAAGAAA (YFP)-coding sequence in the pPD136.64 vector (kind gift GAAGC; lowercase letters correspond to the T3 RNA Pol fromA.Fire,http://www.ciwemb.edu/pub/FireLabInfo/).This promoter)locatedinthe39-endofvha-5.Itinducedapartial construct and the vha-5Tcfp plasmid (see above) were co- L2 larval lethality characterized by rod-like larvae filled with injected with or without a dlg-1Trfp plasmid marking the C. fluid. elegans adherens junction (gift from Jeff Hardin); at least DNA sequencing of vha-5 and rdy-2: Using overlapping threeanimalsforeachlarvalstagefrommorethantwoinde- PCRreactions,weamplifiedtheentirevha-5andrdy-2coding pendent transgenic lines were examined and gave identical sequencesandsequencedfragmentsbearingadeletionorall results. fragmentsforrdy-2(mc39).vha-5(mc37)correspondstoa214-bp Mosaic analysis of vha-5: Mosaicanalysis of vha-5 was per- deletion, including the genomic positions 2498–2711 down- formedusing twoparallelstrategies. Inthefirstcase, homo- streamofthefirstvha-5codingnucleotide;vha-5(mc38)corre- zygous transgenic vha-5(mc38); Ex[pML670; pRF4] animals spondstoa124-bpdeletionincludingthegenomicpositions were allowed to lay eggs for 6–8 hr (pML670 is a rescuing 2298–2421 downstream of the first vha-5-coding nucleotide; vha-5Tgfpconstruct;seeabove).Rdydeadlarvaewereexam- rdy-2(mc39) corresponds to a T:A substitution at position inedbyDICandGFPfluorescence24hrafteregglaying;plates 16,382intheF53F4cosmidsequenceandispredictedtotrans- werealsoinspectedoverthenext2daysforraredyinglarvae form an AGA codon into an opal stop codon; rdy-2(mc40) thatcouldprogressbeyondtheL2stage.Inthesecondcase, corresponds to a 121-bp deletion, including the positions we induced deletions in the vha-5 promoter by generating 15,506–15,626intheF53F4cosmidsequence. three plasmids: pML680 was obtained by digesting pML670 RT–PCR in rdy-2: To determine the 59-end of rdy-2 tran- withHindIIIandAvrIIfollowedbyT4DNApolymerasetreat- scripts, we used an RT–PCR strategy. Total RNA preparation ment(1542-ntdeletion);pML685andpML689wereobtained and RT–PCR were carried out as described before (Bosher byPCRtoamplifytheplasmidpML670exceptthepromoter et al. 2003). Reverse transcription was initiated with either region encompassing nucleotides 1494–2494 (primers 59- oligo(dT)or59-ACGTAGAGAAGTGCTCCAAGG,whichbridges aaaacgcgtgAGAACTGTGAGAATTTCAATCand59-aaaacgcgtg thefinaltwoexons.PCRwasdoneusingtheprimer59-TACTTC AGGTGTTAAAGGCTAATCTGC) or nucleotides 1494–2653 TTCCAAATCTCGACG or a primer corresponding to the (primers 59-aaaacgcgtgACAGTTCTCAATTCATATTGG and sequenceoftheSL1splicedleaderand59-CAATGTGACACAGC 59-aaaacgcgtgATCTCTCTCCTTTGTTGCTC),respectively;the TAACTCC(inthefourthexon)ortheprimerusedforRT.RT– underlinedMluIrestrictionsitewasusedforreligation. PCRproductswerethensequenced. Microscopy: DIC, TEM, scanning electron microscopy Fluorescent fusion proteins: Constructs were generated (SEM),andconfocalmicroscopywereperformedasdescribed usingstandardproceduresandsubsequentlytransformedinto elsewhere(Lie´geoisetal.2006).TEMonrdymutantswascar- XL1-blueelectro-competentbacteria.Therescuingvha-5Tgfp ried out by picking larvae as soon as signs of rigidity and (pML670)andvha-5Tmrfp(pML698)constructsaredescribed translucence became apparent, which was ,32 hr after egg elsewhere (Lie´geois et al. 2006). Substituting the GFP- laying.TEMandSEMonadultsweredonebypickingL4larvae codingsequencewiththatofcyanfluorescentprotein(CFP) 24hrpriortofixation.ForTEM,fourvha-5(mc38)andthree (taken from plasmid pPD136.61, a kind gift from A. Fire, rdy-2(mc39)animalswereobserved.Forbothvha-5(mc38)and http://www.ciwemb.edu/pub/FireLabInfo/) produced the rdy-2(mc39) animals, a set of at least 20 adjacent ultrathin vha-5Tcfp construct. pML680 (Ex[1DHyp]), carrying a 1542- sections from the tip of the head and at least three sections bpdeletioninthepresumptivevha-5promoter,wasobtained takeninatleastthreedifferentareasofthebodywereanalyzed. by digesting pML670 with HindIII and AvrII followed by T4 For SEM, 15 animals were observed for the vha-5(mc38); DNApolymerasetreatment.Other vha-5promoterdeletions Ex[pML680]strain,whichalldisplayedalaedefects. wereobtainedbyPCRusingtheprimers59aaaacgcgtgAGAAC TGTGAGAATTTCAATC and 59-aaaacgcgtgAGGTGTTAAAG GCTAATCTGC (deletion 1493–2494; underlined sequence, MluI site) and 59-aaaacgcgtgACAGTTCTCAATTCATATTGG RESULTS and 59-aaaacgcgtgATCTCTCTCCTTTGTTGCTC (deletion 2482–2652)startingfrompML670.pML673,encodingaRDY-2T A genetic screen for mutants displaying che-14-like GFP functional fusion protein, was obtained by cloning the phenotypes: che-14 larvae display two phenotypes that promoter and thefull-length coding sequence of F53F4.6 in are easy to score (Michaux et al. 2000). First, a pro- frame with the GFP-coding sequence (primers 59-cccgagctc portion of che-14 larvae die looking as rods filled with GACAAGAAACGTGTTCGAGC,SacIunderlined,and59-gggg fluid. Second, all che-14 L2 and older larvae display a taccAACTTTTCACGAGATATGAAGATTA, KpnI underlined) inamodifiedversionofpPD95.75inwhichaSacIsitehadbeen dye-staining defect of amphid and phasmid chemo- engineered.SubstitutingtheGFP-codingsequencewiththat sensoryneuronsafterincubationwiththelipophilicdye ofCFPproducedtherdy-2Tcfpconstruct.Asimilarstrategywas DiO. DiO normally stains neuronal cell bodies, pro- usedtogenerateache-14Tyfpconstructstartingfromthepre- vided that their ciliated endings are normal and have viouslydescribedche-14Tgfpconstruct(Michauxetal.2000). accesstotheenvironmentthroughthechannelformed ToexaminethedistributionofRDY-2andCHE-14mutantsin weakrdy-1mutants,weco-injectedtheselectionmarkerpRF4 by the surrounding socket and sheath cells (Perkins with the mutant vha-5(L786S)Tmrfp transgene (at 3 ng/ml) etal.1986). 712 S.Lie´geoisetal. Figure1.—Mutagenesisandidentificationofrdymutations.(A)Strategyfortheidentificationofrdymutations.AfterTMP/UV mutagenesis,theprogenyofindividualF animalswereexaminedforthepresenceofrod-likelarvaefilledwithfluid(topphotos: 1 DICmicroscopy)andthenforstainingwiththelipophilicdyeDiO(bottomphotos:fluorescencemicroscopy),whichnormally labels12neuronsinthehead(largearrows)andtheirdendrites(arrowheads).(Left)Wild-type(WT)larvae.(Right)rdy-1(mc38) mutants(thesmallarrowinthebottomphotopointstothepharyngeallumen).(B)L1larvaalae(arrowheads)ofwild-typeandrdy mutantsviewedbyDICmicroscopy.LarvaearearrangedinorderofincreasedseverityfromWT¼rdy-3(normalalae).rdy-2.che- 14¼rdy-4.rdy-1(noalae).(C)Excretorycanal(openarrowheads)ofL1larvaeviewedbyDICmicroscopyandarrangedinorder ofincreasedseverity:thecanalwasthickerinrdy-2mutants;thickerandirregular(solidarrowhead)inrdy-4mutants;extremely thickinrdy-1mutants;essentiallyabsentinrdy-3mutants,inwhichvacuoles(arrow)thatprogressivelygrewinsize(top—24hr afteregg laying;bottom—32 hr afteregg laying)couldbe seenatthe levelof the excretory cellbody.Bars, 5 mm. To identify essential as well as nonessential genes Thegenerdy-3isdefinedbyasingleallele,andtheothers potentiallyactinginthesameprocessasche-14,weuseda bytwoalleles. two-step clonal strategy with the two criteria described Table1andFigure1presentamoredetailedaccount above(Figure1A).Thisscreenledtotheidentification of the defects conferred by the rdy mutations. First, ofche-14(mc35)(Michauxetal.2000).Wealsorecovered whereas che-14 mutants display a partial larval lethality, seven other mutations (not described at the time), other rdy mutations induced a fully penetrant lethality namedmc37–mc43.Wecompletedthisscreenbyacloser duringtheL1orL2larvalstages.Sinceallknownche-14 examinationofthecuticle,asche-14adultshavestunted mutations are strong or null alleles (Michaux et al. alae, which are cuticular specializations running along 2000), some essential functions carried by rdy genes thelateralsideoftheanimal(Figure1B).Wecalledthe mustbeche-14independent.Second,theyalldisplayeda genesidentifiedbythesemutationsrdy.Geneticanalysis penetrant dye-filling defect in amphids and phasmids, showedthattheydefinefourcomplementationgroups, as do che-14 alleles. Third, DIC microscopy suggested whichmappedontofourchromosomes(seesupplemen- thatallrdyL1larvae,exceptrdy-3(mc41),hadabnormal talmaterialathttp://www.genetics.org/supplemental/). alae (Figure 1B); the alae defect of che-14 larvae was Controlof OsmoregulationandSecretion 713 TABLE 1 Phenotypesofthe rdy mutants Genotype %Rdy (N)a Stageof lethalityb DiO(1)neuronsc Alaed Wild type 0 — 10.5 61(n¼ 20) 111 che-14(mc35) 49(n ¼305) L1to adult 1.2 61(n¼ 20) 1 rdy-1(mc37) 21(n ¼241) Mid-L1 (n ¼18) 1.1 62.2 (n¼ 24) (cid:2) rdy-1(mc38) 24(n ¼228) Mid-L1 (n .50) 1.5 62.7 (n¼ 13) (cid:2) rdy-2(mc39) 23(n ¼245) L2(n .50) 1.1 62.1 (n¼ 10) 11 rdy-2(mc40) 22(n ¼262) L2(n ¼21) 1.36 2(n ¼21) 11 rdy-3(mc41)e 21(n ¼571) 90% L2/10% L3(n¼ 38) 0(n ¼20) 111 rdy-4(mc42) 22(n ¼380) Mid-L1 (n ¼25) 0(n ¼10) 1 rdy-4(mc43) 23(n ¼248) Mid-L1 (n .50) 1.26 1(n ¼20) 1 aPercentageofrod-lookinglarvaefilledwithfluidintheprogenyofheterozygousrdymutantstrainsorinthe progenyofhomozygousche-14(mc35)animals.AlthoughtheproportionofRdylarvaewasalways,25%,webe- lievethattheirlethalityisfullypenetrant,astheirtransparencymakesthemdifficulttospotandaswenever recovered viableadultslayingonly Rdylarvae. bStagewhenlarvae ceasedto move,whichwas assessedat least 48hr afteregg laying. cNo.ofamphidchemosensoryneuronsthatwere stainedbyDiO,whichcannormally stain12neuronsin wild-type animals. dPresenceorabsence ofalae under DICmicroscopy with anarbitrary scoreranging from 111to(cid:2) (see Figure 1C). erdy-3(mc41)larvaewerefrequentlyfoundtodieofffood,whichisafurtherindicationthattheyhavedefective chemosensoryorgans. intermediate between those of rdy-1 and rdy-2; that of whichinduceprematurestopcodons(Figure2B).This rdy-4larvaewasslightlyvariablebutgenerallylikethatof resultisconsistentwiththenatureofthemutagenused che-14 larvae. In wild-type animals, the excretory cell (trimethylpsoralen),thegenetictestsshowingthatmc37 sendsoutlonganteriorandposteriorprocesses,which and mc38 are strong or null alleles (see supplemental run on both sides of the animal and are called the ex- material at http://www.genetics.org/supplemental/), cretory canals. The posterior canals extend until the and the absence of wild-type VHA-5 in Western blots somaticgonadattheL1stageandreachtherectumin ofvha-5(mc38)animals(Lie´geoisetal.2006).Below,we L2 larvae. rdy-1, rdy-2, and rdy-4 mutants had an ex- willrefertordy-1asvha-5.VHA-5correspondstooneof cretory canal of normal length, but it was abnormally thefourC.eleganslargetransmembranesubunitsofthe wide and occasionally exhibited swelled areas (Figure V-ATPase,theso-calleda-subunit.VHA-5andtheother 1C). In contrast, rdy-3(mc41) larvae had no excretory a-subunits (UNC-32, VHA-6, and VHA-7) have specific canalanddevelopedaprogressivevacuoleatthelevelof tissuedistributions(Okaetal.2001;Pujoletal.2001). the excretory cell body (Figure 1C; 21 of 29 had no The V-ATPase is involved in acidification of secretory canal;6hadacanalextendinguptothepositionofthe and endocytic organelles and is essential for osmoreg- H2 blast cell, and 2 until the position of the V1 blast ulationinanimalexcretorysystems(NishiandForgac cell). We thus suggest that rdy-3 may act in a different 2002; Sun-Wada et al. 2003). The transmembrane V0 processthantheotherrdygenes. sector,towhichVHA-5belongs,alsoplaysadirectrolein We decided to focus on rdy-1 and rdy-2, which had trafficking in yeast, Drosophila, and C. elegans (Peters strong alae phenotypes. Our rdy-1 and rdy-2 alleles et al. 2001; Bayer et al. 2003; Hiesinger et al. 2005; are strong loss-of-function or null alleles, since their Lie´geoisetal.2006). phenotypes did not worsen in trans to deficiencies rdy-2 encodes a four-transmembrane protein of (see materials and methods). For simplicity, we will unknown function: Usingasimilarstrategy,weshowed first describe their cloning and then their cellular thatthepredictedgeneF53F4.6couldrescuethelethal- phenotypes. ity of rdy-2(mc39) larvae (see materials and methods RDY-1 corresponds to the V-ATPase a-subunit VHA- and Figure 3A). In particular, we found that the muta- 5:Todeterminethemolecularidentityofrdy-1,weused tionrdy-2(mc39)changestheArgcodon71intoanopal a classical strategy combining high-resolution genetic stop codon, whereas rdy-2(mc40) is a deletion inducing mapping, RNA interference, and transgene-mediated aframeshift(Figure3,BandC;supplementalFigure1 complementation rescue (Figure 2A) (see materials at http://www.genetics.org/supplemental/), in agree- andmethods).Wefoundthatrdy-1correspondstothe ment with the prediction that both are strong or null previouslydescribedgenevha-5(Okaetal.2001;Pujol alleles (see supplemental material at http://www. etal.2001)(Figure2A).Inparticular,wefoundthatrdy- genetics.org/supplemental/).RT–PCRexperimentsand 1(mc37) and rdy-1(mc38) are small deletions in vha-5, sequence comparisons, which are further detailed in 714 S.Lie´geoisetal. Figure 2.—rdy-1 corre- sponds to vha-5 and codes for a V-ATPase a-subunit. (A, top). Genetic map of chromosome IV showing the positions of markers used to map rdy-1. rdy- 1(mc37) and rdy-1(mc38) mutations were positioned betweentheleftbreakpoint ofeDf18,whichisdefinedby cosmid K07H8, and a SNP located in cosmid D2096. (Middle) Among cosmids in this region, F35H10 res- cued the lethality of rdy- 1(mc38) larvae (number of rescued lines indicated on the right). (Bottom) RNAi and further rescuing tests proved that rdy-1 corre- spondstothegeneF35H10.4/vha-5,whoseexon–intronstructureisshownalongwiththepositionsofmc37andmc38.(B)Morede- taileddescriptionofthemolecularlesionscorrespondingtovha-5(mc38)andvha-5(mc37).(Top)Wild-typesequenceflankingthe deletionbreakpoints(slashes).(Bottom)Mutantsequenceanddistancetotheneareststopcodon. supplemental Figure 1 at http://www.genetics.org/ poorly attached and frequently enlarged (Michaux supplemental/, suggest that there are two distinct rdy- etal.2000).InagreementwiththeDICanalysis(Figure 2 transcripts with distinct 59-ends. The long and short 1) and with the characterization of point mutations rdy-2transcriptspotentiallyencodetwotetraspanmem- partially affecting the proton pump function of vha-5 brane proteins (Figure 3D; supplemental Figure 1 (Lie´geois et al. 2006), we found that vha-5(mc38) null at http://www.genetics.org/supplemental/) with pre- larvaeand,toalesserextent,rdy-2mutantlarvaehadan dictedN-andC-terminalcytosolictails.Manynematode enlargedexcretorycanal(Figure4A). species, including the distant parasitic nematodes Epidermis: The epidermis secretes the cuticle (Fig- Meloidogyne incognita and Strongyloides stercoralis (http:// ure4B),whichinL1,dauer,andadultstagesformsalae www.nematode.net/blast), encode homologs of the with contributions from seam cells and the hyp7 short RDY-2 isoform, but only the closely related C. syncytial epidermis (Sapio et al. 2005). Typically, che-14 briggsae and C. remanei species are predicted to encode mutantshaveathinnercuticleandalae.Wecoulddetect homologs of the long RDY-2 isoform (supplemental bothepidermalandcuticulardefectsinvha-5nulllarvae Figure 1B at http://www.genetics.org/supplemental/). (Figure 4, B and C). Within the epidermis, we noted ItsuggeststhattheshortRDY-2isoformmightcarrythe that the stacked sheets of membranes, which normally mostimportantfunction.Outsideofnematodes,there invaginate from the apical membrane, were either re- are no RDY-2 homologs. In particular, the sizes and duced in size or disorganized (Figure 4B, open arrow- sequences of RDY-2 extracellular and cytosolic loops head). Extracellularly, the cuticle had an abnormal differfromthoseofothertetraspanproteins,suchaspro- structure (Figure 4, B and C). In some places, dense teolipids, connexins, tetraspanins, and claudins. None- material accumulated under the cuticle (Figure 4C), theless,wenotethatthesewell-characterizedtetraspan whileinothersthecuticlewasnotcloselyapposedtothe proteins are involved in cell adhesion, membrane in- epidermal apical plasma membrane (Figure 4B, solid tegrity,orpossiblyapicaltrafficking(Cheongetal.1999). arrowhead).Thecuticle’soutersurfacewaswavyinstead vha-5 and rdy-2 mutations affect osmoregulation and of flat, it had an irregular thickness, and alae were secretion: As outlined above, rdy mutants share with absent (Figure 4C) (consistent with the DIC pheno- che-14 mutants several phenotypes at the level of the type).Theapparentseparation betweentheepidermis dissectingmicroscope.Todeterminewhetherthiscould andthecuticlemightreflectanosmoregulationdefect; also be the case at the subcellular level, we examined the structural cuticular defects are consistent with the vha-5(mc38)andrdy-2(mc39)larvaebytransmissionelec- observationthatpointmutationspartiallyaffectingthe tronmicroscopyastheywerebecomingrods. traffickingfunctionofVHA-5,butnotitsprotonpump Excretory cell: In wild-type animals, a system of function,hadreducedalaeandweredumpy(Lie´geois beaded canaliculi feed into a central apical lumen of etal.2006).Thecuticleofrdy-2larvaewasabnormal,too, theexcretorycanal(Figure4A),whichissurroundedby but not asseverely affected: its most distinctive feature a basal lamina that it shares with the neighboring epi- wastheirregularandgenerallyflattenedstructureofits dermis.Typically,inche-14mutantstheexcretorycanalis alae(Figure4C). Controlof OsmoregulationandSecretion 715 Figure 3.—rdy-2 encodes two putative tetraspan proteins. (A, top)Geneticmapofchromosome Vshowingthepositionsofmarkers usedtomaprdy-2.rdy-2(mc39)and rdy-2(mc40) mutations were posi- tioned between a SNP localized inthecosmidT10G3andtheleft breakpoint of itDf2, which is de- finedbythecosmidT03D2.(Mid- dle) Among cosmids in the area, only cosmids C50B8 and F53F4 (boldface type) could rescue the lethalityofrdy-2(mc39)larvae(the number of rescuing lines tested for the presence of cosmid DNA byPCRisindicatedontheright). (Bottom) Among PCR-generated subfragments of F53F4, only F53F4.6couldrescuethelethality of rdy-2(mc39) larvae. (B) Pre- dicted exon–intron structure of F53F4.6 according to Wormbase version WS157 (top) and actual exon–intron structure of rdy-2 transcripts deduced from RT– PCR experiments using the pri- mers symbolized between both structures (half arrows; S, sense; R, reverse; nucleotides are num- bered relative to the first AUG according to WS157). The posi- tionsofconservedareasintheC. briggsaeF53F4.6homologaresym- bolized by dashed lines. (C) A more detailed description of the molecular lesion corresponding to rdy-2(mc40) (see Figure 2B for symbols). (D) Topology of the long and short RDY-2 proteins as predicted by the software TMHMMversion2.0(http://www. cbs.dtu.dk/services/TMHMM/); theN-termextensionofthelong proteinisindicatedshaded. Chemosensory organs: In wild-type animals, the bi- material surrounding the ciliated endings of chemo- lateralamphidciliatedneuronsgothroughtwoconsec- sensory neurons (Perkins et al. 1986) (Figure 5D, en- utive channels made by the amphid sheath and the largement).Invha-5nulllarvae,theselamellaeadopted amphid socket cells (Figure 5A), both of which are af- acircularring-likestructure(Figure5C,arrowheads).At fectedinche-14mutants(Perkinsetal.1986;Michaux aslightlyposteriorlevel,neuronswere separatedinan et al. 2000). The bilateral amphid sheath cells, and abnormallywideandelectron-lightlumen(Figure5E), several other sensory neuron sheath cells, contain dis- and we noted an absence of granular material around tinctive parallel membrane lamellae (Figure 5B, right neuronsintheamphidpocket(Figure5E,arrowhead). enlargement),whicharesuspectedtoplayaroleinthe Enlargementofthesheathpocketmightalsoreflectan formation of the large vesicles that are secreted within osmoregulationdefect.Likewise,inrdy-2mutantlarvae, the amphid pocket and accumulate in che-14 mu- we could not find any granular material around neu- tants (Perkins et al. 1986). The content of these vesi- rons,whichwerealsospreadoutinanabnormallywide cles might correspond to the granular electron dense electron-light lumen (Figure 5F, arrowhead). These 716 S.Lie´geoisetal. had lost vha-5Tgfp expression in the excretory system (Table 2). However, larvae retaining expression in the epidermis(classIandII)couldsurvivelongerthanRdy larvaewithnoexpressionatall(classIII),implyingthat theepidermisalsorequiresVHA-5functiontomaintain theanimals’health(Table2).Tospecificallyrescuevha- 5 function in the excretory cell, we used promoter deletionsinthevha-5promoter,aswecouldnotfindany well-characterized gene expressed in the excretory system but not in the epidermis (Figure 6A). One vha- 5promoterdeletion(vha-5;Ex[Dhyp])remainedactive in all cells expressing vha-5, except in the epidermis aftertheL4/adultswitch,andrescuedthelarvallethal- ity of vha-5(mc38). The corresponding adults displayed thinner alae than wild-type adults and their cuticle was not closely apposed to the epidermis everywhere when examinedbyelectronmicroscopy(Figure6,BandC),as alsoobservedinvha-5nullmutants(Figure4,BandC). Collectively, these data show that vha-5 acts cell-autono- mouslyandthatthecuticledefectsdonotresultfromthe absenceofVHA-5functionintheexcretorysystem. VHA-5 and RDY-2 are apical and have overlapping distributions: Tofurtherdefinetherolesofrdy-1/vha-5 Figure 4.—vha-5 and rdy-2 mutants have enlarged excre- and rdy-2, we determined their expression patterns us- tory canals and cuticle secretion defects. TEM images of ing functional translational fusions (see Figures 2 and wild-type (WT), vha-5(mc38), and rdy-2(mc39) L1 larvae. (A) 3).UsingGFPconstructsandantibodies,wepreviously Cross section through the excretory canal; its outline is showed that VHA-5 is expressed in the excretory canal markedbyadashedline.Notetheenlargedsectionoftheca- andtheepidermis(Lie´geoisetal.2006).Wefoundthat nalinrdymutantsanditsdarkappearanceintherdy-1/vha-5 larva.Theaveragecanalsectionwas0.2260.05mm2inwild- RDY-2hasadistributionverysimilartothatofVHA-5in type L1 larvae, 0.69 6 0.31 mm2 in vha-5(mc38) larvae (P , thesetissues(Figure7A).Specifically,wesawexpression 0.0005), and 0.44 6 0.11 mm2 in rdy-2(mc39) larvae (P , intheliningoftheexcretorycanalandexcretoryduct, 0.0001). (B) Cross section through the epidermis. In vha- butnotaroundtheexcretorypore.Asnoexpressionwas 5(mc38)larvae,stackedsheetsofmembrane(arrowhead)orig- seen around the excretory cell body, we conclude that inatingfromtheapicalplasmamembraneareirregular,and the cuticle is irregular (arrow) and has partially detached RDY-2 is localized at the apical side of the canal, as from the epidermis (solid arrowhead). (C) The alae of the reportedforVHA-5(Lie´geoisetal.2006).RDY-2hada vha-5(mc38)larvaareabsent,andthoseoftherdy-2(mc39)larva distribution in the epidermis similar to that of VHA-5 haveaflatstructure,comparedtocontrolalae.Bars,0.5mm. and was also excluded from seam cells (Figure 7A). In contrast to VHA-5, whose expression was observed defects are compatible with a direct or indirect (see throughout development, starting at midembryogene- discussion) role in secreting the granular material sis,RDY-2expressionbecameprogressivelyfainterafter found in the amphid channel and in controlling the L1 stage. VHA-5 was also detected at the lumen of osmoregulationintheamphidpocket. thevulvaandrectum(datanotshown).Inaddition,we vha-5actscell-autonomously:Theearlylarvallethality foundthatVHA-5aswellasRDY-2wereexpressedinthe andstrongexcretorycelldefectsofvha-5mutantsraise sheathcellsassociatedwithheadandtailsensoryorgans theprospectthatthecuticlesecretiondefectsmightbe (Figure7A).Three-dimensionalreconstructionsshowed indirectandresultfromlethality.Totestthispossibility, that VHA-5 and RDY-2 formed a sixfold symmetrical we performed a mosaic analysis of vha-5 using two pattern, which includes a larger spot that presumably parallel approaches that both rely on the use of a res- correspondstotheamphid(Figure7C).Wethussuggest cuing vha-5 transgene expressed in the excretory cell thatRDY-2andVHA-5arepresentinCEPand/orOLQ and the epidermis (Lie´geois et al. 2006) (see also supportcells,inadditiontoamphidsupportcells.Inthe below).First,weanalyzedthedefectsobservedindead amphidsheathcell,VHA-5andRDY-2werefoundinthe larvaesegregatingfromtransgenicvha-5(mc38)animals mostdistalpartofthecellliningthesheathpocket,which carrying a rescuing vha-5Tgfp transgene. Second, we can be equated to its apical side (Figure 7, C and D). sought to rescue vha-5 function in the excretory canal Expressionintheexcretorysystem,insheathcells,andin but not in the epidermis. Using the first approach, we theepidermismatcheswellvha-5 andrdy-2 phenotypes, foundthatlarvallethalityisduemainlytolossofvha-5 strengthening the notion that these genes act cell- expressionintheexcretorysystem,sinceallRdylarvae autonomously. Controlof OsmoregulationandSecretion 717 Figure 5.—VHA-5 and RDY-2 are essential for secretion of ma- trix material by sheath cells. (A) Schematic showing the approxi- mate positions of the different TEM transverse sections in B–F. All images correspond to L1 lar- vae. (B) Wild-type (WT) and (C) vha-5(mc38) larvae, close to the tipofthenose.Theleftandright magnifications show the amphid openingatthelevelofthesocket channel (arrow, terminal sensory dendrites) and a stack of mem- branesheets(arrowhead),respec- tively; amphid neurons were normally enclosed by the socket channel in vha-5(mc38) mutants, butmembranesheetsweredisrup- ted (arrowhead). (D) Wild-type, (E) vha-5(mc38), and (F) rdy- 2(mc39)larvae,furtherposteriorly, showing ciliated neurons sur- rounded by the amphid sheath. Noteintheenlargedview(right), the dark material (arrowhead in D) in the extracellular space aroundciliateddendrites(arrow), whichisabsentinthetwordysec- tions.Instead,thereisemptyspace around the dendrites (arrow- heads), particularly in the vha-5 larva.Bars,1mm. vha-5 acts upstream of che-14 and rdy-2 in epidermal accumulatewithindarkMVBsintheepidermis(Lie´geois but not in sheath cells: Our initial goal was to identify etal.2006).WefoundthatCHE-14andRDY-2colocalized genes acting in the same process as che-14 in osmoreg- with the mutant VHA-5 in the epidermis (Figure 7B), ulation and trafficking. To test if this was the case for presumably within MVBs. We conclude that VHA-5 is vha-5andrdy-2,wereasonedthattheyshouldhave,ata requiredforalatetraffickingstepofCHE-14andRDY-2in minimum, the same subcellular distributions as che-14 theepidermis.Incontrast,thedistributionsofthethree andpossiblybemutuallyrequiredfortheirlocalization. proteins in sensory organs were overall quite similar to We generated a triple transgenic line expressing func- that observed in control heterozygous animals (Figure tional VHA-5TmRFP, RDY-2TCFP and CHE-14TYFP 7D).Inparticular,wedidnotdetecttheiraccumulationin constructs.Three-dimensionalreconstructionsthrough areas distal to the sheath pocket. Moreover, vha-5(mc38) the head showed that CHE-14 was uniquely present in adultsrescuedbythetraffickingmutanttransgenesvha- socketcells(greenareainFigure7D).Thisobservation, 5(L786S) or vha-5(E830Q) could normally take up DiO alongwiththeabsenceofRDY-2andVHA-5fromseam (data not shown). Together, these data suggest that the cells,indicatesthatCHE-14canworkindependentlyof trafficking function of VHA-5is not essentialinamphid VHA-5 and RDY-2 at least in some cells. We noted that sheathcells. RDY-2wasenrichedintheanterior-andposterior-most VHA-5 and actin microfilaments are jointly reorga- areasoftheamphidsheathcellsurroundingthesheath nized during molting: The finding that VHA-5 is re- pocket compared to CHE-14 or VHA-5 (YZ sections of quired for cuticle formation prompted us to examine Figure 7D); the significance of this enrichment is whether its expression changes during larval molts, as unclear.Wenextlookedatthedistributionofthethree observedformanygenesencodingcuticularproteinsor same transgenes in a weak vha-5 mutant background, proteinsinvolvedintheirprocessing(Johnstone2000; whichwasobtainedbyrescuingthevha-5(mc38)nullmu- Hashmietal.2004;Frandetal.2005;Haoetal.2006). tantwithavha-5transgenecarryingthepointmutation WedidnotseeanymajorchangeinVHA-5abundance L786S.Thismutationaffectsthetraffickingfunctionof duringlarvalstages(notshown);however,wecouldsee VHA-5,causingthefusionproteinandsomecargoesto thatitsdistributionchangedfromrandomlyorganized 718 S.Lie´geoisetal. TABLE2 Mosaic analysissuggests thatvha-5 is requiredfor viability inthe excretorysystemand, toa lesser extent, inthe epidermis Presenceof GFPa Tissue Non-Rdylarvae Class IRdy larvae Class IIRdylarvae Class IIIRdy larvae Excretory cell 1 (cid:2) (cid:2) (cid:2) Excretory ductcell 1 1 (cid:2) (cid:2) Epidermis 1 1 1 (cid:2) No.of larvae .600b 5 14 172 Stage 26hr post-egg laying Mid-L2 Late L1/young L2 Late L1/young L2 Mid-L1 aLarvaesegregatingfromvha-5(mc38);Ex[vha-5Tgfp]transgenicanimalswereexaminedforthepresenceof GFP in theexcretorycell, theexcretory ductcell, andtheepidermis: 1,GFP present; (cid:2),GFPabsent. bAll larvae expressing the GFP in the excretory system reached adulthood, except two that had very short excretory canalsandfilled withfluid inlatelarvaldevelopment. spots at intermolts to aligned spots forming parallel andKolodziej2002).Thisconstruct,whichwasdriven circumferential bands at molts (Figure 8 and data not by the vha-8 promoter, is described as ABDTYFP in shown).Thesecircumferentialbandswerestrikinglyre- Figure 8 (it was validated as an actin-binding protein miniscent of the actin bundles, which disappear after usinganembryonicepidermalpromoter;F.Landmann, molts and reform prior to molts (Costa et al. 1997). C.GallyandM.Labouesse,unpublishedresults).We Interestingly, the V1 sector B- and C-subunits of the could thereby correlate changes in actin organization V-ATPasecanbindactin(Leeetal.1999). with that of a VHA-5TCFP construct. Consistent with TotestwhetherVHA-5distributionmightfollowthat the findings reported by Costa et al. (1997), we ob- ofactin,wegeneratedaprobetovisualizeactininvivo. servedthatactindistributionwasdisorganizedbetween Wefusedthefirst290residuesofthespectraplakinVAB- molts and started to form parallel circumferential 10toYFP(Bosheretal.2003),sincethecorresponding filamentsslightlybeforemolts(Figure8).VHA-5distri- domaininhumanandDrosophilaVAB-10homologsisa bution did not correlate with actin between molts, well-definedactin-bindingdomain(Sunetal.2001;Lee although we assume that the randomly distributed Figure6.—Cell-autonomousactivityofvha-5in the epidermis. (A) Dissection of the vha-5 pro- moter.Eachlinedepictsthepromotersequence (thick line) present upstream from the VHA-5 andGFPcodingregions.Expression(1),absence ((cid:2)),orweakexpression(parentheses)oftheGFP intissueswhereitisnormallyexpressedwereas- sayed:Sup,supportcells;Exc,excretorycell;larval Hyp,larvalepidermis;adultHyp,adultepidermis; Ut, uterus; Rec, rectum. (B and C) GFP fluores- cence(left),SEM(middle),andTEM(right)mi- crographsofavha-5(mc38)animalrescuedbythe controlvha-5Tgfptransgene(pML670,notedvha- 5;Ex[1])orbythepromoterdeletionconstruct thatabrogatesGFPexpressionintheadultepider- mis(notedvha-5;Ex[DHyp]).NoteinBthepunc- tate GFP expression in the epidermis (left), the regularannulae(arrowheadinSEM),andthenor- mal alae (arrow in SEM and TEM); conversely, noteinCtheabsenceofGFPexpressionintheepi- dermis(left),thedisruptedannulae(arrowhead in SEM), the flat alae (arrow in TEM), and the large vacuoles causing an apparent detachment between the epidermis and the cuticule (solid arrows).Bars,5mm.