Logout succeed
Logout succeed. See you again!

HESPERIDIN, A PLANT FLAVONOID ACCELERATED THE CUTANEOUS WOUND HEALING IN ... PDF
Preview HESPERIDIN, A PLANT FLAVONOID ACCELERATED THE CUTANEOUS WOUND HEALING IN ...
EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Original article: HESPERIDIN, A PLANT FLAVONOID ACCELERATED THE CUTANEOUS WOUND HEALING IN STREPTOZOTOCIN-INDUCED DIABETIC RATS: ROLE OF TGF-Β/SMADS AND ANG-1/TIE-2 SIGNALING PATHWAYS Wenbin Li1, Amit D. Kandhare2,3*, Anwesha A. Mukherjee2, Subhash L. Bodhankar2 1 Department of Dermatology, Shaanxi Traditional Chinese Medicine Hospital, Xi’an, Shaanxi, 710003, China 2 Department of Pharmacology, Poona College of Pharmacy, Bharati Vidyapeeth Deemed University, Erandwane, Paud Road, Pune-411 038, India 3 Jalan Universiti Bandar Barat, 31900, Kampar, Perak, Malaysia * Corresponding author: Dr. Amit D. Kandhare, Department of Pharmacology, Poona College of Pharmacy, Bharati Vidyapeeth Deemed University, Erandwane, Paud Road, Pune-411 038, India, E-mail: [email protected] http://dx.doi.org/10.17179/excli2018-1036 This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/). ABSTRACT Background: Delayed wound healing is a diverse, multifactorial, complex and inter-related complication of dia- betes resulting in significant clinical morbidity. Hesperidin possesses potent antidiabetic and wound healing ac- tivity. Aim: To evaluate the potential of hesperidin against experimentally induced diabetes foot ulcers. Methods: Diabetes was induced experimentally by streptozotocin (STZ, 55 mg/kg, i.p.) in Sprague Dawley rats (180-220 g) and wounds were created on the dorsal surface of the hind paw of rats. Hesperidin (25, 50 and 100 mg/kg, p.o.) was administered for 21 days after wound stabilization. Various biochemical, molecular and histo- pathological parameters were evaluated in wound tissue. Results: STZ-induced decrease in body weight and increase in blood glucose, food, and water intake was signifi- cantly (p < 0.05) inhibited by hesperidin (50 and 100 mg/kg) treatment. It showed a significant increase (p < 0.05) in percent wound closure and serum insulin level. The STZ-induced decrease in SOD and GSH level, as well as elevated MDA and NO levels, were significantly (p < 0.05) attenuated by hesperidin (50 and 100 mg/kg) treatment. Intraperitoneal administration of STZ caused significant down-regulation in VEGF-c, Ang-1, Tie-2, TGF-β and Smad 2/3 mRNA expression in wound tissues whereas hesperidin (50 and 100 mg/kg) treatment showed signifi- cant up-regulation in these mRNA expressions. STZ-induced alteration in would architecture was also attenuated by hesperidin (50 and 100 mg/kg) treatment. Conclusion: Together, treatment with hesperidin accelerate angiogenesis and vasculogenesis via up-regulation of VEGF-c, Ang-1/Tie-2, TGF-β and Smad-2/3 mRNA expression to enhance wound healing in chronic diabetic foot ulcers. Keywords: diabetic foot ulcer, hesperidin, VEGF-c, Ang-1, Tie-2, TGF-β, Smad 2/3 Abbreviations: Angiopoietin-1 (Ang-1), Diabetes mellitus (DM), Diabetic wound control (DWC), Hematoxylin and Eosin (H&E), Lipid peroxidation (MDA), Nitric oxide (NO), Normal non-diabetic (ND), Normal wound control (NWC), Reactive oxygen species (ROS), Reduced glutathione (GSH), Reverse Transcriptase Polymerase Chain Reaction (RT-PCR), Standard Error of Mean (SEM), Streptozotocin (STZ), Superoxide dismutase (SOD), Transforming growth factor-β (TGF-β), Tumor necrosis factor-α (TNF-α), Vascular endothelial growth factor (VEGF-c) 399 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 INTRODUCTION wound-healing process (Adil et al., 2017b, d; Bajpai et al., 2009; Vijay et al., 2009). Fur- Diabetes mellitus is a complex metabolic thermore, increased apoptosis signaling and disorder affecting 171 million people world- abnormal expression of some gap junction wide, and this number is projected to reach proteins, i.e., connexins also delayed the 366 million by 2030 (Adil et al., 2017a, d; wound-healing process (Clark, 2008). Nu- World Health Organization, 2016). Improper merous scientific reviews and studies demon- control of diabetes mellitus leads to an array strate that inhibited production of transform- of macro- and microvascular complications ing growth factor-β, insulin-like growth fac- such as cardiomyopathy, encephalopathy, tor-1 and vascular endothelial growth factor neuropathy, nephropathy, retinopathy and resulted in delayed wound healing in diabetes foot ulcer (Badole et al., 2015; Ghule et al., mellitus (Perez Gutierrez and Vargas, 2006; 2015; Nathan, 1993; Visnagri et al., 2014). Teoh et al., 2009). Diabetic neuropathy is the main risk factor as- In spite of tremendous advances in the sociated with a diabetic foot ulcer, and this ul- pharmaceutical drug industry, the treatments cer is a serious problem in clinical practice for diabetic wound ulcer have not progressed (Kandhare et al., 2012c; Rafehi et al., 2011). substantially in recent years. Nowadays, the It has been reported that amongst the diabetic approved the therapeutic implication for the patients 15 % will develop foot ulceration and treatment of diabetic foot ulcers are growth wounds moreover 3 % of them will need am- factor and cell therapies. However, their high putation of a lower limb (Al-Watban et al., cost and unwanted side effects limit their util- 2007). ity in the management of chronic wounds Normal wound healing is a well-orches- (Barrientos et al., 2014; Kandhare et al., trated process characterized by four distinct 2017a). Furthermore, as diabetic foot ulcer is inter-related phases including hemostasis, in- a complex and multi-event clinical problem flammation, proliferation, and remodeling hence, it cannot be treated by single means, (Diegelmann and Evans, 2004; Patil et al., and there is a need of co-adjuvant therapies 2011). Coordination between various cells, such as antidiabetic and antibiotics for glyce- local release of growth factors and cytokines mic and infection control. Moreover, it also influence the rate of wound repair whereas needed daily wound care such as antiseptic disruption in this cycle leads to delayed bath as well as debridement and toe removal wound healing (Goswami et al., 2016; Shukla for gangrene depending upon need. Hence, et al., 1997). Diabetes mellitus is well known, there is an urge to the pursuit of new thera- and major contributors to delayed or impaired peutic agents for the treatment of non-healing wound healing resulted in chronic ulcer for- diabetic foot ulcers. mation. Several lines of studies suggested pe- An array of compounds derived from ripheral neuropathy and microvascular dis- natural plants (such as triterpenes, alkaloids, eases are the vital factors that are delayed flavonoids) receives increasing acceptance wound healing in diabetic condition (Ghosh et (Kandhare et al., 2016b; Paocharoen, 2010) al., 2012; Mustoe, 2004; Shivakumar et al., due to non-toxic nature as well as they have 2014). an ability to influence one or more wound Delayed wound healing exists with un- healing phases (Panchatcharam et al., 2006; known etiology, and its underlying mecha- Sumitra et al., 2005). In the light of the exper- nisms are not yet completely understood. imental evidence, it is documented that novel However, elevated oxidative stress, delayed herbal moieties contain numerous phytocon- collagen synthesis, decreased angiogenesis, stituents that can be explored to the impaired epithelialization and glucose management of chronic wounds. A large metabolism, fibroblast and endothelial cell number of the popularly used ayurvedic dysfunction has been reported as a vital plants have not been scientifically examined pathophysiological factor in delaying the 400 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 for their efficacy and anti-diabetic properties vestigation to evaluate the potential of admin- (Patel et al., 2012). Furthermore, literature has istration of hesperidin against experimentally indicated that animal models of impaired induced diabetes foot ulcers. healing may have greater clinical relevance (Kandhare et al., 2014; Nunan et al., 2014) MATERIAL AND METHOD and played a vital role in the scientific evalu- Animals ation of these unexplored moieties from the Adult Sprague Dawley rats (male, 180- herbal origin. Since delayed diabetic wound 220 g) were obtained from the National Insti- healing is composite of multiple factors in- tute of Biosciences, Pune (India). Rats were cluding impaired glycemic control, peripheral housed at 24 ± 1 °C, with a relative humidity neuropathy, and lowered immunity against in- of 45–55 % and 12:12 h dark/light cycle. The fections hence, Streptozotocin (STZ)-induced animals had free access to standard pellet diabetic wound is an ideal model that repre- chow (Pranav Agro Industries Ltd., Sangli, sents these clinicopathological features of di- India) and filtered water throughout the ex- abetic foot ulcer (Kandhare et al., 2011). perimental protocol. All experiments were Hesperidin (hesperetin-7-rhamnogluco- carried out between 09:00 and 17:00 h. The side) is a major plant flavonoid abundantly experiment was conducted according to the present in a variety of citrus species including guidelines of Committee for Control and Su- Citrus aurantium L., C. sinensis, C. unshiu pervision of Experimentation on Animals (Rutaceae) (Emim et al., 1994; Kawaguchi et (CPCSEA), Government of India on animal al., 1997). Studies have shown hesperidin experimentation. have many biological functions, including anti-diabetic, antihyperlipidemic, anti-ulcers, Chemicals anti-inflammatory, anti-microbial, analgesic, Hesperidin and Streptozotocin (Sigma antifungal, hepatoprotective, antioxidant, Chemical Co., St Louis, MO, USA), Total antiallergic, anti-cancer, anti-hypertensive RNA Extraction kit (MP Biomedicals India and anti-atherogenic potential (Akiyama et Private Limited, India) and One-step Reverse al., 2010; Jin et al., 2008; Kandhare et al., transcription-polymerase chain reaction (RT- 2017b; Kaur et al., 2006; Kawaguchi et al., PCR) kit (MP Biomedicals India Private 1997; Lee et al., 2004; Nandakumar et al., Limited, India), GOD ‐ POD (glucose 2011; Shah and Patel, 2010; Shi et al., 2012). oxidase-peroxidase) diagnostic kit (Accurex There is a report indicating that hesperidin Biomedical Pvt. Ltd., Mumbai, India) were ameliorates sodium arsenite-induced toxicity procured from respective manufacturer. in rats (Pires Das Neves et al., 2004). Recently, the wound healing potential of Induction and assessment of diabetes hesperidin has been proven in experimental Diabetes was induced by intraperitoneal animal models and clinical trials (Ahmad et administration of streptozotocin (STZ, 55 al., 2013; Godeberge, 1994; Hasanoglu et al., mg/kg) in citrate buffer (pH 4.4, 0.1 M) 2001; Struckmann and Nicolaides, 1994). The (Visnagri et al., 2012). A separate group of role of hesperidin in diabetes-induced compli- age‐matched control rats were also main- cation such as diabetic nephropathy, neuropa- tained which received an equal volume of cit- thy, cardiomyopathy, and encephalopathy rate buffer. Retro-orbital plexus technique have been proven effectively (Ibrahim, 2008; was used to collect the blood samples, and Shah and Patel, 2010). To best of our GOD‐POD was used to estimate serum glu- knowledge, no study has been carried out that cose levels. Rats having serum glucose levels evaluated the effect of hesperidin in the more than 250 mg/dL were selected as dia- diabetic wound. Hence, the aim of present in- betic and used for the present study. 401 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Excision wound model (Fuji, S20 Pro, Japan) by an observer blind to Excision diabetic foot ulcer was created the treatment. The metabolic cages (Techni- according to the previously established plast, Italy) were used to determine food in- method (Kandhare et al., 2014). Briefly, on take and water intake. the day of wound creation, each rat was anes- After 22 days, rats were anesthetized thetized with ketamine (75 mg/kg, i.p.) and under etheral anasthesia and blood was with- xylazine (10 mg/kg, i.p.). The rectangular drawn by a retro-orbital puncture for determi- wound (2 mm × 5 mm) was created on the nation of serum parameters. Then, animals dorsal surface of the foot of each rat. The rats were sacrificed by cervical dislocation and were randomly divided into various experi- wound tissues were rapidly removed and mental groups. stored at -80 °C for biochemical parameters. Experimental design Measurement of the wound area, calcula- After wound creation, rats were divided tion of wound contraction and determina- into following experimental groups (n=6, tion of half-closure time (CT50) each): On day various days including 4, 8, 12, 16 A. Non-diabetic and non-wounded animals and 21, the progressive changes in wound Group I: Normal non-diabetic (ND): area were recorded using camera (Fuji, S20 non-diabetic animals without wound re- Pro, Japan). Then, the wound area was ceived double distilled water (10 mg/kg, determined using image analysis software p.o.) for 21 days. (Image J, NIH, USA). B. Non-diabetic and wounded animals The percent (%) wound closure was Group II: Normal wound control calculated by following formula: % Wound (NWC): non-diabetic animals with wound closure = 100 * [(Initial wound area) – (Nth received a single injection of citrate buffer day wound area)/ (Initial wound area)]. (vehicle), and then double distilled water The graph of percent wound closure ver- (10 mg/kg, p.o.) for 21 days. sus time in days from wound creation was C. Diabetic and wounded animals plotted using the software GraphPad Prism Group III: Diabetic wound control v5.0, and linear regression analysis was (DWC): diabetic animals with wound re- performed. The value of X corresponds to ceived double distilled water (10 mg/kg, Y=50 % was consider as CT50 (half-closure p.o.) for 21 days. time, the time taken to close the wound by Group IV: Hesperidin (H (25)): diabetic 50 %). animals with wound received hesperidin (25 mg/kg, p.o.) for 21 days. Determination of serum insulin Group V: Hesperidin (H (50)): diabetic The serum was separated by centrifuga- animals with wound received hesperidin tion (4 °C, 5200 g, 15 min) using Eppendorf (50 mg/kg, p.o.) for 21 days. Cryocentrifuge (model No. 5810, Germany). Group VI: Hesperidin (H (100)): diabetic The assay of serum insulin was performed by animals with wound received hesperidin a rat ELISA (enzyme-linked immunosorbent (100 mg/kg, p.o.) for 21 days. assay) kit (Mercodia AB, Uppsala, Sweden). Group VII: Insulin (I (10)): diabetic ani- mals with wound received insulin (10 Biochemical estimations IU/kg, s.c.) for 21 days. Preparation of tissue homogenate Every day the three different dosages of Skin tissue segments were weight and hesperidin, i.e., 25, 50 and 100 mg/kg were mixed with 0.1 M phosphate buffer (pH 7.4) freshly and administered to animals for 21 and homogenized on ice for 60 seconds at days. On various days, the wound area was 10600 g (Remi Equipment Pvt. Ltd., Remi determined with the help of digital camera 402 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Motors Ltd., Mumbai, India). Supernatant of band intensities were compared with constitu- tissue homogenates was used to determine tively expressed β-actin which served as a superoxide dismutase (SOD), reduced control for sample loading and integrity. The glutathione (GSH), lipid peroxidation intensity of mRNAs was standardized against (MDA), nitric oxide (NO), and that of the β-actin mRNA from each sample, hydroxyproline content as described and the results were expressed as PCR-prod- previously (Adil et al., 2016b; Honmore et al., uct/β-actin mRNA ratio. 2015; Kandhare et al., 2012a,b, 2013, 2015d; Mohod et al., 2016; Mukherjee et al., 2015). Histopathological examination Another portion of skin tissue was stored Reverse transcriptase PCR analysis of in 10 % formalin for 24 h. The specimen was VEGF-c, Ang-1, Tie-2, TGF-β and Smad dehydrated and placed in xylene for 1 h (3 2/3 mRNA expression times) and later in ethyl alcohol (70, 90 and The reverse transcription (RT)-PCR used 100 %) for 2 h respectively. The infiltration to determine mRNA levels in skin tissue (Adil and impregnation were carried out by treating et al., 2016a; Kandhare et al., 2013, 2015c; with paraffin wax twice, each time for 1 h. Mohod et al., 2016). Briefly, total RNA was Tissue specimens were cut into sections of 3- extracted from skin tissues according to the 5 µm thickness and were stained with hema- manufacturer's instructions (MP Biomedicals toxylin and eosin (H&E). The specimen was India Private Limited, India). The polymerase mounted on the slide by use of DPX (distrene, chain reaction mixture was amplified in a with dibutyl phthalate and xylene) as mount- DNA thermal cycler (Eppendorf India Ltd, ing medium. Sections were examined under a Chennai, India) by using gene-specific pri- light microscope to obtain a general impres- mers (Table 1). PCR products were run on sion of the histopathology features of speci- 1 % agarose gel, stained with ethidium bro- men and infiltration of cells. The various mide. Gene expression was assessed by gen- changes in histological features were graded erating densitometry data for band intensities as Grade 0 (not present); Grade 1 (mild); in different sets of experiments, by analyzing Grade 2 (moderate); and Grade 3 (severe) as the gel images on the Image J program (Ver- described previously (Patil et al., 2012c). sion 1.33, Wayne Rasband, National Insti- tutes of Health, Bethesda, MD, USA). The Table 1: Primer sequences for VEGF-c, Ang-1, Tie-2, TGF-β, Smad 2/3, and β-actin Sr. Gene Sequence Size No. Forward primer Reverse primer (bp) 1 VEGF-c CCCTGATGAGATCGAG- ACCGCCTCGGCTTGTCAC 210 TACATCTT 2 Ang-1 GCTGGCAGTACAATGACAGT GTATCTGGGCCATCTCCGAC 512 3 Tie-2 ATTGACGTGAAGATCAA- ATCCGGATTGTTTTT- 375 GAATGCCACC GGCCTTCCTGTT 4 TGF-β GTTCTTCAATACGTCAGA- CATTATCTTTGCTGTCACAAGAGC 309 CATTCG 5 Smad- AGCACACAATAACTTGGACC TAAGACACACTGGAACAGCG- 368 2/3 GATG 6 β-actin GTCACCCACAC- ACAGAGTACTTGCGCTCAGGAG 764 TGTGCCCATCT 403 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Statistical analysis control rats after intraperitoneal administra- Data are expressed as mean ± standard er- tion of STZ. Treatment with hesperidin (50 ror mean (SEM). Data analysis was per- and 100 mg/kg) significantly (p < 0.05) re- formed using Graph Pad Prism 5.0 software duced the food and water intake when com- (Graph Pad, San Diego, CA, USA). Data of pared with diabetic wound control rats. Dia- wound area and percentage wound closure betes-induced increase in food and water in- were analyzed using two-way repeated take was also significantly (p < 0.05) reduced analysis of variance (ANOVA), and by insulin treatment (10 IU/kg) when com- Bonferroni’s multiple range test was applied pared with diabetic wound control rats. for post hoc analysis, while data of Insulin (10 IU/kg) treatment showed more biochemical parameters were analyzed using significant (p < 0.05) improvement to the one-way analysis of variance (ANOVA), and altered food and water intake as compared to Tukey’s multiple range test was applied for hesperidin (25 and 50 mg/kg) treated rats post hoc analysis. A value of p < 0.05 was (Table 2). considered to be statistically significant. Effect of hesperidin and insulin treatment RESULTS on rate of wound contraction and CT50 of diabetic rats Effect of hesperidin and insulin treatment The effect of hesperidin and insulin treat- on body weight, serum glucose level and ment on the morphology of various stages of serum insulin of diabetic rats wound healing is shown in Figure 1. Diabetic There was a significant decrease (p < wound control rats showed a higher wound 0.05) in body weight and serum insulin level area where the rate of wound contraction was whereas an increase in serum glucose level of lower over a period of 21 days. The wound vehicle control rats after induction of diabetes area was significantly decreased (p < 0.05), by intraperitoneal administration of STZ. and the rate of wound contraction was signif- Treatment with hesperidin (50 and 100 mg/ icantly (p < 0.05) increased by hesperidin (50 kg) significantly (p < 0.05) inhibit STZ-in- and 100 mg/kg) treatment when compared duced decreased in body weight and serum in- with diabetic wound control rats. The wound sulin level as compared to diabetic wound area and rate of wound contraction were also control. An elevated level of serum glucose significantly ameliorated (p < 0.05) by treat- level also significantly (p < 0.05) decreased ment with insulin (10 IU/kg) as compared to by hesperidin (50 and 100 mg/kg) as com- diabetic wound control rats (Table 2). Fur- pared to diabetic wound control (Table 2). thermore, the rate of wound contraction was Administration of insulin (10 IU/kg) also sig- significantly higher (p < 0.05) in hesperidin nificant (p < 0.05) increased body weight and (100 mg/kg) treated rats as compared to insu- serum insulin level whereas significantly de- lin (10 IU/kg) treated rats (Table 2). creased (p < 0.05) serum glucose level as The CT50 value for diabetic wound con- compared to diabetic wound control. Insulin trol rats was -272.6 days (negative sign indi- (10 IU/kg) also showed more significant de- cated delayed wound healing). CT50 value crease (p < 0.05) in serum glucose level and for the combination of hesperidin (25, 50 and significant increase (p < 0.05) in serum insu- 100 mg/kg) treated rats was 67.95, 22.78 and lin level as compared to hesperidin (25, 50 13.78 days respectively whereas, CT50 val- and 100 mg/kg) treatment (Table 2). ues for insulin (10 IU/kg) treated rats was 21.77 days (Table 2). Effect of hesperidin and insulin treatment on food and water intake of diabetic rats The food and water intake were increased significantly (p < 0.05) in diabetic wound 404 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Table 2: Effect of hesperidin and insulin treatment on body weight, serum glucose level, food intake, water intake, serum insulin and CT50 of diabetic rats Treatment Body Weight (gm) Serum Glucose Food Intake (gm) Water Intake (ml) Serum Insulin % Wound Closure CT50 Level (mg/dL) (mg/L) (at day 21) (days) Normal 195.83 ± 4.79 285.36 ± 9.50 46.55 ± 2.15 68.62 ± 4.22 2.68 ± 0.12 --- --- NWC 185.50 ± 4.04& 288.38 ± 12.97 48.12 ± 4.45& 64.62 ± 4.79& 2.71 ± 0.33 29.45 ± 10.22 25.78 DWC 165.17 ± 2.37# 331.38 ± 11.75# 72.13 ± 2.56# 120.45 ± 8.12# 0.52 ± 0.21# -22.35 ± 8.44# -263.0 I (10) 200.17 ± 3.51*,$ 285.01 ± 16.34*,$ 35.22 ± 3.19*,$ 48.12 ± 4.11*,$ 2.59 ± 0.86*,$ 50.33 ± 11.22*,$ 19.77 H (25) 173.33 ± 2.01 319.28 ± 9.29 64.50 ± 3.12 112.63 ± 4.23 0.89 ± 0.21 15.55 ± 4.23 77.95 H (50) 192.67 ± 4.53*,$ 294.62 ± 15.24*,$ 52.12 ± 4.73*,$ 95.12 ± 2.01*,$ 1.56 ± 0.56*,$ 45.28 ± 12.33*,$ 68.78 H (100) 195.67 ± 2.99*,$ 289.18 ± 2.50 50.62 ± 3.47*,$ 88.70 ± 3.77*,$ 2.34 ± 0.98*,$ 96.77 ± 18.54*,$ 52.78 Data are expressed as mean ± SEM (n = 6) and analyzed by one-way ANOVA followed by Tukey's multiple range test for each parameter separately. &p < 0.05 as compared to normal, #p < 0.05 as compared to normal wound control, *p < 0.05 as compared to diabetic wound control group and $p < 0.05 as compared to one another. NWC: Normal wound control group; DWC: Diabetic wound control group; I (10): Insulin (10 IU/kg, s.c.) treated group; H (25): Hesperidin (25 mg/kg, p.o.) treated group; H (50): Hesperidin (50 mg/kg, p.o.) treated group; H (100): Hesperidin (100 mg/kg, p.o.) treated group; CT50: Time at which 50 % of the cutaneous wound was closed. The negative sign in CT50 value indicated delayed wound healing. 405 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Figure 1: Morphological representation of rat paws showing various phases of wound healing 406 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Effect of hesperidin and insulin treatment (10 IU/kg) treatment also significantly inhib- on the oxido-nitrosative stress of diabetic ited (p < 0.05) STZ-induced down-regulation rats in VEGF-c, Ang-1, Tie-2, TGF-β and Smad The SOD and GSH levels decreased sig- 2/3 mRNA expression as compared to dia- nificantly (p < 0.05) and MDA and NO levels betic wound control rats. There was a signifi- increased significantly (p < 0.05) in normal cant (p < 0.05) up-regulation in VEGF-c, Tie- wound control rats and diabetic wound con- 2, TGF-β and Smad 2/3 mRNA expression in trol rats. Treatment with hesperidin (50 and the hesperidin (100 mg/kg) treated group as 100 mg/kg) significantly (p < 0.05) reduced compared to insulin (10 IU/kg) treated rats diabetes-induced alterations in oxido-nitrosa- (Figure 2). tive stress when compared with diabetic wound control rats. Insulin treatment (10 Effect of hesperidin and insulin treatment IU/kg) also significantly (p < 0.05) inhibited on diabetes-induced histopathological diabetes-induced alteration in SOD, GSH, alterations in skin tissue of diabetic rats MDA and NO levels as compared to diabetic Figure 3A represented the normal archi- wound control rats (Table 3). tecture of normal tissue from normal control rats. It showed the presence of vessels, epithe- lial layer with few polymorphonuclear leuko- Effect of hesperidin and insulin treatment cyte infiltrations (red arrow, grade 1). Figure on hydroxyproline level of diabetic rats 3B showed the distorted architecture of skin Diabetic wound control rats showed sig- from normal wound control rats. Wound tis- nificant (p < 0.05) decrease in hydroxyproline sue from diabetic control rats showed the level as compared to normal wound control as presence of ectopic vessels with edema along well as normal control rats. When compared with polymorphonuclear leukocyte infiltra- with diabetic wound control rats, hesperidin tion (red arrow, grade 4). It also showed (50 and 100 mg/kg) treatment significantly (p thicker epithelial layer and disorganized fi- < 0.05) increased hydroxyproline level. Hy- broblasts (Figure 3C). Skin tissue from insu- droxyproline level also significantly (p < lin (10 IU/kg) treated rats showed well-orga- 0.05) increased by treatment with insulin (10 nized dermal layers with decreased polymor- IU/kg) as compared with diabetic wound con- phonuclear leukocyte infiltration (red arrow, trol rats. When compared with insulin (10 grade 2) with re-epithelialization (yellow ar- IU/kg) treatment, hesperidin (50 and 100 row, grade 3) and new vessels formation mg/kg) treated rats showed significantly (black arrow, grade 3) (Figure 3D). Wound higher (p < 0.05) hydroxyproline level (Table tissue from the hesperidin (25 mg/kg) treated 3). rats demonstrated incomplete epithelializa- tion (grade 1), lesser number new vessels Effect of hesperidin and insulin treatment (grade 1), and polymorphonuclear leukocyte on VEGF-c, Ang-1, Tie-2, TGF-β and infiltration (grade 3) (Figure 3E). Histo- Smad 2/3 mRNA expression in wound skin pathology of wound skin from hesperidin (50 tissue of diabetic rats and 100 mg/kg) treated rats revealed an in- There was down-regulation in VEGF-c, creased number of blood vessels (grade 3), re- Ang-1, Tie-2, TGF-β and Smad 2/3 mRNA epithelialization (grade 3) with mild polymor- expression in skin tissue of normal wound phonuclear leukocyte infiltration (grade 1) control rats as well as diabetic wound control (Figure 3F and Figure 3G, respectively) (Ta- rats. The mRNA expression of VEGF-c, Ang- ble 4). 1, Tie-2, TGF-β and Smad 2/3 were up- regulated significantly (p < 0.05) in hesperi- din (50 and 100 mg/kg) treatment when com- pared to diabetic wound control rats. Insulin 407 EXCLI Journal 2018;17:399-419 – ISSN 1611-2156 Received: January 07, 2018, accepted: March 28, 2018, published: May 04, 2018 Table 3: Effect of hesperidin and insulin treatment on the oxido-nitrosative stress and hydroxyproline level of diabetic rats Treatment SOD GSH MDA NO Hydroxyproline (U/mg of protein) (µg/mg of protein) (nM/mg of protein) (µg/mL) (µg/mg tissue) Normal 8.67 ± 0.49 6.27 ± 0.74 6.14 ± 0.7 14.76 ± 2.29 4.42 ± 0.44 NWC 4.12 ± 0.75& 2.52 ± 0.18& 15.26 ± 0.74& 34.4 ± 3.92& 1.5 ± 0.19& DWC 2.22 ± 0.38# 1.99 ± 0.2# 21.06 ± 0.64# 58.05 ± 2.66# 0.99 ± 0.16# I (10) 7.38 ± 0.37*,$ 5.61 ± 0.72*,$ 8.76 ± 0.35*,$ 48.23 ± 3.26*,$ 2.09 ± 0.41*,$ H (25) 3.74 ± 0.44 2.21 ± 0.17 19.63 ± 0.94 51.7 ± 4.78 1.05 ± 0.14 H (50) 5.75 ± 0.51*,$ 3.83 ± 0.35*,$ 15.59 ± 1.44*,$ 42.36 ± 4.16*,$ 2.48 ± 0.33*,$ H (100) 6.39 ± 0.53*,$ 4.99 ± 0.41*,$ 11.3 ± 1.1*,$ 33.34 ± 2.98*,$ 3.12 ± 0.48*,$ Data are expressed as mean ± SEM (n = 4) and analyzed by one-way ANOVA followed by Tukey's multiple range test for each parameter separately. &p < 0.05 as compared to normal, #p < 0.05 as compared to normal wound control, *p < 0.05 as compared to diabetic wound control group and $p < 0.05 as compared to one another. NWC: Normal wound control group; DWC: Diabetic wound control group; I (10): Insulin (10 IU/kg, s.c.) treated group; H (25): Hesperidin (25 mg/kg, p.o.) treated group; H (50): Hesperidin (50 mg/kg, p.o.) treated group; H (100): Hesperidin (100 mg/kg, p.o.) treated group; SOD: Superoxide Dismutase; GSH: Reduced Glutathione; MDA: Malondialdehyde; NO: Nitric Oxide. Table 4: Effect of hesperidin and insulin treatment on wound healing processes and healing phases of diabetic rats Treatment Epithelization Polymorphonuclear Leukocyte Fibroblasts New vessels Normal ++++ + ++++ ++++ NWC + +++ ++ + DWC + ++++ + - I (10) +++ ++ ++ +++ H (25) + +++ + + H (50) ++ ++ +++ ++ H (100) ++++ + +++ +++ NWC: Normal wound control group; DWC: Diabetic wound control group; I (10): Insulin (10 IU/kg, s.c.) treated group; H (25): Hesperidin (25 mg/kg, p.o.) treated group; H (50): Hesperidin (50 mg/kg, p.o.) treated group; H (100): Hesperidin (100 mg/kg, p.o.) treated group. Note: 0: no abnormality detected; +: damage/active changes up to less than 25 %; ++: damage/active changes up to less than 50 %; +++: damage/active changes up to less 75 %; ++++: damage/active changes up to more than 75 % 408