Logout succeed
Logout succeed. See you again!

High mitochondrial sequence divergence meets morphological bioacoustic conservatism: Boophis quasiboehmei sp. n., a new treefrog species from south-eastern Madagascar PDF
Preview High mitochondrial sequence divergence meets morphological bioacoustic conservatism: Boophis quasiboehmei sp. n., a new treefrog species from south-eastern Madagascar
Bonn zoological Bulletin Volume 57 Issue 2 pp. 241-255 Bonn, November 2010 High mitochondrial sequence divergence meets morphological and bioacoustic conservatism: Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar Miguel Vences l Jorn Kohler 2 Angelica Crottini 13 & Frank Glaw 4 , , 1 Division ofEvolutionary Biology, Zoological Institute, Technical University ofBraunschweig, Spielmannstr. 8, D-38106 Braunschweig, Germany; E-mail: [email protected] 2 Department ofNatural History - Zoology, Hessisches Landesmuseum Darmstadt, Friedensplatz 1, D-64283 Darmstadt, Germany 3 Sezione di Zoologia e Citologia, Dipartimento di Biologia, Universita degli Studi di Milano, Via Celoria 26, 1-20133 Milano, Italy 4 Zoologische Staatssammlung Munchen, Munchhausenstr. 21, D-81247 Munchen, Germany Abstract. We describe a new species oftreefrog from Madagascar that is highly similar in external adult morphology, bioacoustics and colouration to Boophis boehmeibut differs from this species by a remarkable differentiation in a frag- ment ofthe mitochondrial 16S rRNAgene. Amore detailed analysis revealedthat this differentiation is concordantwith thepattern intwonucleargenes(Ragl andPOMC)whichshownohaplotype sharingofthenewspecieswithB. boehmei, and with a consistent difference in tadpole morphology (third lower row oflabial keratodonts reduced in length in the new species). We concludethatconcordance between these independentcharacters indicates two independent evolution- arylineages that shouldbestbe considered as separate species, despite theirsimilar adultmorphology. The new species, Boophis quasiboehmei sp. n., is so far known only from an area in the southern central east and south-east ofMadagas- car, south ofthe Mangoro river, whileB. boehmei is known only from the area aroundAndasibe north ofthe riverMan- goro. Preliminary data indicate that this group oftreefrogs contains several more cryptic species, and a simple explana- tion assumingthe Mangoro riveras a barrierbeing responsible for divergence between them is likely no longertenable. Key words. Amphibia,Anura, Mantellidae, Boophis boehmei, Boophis quasiboehmei sp. n., Madagascar. INTRODUCTION Treefrogs of the genus Boophis have long been among integration ofbioacoustics into theirtaxonomy has led to Madagascar's less studied amphibians, but intensified an improved understanding ofBoophis species diversity. fieldwork and application ofintegrative taxonomyproto- Together with an initial screening ofmolecular diversity, cols have ledto a steep increase ofknowledge (Blommers- this has led to the description of many new species of Schlosser 1979; Cadle 2003; Glaw & Vences 2007; Glaw Boophis (e.g.,Andreone 1993, 1996;Andreoneetal. 1995; et al. 2010). Many Boophis species call from high posi- Cadle 1995; Glaw & Thiesmeier 1993; Glaw & Vences tions in the vegetation and intensive nocturnal searches 1992, 1994, 1997b, 2002; Glaw et al. 2001, 2010; Koh- & for calling males are needed to find them. Consequently, ler et al. 2007, 2008; Vallan et al. 2003, 2010; Vences many species have been described on the basis of only Glaw 2002, 2005; Vences et al. 2010; Wollenberg et al. small series or even single individuals, and females are 2008) andthe identification ofa large numberofaddition- oftenunknown. Furthermore, many species ofBoophis are al, yetundescribed candidate species (Vieites etal. 2009). known to be morphologically very similar and a diagno- Furthermore, tadpoles of Boophis are among the most sis based on external morphology alone is often unreli- commonly encountered anuran larvae in Malagasy rain- able (Glaw et al. 2001; Vences et al. 2008). However, be- forest streams (Vences et al. 2008), and a large number cause the advertisement calls ofthese species are usual- ofthemhave recentlybeen described (e.g., Raharivololo- ly loud and species-specific (Vences et al. 2006), the niaina et al. 2006; Randrianiaina et al. 2009a, b). Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK 242 Miguel Vences et al. Taking the latest species descriptions into account, the and the newly described species are indeed among the genus Boophis, classified in the endemic Malagasy-Co- morphologically and bioacoustically most cryptic species moroan family Mantellidae, currently comprises 71 de- pairs so far discovered in Madagascar. scribed species. The genus is monophyletic and composed of two main clades that correspond to mainly stream- MATERIALS AND METHODS breeding (subgenus Boophis) and pond-breeding species & (subgenus Sahona), respectively (Glaw Vences 2006, 2007). The stream breeders are further divided into eight Frogs were collected at night by opportunistic searching, phenetic species groups. Most of these species groups usingtorches andhead lamps. Specimens were euthanized probably are monophyletic units although some are not inachlorobutanol solution, fixed in 95% ethanol, andpre- (particularly the Boophis majori group). served in 70% ethanol. Locality information was record- ed with GPS receivers. Specimens were deposited in the The Boophis goudoti species group contains 13 small to collection ofUniversite d'Antananarivo, Departement de large species oflargely arboreal frogs that are mainly dis- BiologieAnimale,Antananarivo (UADBA), Zoologisches tributed in the rainforests and highlands of Madagascar. Forschungsmuseum Alexander Koenig, Bonn (ZFMK), A subgroup of small-sized species is characterized by and the Zoologische Staatssammlung Miinchen (ZSM). colourful eyes, usually with red iris colour and a bluish FGMV, FGZC andZCMVreferto F. Glaw and M. Vences & iris periphery (Glaw Vences 1997a, b). Several ofthese field numbers. Terminology for biogeographic regions of species such as Boophis boehmei, B. burgeri, B. reticula- Madagascar follows Boumans et al. (2007). tus, and B. rufloculis are known to occur at the same lo- cality in the Andasibe region in the northern central east Morphological measurements (in millimetres) were all ofMadagascarand5. reticulatus, B. sp. aff. ruftoculis and done by M. Vences with a digital caliper (precision 0.01 B. sp. aff. boehmei (= B. sp. 8 and B. sp. 16 ofVieites et mm) to the nearest 0.1 mm. Used abbreviations are: SVL al. 2009) in Ranomafana National Park in the southern (snout-vent length), HW (greatest headwidth), HL(head central east. Ofthe various confirmed candidate species length), ED (horizontal eye diameter), END (eye-nostril in the B. goudoti group (Glaw & Vences 2007; Vieites et distance), NSD (nostril-snout tip distance), NND (nos- al. 2009), four have recently been described (or older tril-nostril distance), TD (horizontal tympanum diameter), names were resurrected for them) on the basis ofmolec- TL (tibia length), HAL (hand length), HIL (hindlimb ular, morphological, and/orbioacoustic differences (Glaw length), FOL (foot length), FOTL (foot length including et al. 2010). However, no taxonomic conclusions have so tarsus), FORL (forelimb length), and RHL (relative farbeen drawn forthe two candidate species from the Ra- hindlimb length). Terminology and description scheme nomafana region mentioned above (B. sp. 8 andB. sp. 16), follow Glaw et al. (2010). Webbing formulae follow mainly because oftheir high morphological similarity to Blommers-Schlosser(1979). Statistical analyses wereper- Boophis rufioculis and to B. boehmei, respectively. formed with Statistica software (Statsoft Corp., Tulsa, USA). Boophis boehmei is the smallest species in theB. goudoti group and has been originally described from Andasibe, Vocalizations were recorded in the field using different where it is rather common (Glaw & Vences 1992). Pop- types of tape recorders (Sony WM-D6C, Tensai RCR- ulations from more southern localities, initially allocated 3222) and external microphones (Sennheiser Me-80, Vi- EM to this species (Ranomafana region and Andohahela) vanco 238), and an Edirol R-09 digital recorder with turned out to be genetically highly divergent (Vieites et internal microphones and saved as uncompressed files. al. 2009) and have therefore been considered as Boophis Recordings were sampled (or re-sampled) at 22.05 kHz & sp. aff. boehmei (Glaw Vences 2007) or B. sp. 16 and 16-bit resolution and computer-analysed using the (Vieites et al. 2009), although no reliable morphological software CoolEdit 98. Frequency information was ob- or bioacoustic difference between them had been ob- tained through Fast Fourier Transformation (FFT; width served. The recent discovery ofdifferences in the tadpole 1024 points). Spectrograms were obtained at Hanning labial tooth row arrangements of Boophis boehmei and window function with 256 bands resolution. Temporal Boophis sp. 16 (Randrianiaina et al. 2009b) prompted us measurements are given as range, with mean ± standard to undertake amore detailed comparison. On the basis of deviation in parentheses. Terminology in call descriptions high mitochondrial divergences, consistent differences in follows Kohler (2000). two nuclear genes, constant differences in tadpole mor- phology, and subtle differences in iris colour, we conclude Two different molecular data sets were studied: that the central south-eastern populations indeed consti- tute adistinct species whichwe describe herein asBoophis First, we analyzed sequences of the mitochondrial 16S quasiboehmei. It is howeverworth to notethatB. boehmei rRNA gene of around 500 bp from all Boophis goudoti Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK 1 Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 243 Table 1. Primer sequences and PCR conditions used in the present study. PCR conditions start with temperature (in °C) ofeach step followed by the time in seconds. Gene Primer name Sequence (5' -> 3') Source PCR conditions BDNF BDNFDRV 1 ACCATCCTTTTCCTKACTATGG Vieites et al. (2007) 94(120), [94(20), 57(45), BDNF BDNFDRV 1 CTATCTTCCCCTTTTAATGGTC Vieites et al. (2007) 72(120) 39], 72(600) Ragl AmpF2 ACNGGNMGICARATCTTYCARCC s. Chiari et al. (2004) 94(120), [94(20), 50(50), Ragl AmpR2 GGTGYTTYAACACATCTTCCATYTCRTA s. Chiari et al. (2004) 72(180) x 45], 72 (600) POMC POMCDRVFl ArATGTCArGASCCAYTTYCGCTGGAA Vieites et al. (2007) 95(120), [95(60), 58(60), POMC POMCDRVRl GGCRTTYTTGAAWAGAGTCATTAGWGG Vieites et al. (2007) 72(90) x 35], 72(600) group species and candidate species with reddish iris were edited using CodonCode Aligner (v. 2.0.6, Codon colouras obtained by Vieites et al. (2009), Randrianiaina Code Corporation).All newly determined sequences have et al. (2009b) and StrauB etal. (2010).Afteralignmentand been deposited in GenBank (HQ380132-HQ380172). removal ofincomplete sections at its beginning and end Haplotypes ofPOMC datawere inferredusing the PHASE the data set for analysis had a length of479 bp. Unparti- algorithm (Stephens et al. 2001) implemented in DnaSP tioned Bayesian inference searches were performed. The software (Version 5.10.3; Librado & Rozas 2009). Hap- bestmodel ofevolution (GTR+G) was determinedbyAIC lotype networkreconstruction ofphased sequences ofthe in MrModeltest (Nylander2002). Bayesian analyses were POMC (Fig. 2A) andRagl (Fig. 2B) fragments were per- performed withMrBayes 3.1.2 (Ronquist & Huelsenbeck formed using the software TCS, version 1.21 (Clement et 2003). Tworuns of10 million generations (startedon ran- al. 2000). This software employs the method ofTemple- dom trees) and four incrementally heated Markov chains ton et al. (1992) and it calculates the numberofmutation- (using default heatingvalues) each, samplingthe Markov al steps by which pairwise haplotypes differ, computing chains at intervals of 1000 generations were used. The last the probability ofparsimony forpairwise differences un- 5001 trees were retained post bum-in and summarized to til the probability exceeds 0.95 (no manual adjustment of generate the majority rule consensus tree. threshold was necessary). Second, we used tissue samples offour and one Boophis boehmeifromAndasibe andAn'Ala, respectively, andfour RESULTS and two tissue samples of B. quasiboehmei from Sa- hamalaotra (=Samalaotra) andAmbohitsara (Tsitolakafor- A detailed analysis ofall available 16S rRNA sequences est) fornewly determining DNAsequences ofvarious nu- ofadults and tadpoles assigned to B. boehmei (GenBank clear genes. Toe clips or leg muscle tissue samples (pre- accession numbers GQ904739-GQ904746, served in 95% ethanol) wereused forDNAextraction. To- DQ792470-DQ792471, AY341717, AY848560- tal genomic DNA was extracted from the tissue samples AY848562) and the candidate species B. sp. 16 (sensu usingproteinase Kdigestion (10mg/ml concentration) fol- Vieites et al. 2009) (accession numbers lowed by a standard salt extraction protocol (Bruford et GQ904717-GQ904738, AY848529-AY848536) con- al. 1992). We amplified fragments ofthree genes from the finned that these two forms are genetically highly diver- DNA nuclear (nuDNA): brain-derived neurotrophic fac- gent. Depending on the length ofthe sequence available, tor (BDNF), recombination activating gene 1 (Ragl), and theuncorrectedpairwise distances were between 8.8% and pro-opiomelanocortin (POMC). Standard Polymerase 11.0% (note thatthese values are higherthan the 6.8%re- chain reactions were performed in a final volume of 1 portedbyVieites et al. (2009) because ofdifferent lengths pi and using 0.3 pi each of 10 pmol primer, 0.25 pi ofto- ofthe sequences, with adifferentproportion ofhypervari- mM tal dNTP 10 (Promega), 0.08 pi of 5 U/ml GoTaq, able sites included in the analysis). Next to single substi- and 2.5 pi 5X Green GoTaq Reaction Buffer (Promega). tutions we also detected one major insertion ofseven nu- Primers and detailedPCRconditions areprovided inTable cleotides inthe candidate species which in this extentwas 1. PCRproducts werethenpurifiedthrough QIAquick pu- not present in any ofthe related species ofBoophis (Fig. rificationkit(Qiagen) according to the manufacturer's in- 1 ). Pairwise divergences were 0.0-0.9% within B. struction. Purified PCR templates were sequenced on an boehmei, 0.0-0.5% within specimens ofB. sp. 16 from the automated DNA sequencer (Applied Biosystems ABI Ranomafana region, and 3.6-4.9% between the single 3130XL). Chromatographs were checked and sequences available sequence of B. sp. 16 from Andohahela Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK c ) ) )) 244 Miguel Vences et al. Boophisaxelmeyeri(Tsaratanana-DQ118669) Boophisrufioculis(An'Ala-DQ003334) Boophissp. 41 (Mahasoa-FJ559156) ** Boophissp. 8-aff. rufioculis(Maharira-ZCMV235-AY848535) j Boophissp.8- aff.rufioculis(Antoetra-FAZC 11465-AY848553) \j-Boophissp. 8-aff.rufioculis(Antoetra-FAZC 11451 -AY848551) '-Boophissp.8- aff.rufioculis(Antoetra-FAZC 11452-AY848552) ** [i—j-BBBooooooppphhhiiisssbbsoope.ehh4mm0eei(iM[[aCChaa4a43s3oHaHMM6-63F31J18585889551]]55((S)Saahhaaffiinnaa--PPSSGG431183)) >-Boophisboehmei[Ca43 HM631885](Sahafina-PSG417) ** r Boophisboehmei(Andasibe-LR 167-DQ792471 P-Boophisboehmei(Andasibe-FGMV2001.1206-AY848560) J r-Boophisboehmei(Andasibe-MVTIS2002G39-AY848562) i-Boophisboehmei(Andasibe-LR 145-DQ792470) Boophisboehmei(Andasibe-FGMV2001.1205-AY848559) ** i_ Boophisboehmei(Andasibe- FGMV2001.1205-AY341717) |_Lr-BBoooopphhiissbbooeehhmmeeii((AAnn'dAalsaib-eZC-MMVVT3I5S0280-0G2QG93084-7A4Y48)48561 ** rBoophisboehmei(An'Ala-ZCMV3571 -GQ904746) J uBoophisboehmei(An'Ala-ZCMV3482-GQ904739) ItBoophisboehmei(An'Ala-ZCMV3445-GQ904740) LJL-BBoooopphhiissbbooeehhmmeeii((AAnn''AAllaa--ZZCCMMVV33545558--GGQQ990044774451) Boophisquasiboehmei(Andohahela-FGZC236-AY848529) r Boophisquasiboehmei(Ranomafana-ZCMV324-AY848536) LBoophisquasiboehmei(Ranomafana -ZCMV2690-GQ904734) Boophisquasiboehmei(Ranomafana- FGMV2002.327-AY848534) ft:Boophisquasiboehmei(Ranomafana-ZCMV3624-GQ904729) Boophisquasiboehmei(Ranomafana -ZCMV3634-GQ904731) Boophisquasiboehmei(Ranomafana -ZSM 1153/2007-GQ904725) ** j-Boophisquasiboehmei(Ranomafana- FGMV2002.328 -AY848533) _p-Boophisquasiboehmei(Ranomafana- FGMV2002.324-AY848530) |j—Boophisquasiboehmei(Ranomafana-ZCMV2688-GQ904733) L Boophisquasiboehmei(Ranomafana-ZCMV3767-GQ904728) Boophisquasiboehmei(Ranomafana-FGMV2002.325-AY848531 Boophisquasiboehmei(Ranomafana-ZSM752/2007-GQ904719) Boophisquasiboehmei(Ranomafana-ZSM 1370/2007-GQ904724) 0.1 - Boophisquasiboehmei(Ranomafana-ZSM 1010/2007-GQ904721) Boophisquasiboehmei(Ranomafana-ZCMV4083-GQ904726) Boophisquasiboehmei(Ranomafana-ZCMV3045-FJ559139) j-Boophisquasiboehmei(Ranomafana-FGMV2002.326-AY848532) i- Boophisquasiboehmei(Ambohitsara-ZCMV4937 -GQ904735) j- Boophisquasiboehmei(Ranomafana-ZSM684/2007-GQ904718) U-Boophisquasiboehmei(Ranomafana-ZSM932/2007-GQ904720) uBoophisquasiboehmei(Ranomafana-ZCMV4491 -GQ904717) DQ792471 lataaattaatttttaat|atcc ttaccctHII/ DQ792470 lataaattaatttttaatIatcc TTACCCTilHi AY848562 lataaattaatttttaat|atcc TTACCCTlHI* AY848561 lataaattaatttttaatIat.: TTACCCTlHI/ ,: AY848560 lataaattaatttttaat TTACCCTllH, AY848559 lataaattaatttttaat TTACCCT||||i AY341717 lATAAATTAATTTTTAAT TTACCCTllHi GQ904746 lataaattaatttttaat TTACCCT||||i GQ904745 lataaattaatttttaat TTACCCTlHH GQ904744 lataaaTtaatttttaatgatt TT„CCCT||||i GQ904741 >ataaattaatttttaat#atcc TTACCCT|H|i GQ904740 lataaattaatttttaat|atcc TTACC:CT||||i GQ904739 lataaattaatttttaat|atcc TTACCCTllHi AY848536 lataaattaattttcaat|accc TTACCCTllHi AY848534 iataaattaattttcaat|a|Sc| TTACCCT||||i AY848533 iataaattaattttCaat|accc TTACCCTllHi AY848532 iataaattaattttcaat|accc TTACCCTllHi AY848531 lataaattaattttcaat|ac.c6 TTACCCT||||i AY848530 iataaattaattttcaat|accc TTACCCTHUi AY848529 iataaattaatttc.t:aat|accc TTACCCTllHi Fig. 1. Phylogenetictreeofspeciesandcandidate speciesoftheBoophisgoudotigroupwithrediriscolour,obtainedusingBayesian inference based on DNA sequences ofthe mitochondrial 16S rRNA gene (alignment length 479 bp). Bayesian posterior values >0.95 symbolized by a single asterisk, of0.99-1.00 by two asterisks. For each sequence, locality, voucher number and Genbank number are given in parentheses. Boophis goudoti was used as outgroup (not shown). Note that the deeperphylogenetic relation- ships shown are not reliable due to the limited amount ofsequence information used in the analysis, and according to an unpub- lished multi-gene data set ofK. C. Wollenberg, B. boehmei and B. quasiboehmei are probably sister groups. The alignment in the lower part ofthe figure shows a section ofthe 16S alignment, with sequences ofBoophis boehmei (upper 13 sequences; numbers tothe leftareGenbank accessionnumbers) andBoophis quasiboehmei(lowerseven sequences). The insertion ofsevennucleotides is a synapomoiphy ofall B. quasiboehmei specimens for which a sequence was obtained, and in this extent is lacking also in all other species ofthe B. goudoti group. Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 245 Boophis quasiboehmei Sahamalaotra Ambohitsara Boophis boehmei Andasibe H An'Ala B Fig. 2. Haplotype networks ofthe nuclear POMC (A) and Ragl (B) genes fragments in B. boehmei and B. quasiboehmei, each from two different localities. Haplotypes per each individual were inferred using the Phase algorithm. The networks show com- plete absence ofhaplotype sharing among the two taxa. (AY848529) and those from Ranomafana. Genetically analysis (Fig. 1) included sequences ofall these taxa and identified specimens assigned to B. boehmei were from confirmed the phylogenetic relationships suggested by Andasibe andAn'Ala. Specimens from Sahafina (Gehring Vieites et al. (2009). However, an unpublished analysis DNA et al. 2010) had quite divergent sequences and their based on multiple mitochondrial genes by K.C. Wollen- status is unclarified, but they clustered with B. boehmei berg instead suggestedaprobable sister-group relationship (Fig. 1). Following the scheme suggested by Padial et al. betweenB. boehmeiandB. sp. 16, confirmingthatthe 16S (2010), this populationwas consideredanewunconfirmed rRNAgene alone as usedhere is insufficientto clarifythe candidate speciesBoophis boehmei [Ca43 HM631885] by phylogeny among Boophis species. Altogether, the phy- Gehring et al. (2010). Probably, specimens fromAnkeni- logenetic relationships among all these species require a heny forwhich no molecular data are available belong to much more detailed analysiswhich howeveris beyondthe this species aswell. Specimens assignedtoB. sp. 16 were scope ofthe present paper. from the Ranomafana area (including Ambatovory, Sa- hamalaotra, Imaloka, Kidonavo, Vohiparara) andAmbo- Theresults ofthe mitochondrial markerindicate no orlim- hitsara, as well as fromAndohahela. ited gene flowbetweenB. boehmeiandB. sp. 16. Thisre- sultwas corroboratedbythe analysis oftwo nuclearmark- Besides a simple assessment ofmoleculardivergencesbe- ers (Fig. 2; the conserved BDNF gene showed no varia- POMC tween Boophis sp. 16 andB. boehmei it is also necessary tion). While in (Fig. 2A), the single included to comment on its phylogenetic position. The analysis of An'Ala specimen had a different haplotype not clustering Vieites et al. (2009) placedB. boehmeiwith B. sp. 8 from with those ofAndasibe, in Ragl the haplotypes belong- Ranomafana and B. sp. 40 from Mahasoa forest, and the ing to the two species formed two well-defined clusters clade made upbythese specieswas sistertoB. sp. 16. Our separated from each otherby a minimum ofsix mutation- Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK — > ; i 246 Miguel Vences et al. m m m m tN CN CN CN -3" CN CN CN •st CN in «n Ol in Ol -st Ol Ol Ol rn CN m o m m o -st tN CO ON NO CN NO ON st CN OCN o 00 CN in Ol Oj oo "st NO -st in in st in NO in in st in NO in ON in in in NO NO in in rt in NO in NO CN CN CN O ^t oo oi rn NO r-- 00 V) q rn r- ON oo rn rn — ON q CN m oo q NO m m OO oi CN CN CN CN CN CN CN CN CN >n NO r~ oi oi rn oi oj oi oi rn ri -HJ O CN oON On oNO NO NO Oen ooo ^> oNO On [ oo oo ooo oOO oo On 00 o rn in NO On CN CN oo od oi oi oi oi oi (N tN CN CN CN CN CN CN Ol CN CN CN Ol Ol Ol CN ol CN Ol Ol Ol Ol Ol Ol Ol r OJ i m o m m m 1—1 ^t NO CN to OCN in O NO 00 Orn oo in f in oo Ol oON oON ON in in o•st £ od no NO ON ON OO t> oo m l> oi rn in oi OO 00 00 ON in o*d ON 00 st -st st -st in •* in •st ^t -st NO NO NO NO ^t -st st in in in •st ^t •st ^t in q ID m ON m CN NO st r-- NO rn CN ON roni oo qoi q oo NO ON NO ^t NO ^t 00 5: ON 00 00 00 ON ON ON ON od oo ON od ON ON od On On On On od ON On ON ON o ON CN CN -st o rn q -st CN m ON o Ol l> •st oo oo om q On in rn q CN 00 00 ON oo ON ON NO ON in ^t o-' od 00 ON od od od ON Ol O) Ol Ol Ol e zz CN o NO mq -st q NO m mst ON m NO Ol ON rn r~; rn rn •st CN tN mrn CN NO o- 00 rn rn rn rn rn rn rn m' rn rn rn rn rn rn rn rn rn rn rn rn rn m" Q Z rn •st cn CN •st •st in m NO t-; t-; mq rn m -st en in m q NO "st 1> 00 ^t q oi CN CN CN CN CN CN CN CN CN CN CN rn rn rn oi oi oi oi oi oi oi oi CN oi oi rn O Zw —SJt- —SJ-t- —XI{- m Ol SJ oi CN CN CN CN CN CN oi r-i CN CN rn rn rn oi oi oi oi oi oi oi oi oi oi CN oi Q On On £^s NO —f Q r- r i ON ON ON ON rn rn -st Tt <st •st "st •st -st in in in rn rn •st rn ^t rn m" rn -st -st Tt <st QH c CN q q q CN q CN q m rn ON <t q ON ON 00 oo q q ON q ON ON oi CN CN CN CN CN CN CN oi CN r-i oi rn oi oi oi oi oi oi oi - ON ^t in r- NO ON -st q -st OON CN ON ON CN q NO m NO m q CN oo m ON CN vi in Nt' 33 rn oON 0o0 * oP- in ro- in q NoO oNO o r- 00 NO NoO oNO Or- to~s oj ro- ion oo- in in "st - m o m m Tt oo ooo oNO >n oo © NO r- in oNO NO r- 00 NO rn NO st oo ON ol rn ooo OCNn 0C0N CN oCNd oCNd OCNN m m oCNo oCdN m Cr-N' mr~ 5- -st Tt NOOl oodl Ool~ otdN O0N4 oOld oOdl or-l' oCNd tONN tONN m 2 2 2 2 2 2 2 22 2 2 er( 03 JoO X^0)3 X<0)3 <X«cSa) <-Ca5asO —a X—CJO XT0eCJ33D < X-<C0)aL3) X^1cC33u X<o> >0i0333 iw—00O0333 £ X<tO>osi <XOo>B X<oo>0P3 Sc<0oCL33> 0ao0E33 lk_r+e0i>eH3v> .-00c0oEBt3333- OE C03 «0033 -2aoSaij P4 Pi 1 al Ph H H H H H H ICUChChD-QhD-D-Dh J? Ph Ph Cu &h I I I I P- m in m o- ON 3- rNmonO !OE3-l NmiOn ocl: ooCN CcN m^m~t OoOoll oooOlooN OOilNn mom roNOnON mroo- mmNoO rmr-sn~t oOor-N- S > > > > > > > > > > > 2 2N I I 2o 2a 20 I I I I U i o2 2 u2 2u o2 2u u2 1 1 oOi N N N N N N N N Ph Ph Ph o ON o O NO oon oNO NoO oNO NoO oNO NoO oNO NoO XOIl 1 o•%^sit mN^OoONn mNOUrilO-n UOmNOmOlO ONmJO Oooslt COCCNlNN mooCCCNNN CC•oCslNNf m-Xt- iuUnn on-oM—sooMf ^^ 0^1 OH0C3HON ®^CONN O 0COs4l| ooiO~nl OO^oolltl OoONOllOl OoOOOllOl CCOCoNNNN OmoColN CtOoNln CmoOtNlN iOoonNoo COiooNNnoo oO0rl0- S "I 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 [2 g Zs -CoQ N (N/5 UNh tNin oNn N Nr/3 PN^ PNh N 0N0 PNh tNL< rN/3 cN/5 0N0 0N0 0N0 oNo oNo 0N0 0N0 PNh PNh 0N0 Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 247 # O BBoooopphhiissqbuoaeshimbeoiehmei al steps. Although the nucleardata setrefers to only alim- ited number ofspecimens, the fact that there is no haplo- type sharingbetween the two forms suggests that theyrep- resent independent evolutionary lineages. Nevertheless, these pronounced genetic divergences were contrasted by no or low divergences in adult morpholo- gy andbioacoustics. The calls ofthe two forms were sim- ilar, with no detectable differences (see call descriptions below). In both forms, notes may be combined to short regular series, and intervals between notes are otherwise highly variable and mostly irregular. The temporal and spectral parameters in calls ofboth forms are somewhat variable among populations and individuals, but broadly overlap at inter- and intra-populational level. Even the pulserate within notes, a charactershown tobe evolution- aryhighly dynamic amongcloselyrelated species (e.g. Pa- -2.5 -2.0 -1.5 -1.0 -0.5 0.0 0.5 1.0 1.5 2.0 2.5 3.C dial et al. 2008), is identical in both forms (see analysis PCA Factor 2 below). Inter-note intervals outside ofregular note series furthermore seem to depend on calling motivation ofthe Fig. 3. Scatterplot of individual males ofBoophis boehmei individual male. (filledcircles) andB. quasiboehmei(opencircles) alongthe sec- ond and third factor ofa Principal Component Analysis (Vari- maxnormalizedrotation). ThePCAwasbasedon measurements Aclose examination ofadult morphology yielded no dis- in Table 1. The specimen from Midongy was excluded from crete characters thatwould allow a diagnosis between the analysisbecausethe species identityofthispopulation isnotful- two forms. One subtle difference was detected in adult life ly clarified. A C E F ^^^^^^^^^^^^^ Fig.4. Comparativephotographsoforaldiscsofpreservedtadpoles ofBoophisquasiboehmeisp. n. (top,A-F) andBoophisboehmei (bottom, G-I): (A) ZSM 442/2008, Imaloka; (B-C) ZSM 83-84/2008, Ambohitsara; (D) ZSM 509/2008, Ambatolahy; (E) ZSM 1682/2007, Sahalamaotra; (F) ZSM 443/2008, Imaloka; (G-I) ZSM 1738/2007, 1750/2007, 1779/2007, An'Ala. Note the short third lower (= posterior) keratodont row ofBoophis quasiboehmei sp. n. with only few (or even misssing [D]) keratodonts, and the lessreduced legth ofthis row inB. boehmei(indicatedby white arrows). Inthe tadpoles ofotherspecies oftheBoophisgoudoti group, the third lower keratodont row is more extended than in the two species shown (see Randrianiaina et al. 2009b). Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK 248 Miguel Vences et al. Table 3. Factor loadings, Eigenvalues and percent explained The most convincingdiagnostic charactercomes from tad- variation from a Principal ComponentAnalysis ofmorphome- pole morphology and has been describedin detail by Ran- tric data in Table 2. Factor loadings >0.5 are shown in bold. drianiaina et al. (2009a, b): all tadpoles ofBoophis sp. 16 (from Ranomafana and Ambohitsara; N = 75) examined Factor 1 Factor 2 Factor 3 Factor 4 had a short (or completely absent) third posterior row of labial keratodonts (P3), whereas in B. boehmei (from lo- SVL 0.535637 0.024396 0.278024 0.432915 calitiesAndasibe andAn'Ala) this rowwas slightly short- HW 0.401178 -0.052815 0.722325 0.434988 er than in other species ofthe B. goudoti group, but still HL 0.283729 -0.059521 0.901536 -0.000783 much longer than in B. sp. 16, with no overlap in num- bers oflabial keratodonts in P3 and almost no overlap in TD -0.451112 0.171742 0.508941 0.315946 relative length ofP3 (Fig. 4). ED 0.042109 0.184460 0.248786 0.727413 END 0 263940 0 645782 0 593063 0 078554 Given this constant difference in tadpole morphology NSD -0.058373 0.886713 -0.111786 0.323847 which fully correlates withhighmitochondrial divergences (amongthe highest observedbetween closely relatedman- NND 0.169004 0.159007 -0.021443 0.796064 tellid frog species), and with fully separated haplotypes FORL 0.776970 -0.189957 0.113991 0.209375 in two nuclear genes, we conclude that B. boehmei and HAL B. sp. 16 constitute two separate and independent evolu- 0.936216 0.015471 0.113066 -0.107870 tionary lineages. Therefore, they should best be consid- HIL 0.852890 -0.051712 0.150553 0.154111 eredas distinct species, although cryptic in adultmorphol- FOTL 0.932469 0.147455 0.044485 0.068645 ogy and advertisement calls. In the following we thus de- FOL 0.784388 0.333820 0.095038 0.209488 scribe B. sp. 16 as a new species. TIBL 0.743402 0.023610 0.266693 0.084073 Boophis quasiboehmei sp. n. Eigenvalue 5.977193 2.369640 1.412833 0.905600 (Figs 5-6) % Variance 42.69424 16.92600 10.09166 6.46857 Holotype. ZSM 227/2006 (field number ZCMV 3045), adult male (Fig. 5), collected at Ambatovory, at the edge ofRanomafanaNational Park, south-easternMadagascar, m colouration. All specimens ofB. boehmeihad a brightred 21°14,279' S, 47°25,487' E, 966 a.s.l., on 26 February outer iris area and a brownish inner iris area, whereas B. 2006 by M. Vences, Y. Chiari, T. Rajoafiarison, E. Raje- sp. 16 had no such bright red colour but orange, either as riarison, P. Bora and T. Razafindrabe. a more or less uniformly orange iris or as an orange out- ZFMK er iris area. Paratypes. 59881-59882, two adult males, col- lected inthe Ranomafanaregion, south-eastern Madagas- In a search for a possible morphometric differentiation, car, in December 1994 by M. Burger; ZSM 715/2003 we carriedout a Principal ComponentAnalysis on the ba- (FG/MV 2002-0363), one adult male, collected at Vo- sis ofmeasurements in Table 2 (males only). The analy- hiparara (close to the Kidonavo bridge), RanomafanaNa- sis resulted in three factors with Eigenvalues greaterthan tional Park, 21°13' S, 47°22' E, ca. 1000 m a.s.l., on 20 1 (Table 3) which togetherexplained 70% ofthe total vari- January 2003, by F. Glaw, M. Puente, L. Raharivololoni- ation. Because size ofspecimenswas similar, the first fac- aina, M. Thomas and D. R. Vieites; ZSM 228/2006 torwas notrepresentative mainly ofbody size, but ofrel- (ZCMV 3051), ZSM 229/2006 (ZCMV 3069), and ZSM ative limb length; the highest factorloadings were forvari- 230/2006 (ZCMV 3070), three adultmales, from same lo- ables associatedwith limb length (Table 3). Factors 2 and cality and with same collectors and collection date; ZSM 3 were associated with the shape ofthe head: Factor2 with 224/2006 (ZCMV 2988), male, collected at Sahamalao- END and NSD, and Factor 3 with mainly HW and HL. tra, Ranomafana National Park, south-eastern Madagas- While Factor 1 resulted only marginally in a trend ofsep- car, 21°14.113' S, 47°23.767' E, south-eastern Madagas- aration ofthe two species (not shown), Factors 2 and es- car, on 25 February 2006 by M. Vences, Y. Chiari, T. Ra- pecially 3 separated most specimens ofB. boehmei vs. B. joafiarison, E. Rajeriarison, P. Bora and T. Razafindrabe; sp. 16 (Fig. 3). However, univariate analyses on the ba- ZSM 226/2006 (ZCMV 2951), male, collected at Imalo- sis of the variables with highest factor loadings did not ka, Ranomafana National Park, south-eastern Madagas- m result in a convincing separation (not shown), indicating car, 21°14,527' S, 47°27,909'E; 1020 a.s.l., on 23 Feb- that morphometric data cannot serve as diagnostic char- ruary 2006 byY. Chiari, P. Bora, T. Rajoafiarison, E. Ra- acters to separate these two forms. jeriarison, and T. Razafindrabe; ZSM 231/2006 (ZCMV Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK Boophis quasiboehmei sp. n., a new cryptic treefrog species from south-eastern Madagascar 249 Fig. 5. Dorsolateral (A) and ventral (B) views ofthe male holotype ofBoophis quasiboehmei sp. n. (ZSM 227/2006) in life. 3360), male, collected at Ranomena, 21°12,736' S, Diagnosis. Assigned to the genus Boophis based on the 47°26,010' E, Ranomafana National Park, south-eastern presence ofan intercalary element between ultimate and Madagascar, on 28 February 2006, M. Vences, Y. Chiari, penultimate phalanges offingers and toes (verifiedby ex- ZSM T. Rajoafiarison, and E. Rajeriarison; 232/2006 ternal examination), presence ofnuptial pads andabsence (ZCMV 3374) from the Ranomafanaregion, perhaps col- offemoral glands in males, and overall similarity to oth- lected at Ranomafanakely river but without precise col- erBoophis species.Assignedto theBoophisgoudotigroup lecting data; ZSM 2322/2007 (ZCMV 5948), male, col- because of its brownish ground colour, presence ofder- lected at Sahamalaotra, Ranomafana National Park, mal flaps or tubercles on heels and elbows, presence of south-easternMadagascar, 21°14.113' S, 47°23.767' E, on white tubercles ventrally ofthe cloacal opening, presence 5 March 2007 by M. Vences, A. StrauB, R. D. Randriani- of a sharp canthus rostralis, absence ofred skin colour, aina, and K. C. Wollenberg. and molecular phylogenetic relationships. Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK 250 Miguel Vences et al. Fig. 6. Specimens ofBoophis quasiboehmei sp. n. in life: (A) frontal and (B) ventral views ofa male from Ambohitsara (field number ZCMV 5867); (C) dorsolateral and (D) ventral views ofamale fromAndohahela (deposited in UADBA); (E) male from Ranomafana (deposited in UADBA); (F) male paratype ZFMK 59882 from Ranomafana (photo by M. Burger). Together with B. boehmei, the smallest species in the more from B. goudoti, B. obscurus, B. periegetes, B. Boophis goudoti group characterized by a deviant oral madagascariensis, B. roseipalmatus, B. brachychir, B. morphology ofthe tadpole which is unknown from any entingae, B. rufioculis, B. burgeri, B. reticulatus, B. ax- other Boophis species. Boophis quasiboehmei sp. n. dif- elmeyeri, and B. spinophis by smaller size (SVL ofadult fers from all described species in theB. goudoti group by males 28-31 mm versus 31-82 mm) andbioacoustic dif- substantial genetic differentiation (> 6% pairwise diver- ferentiation (see Vences et al. 2006 for details). B. quasi- gence in a fragment ofthe 16S rRNA gene) and further- boehmei sp. n. is most similar to B. boehmei and differs Bonn zoological Bulletin 57 (2): 241-255 ©ZFMK