Logout succeed
Logout succeed. See you again!

Identification and Characterization of a Novel Plasmodium falciparum Merozoite Apical Protein ... PDF
Preview Identification and Characterization of a Novel Plasmodium falciparum Merozoite Apical Protein ...
Identification and Characterization of a Novel PlasmodiumfalciparumMerozoite Apical Protein Involved in Erythrocyte Binding and Invasion Thilan Wickramarachchi., Yengkhom S. Devi., Asif Mohmmed*, Virander S. Chauhan* MalariaGroup,InternationalCentreforGeneticEngineeringandBiotechnology,NewDelhi,India Abstract Proteins that coat Plasmodium falciparum merozoite surface and those secreted from its apical secretory organelles are consideredpromisingcandidatesforthevaccineagainstmalaria.Inthepresentstudy,wehaveidentifiedanasparaginerich parasite protein (PfAARP; Gene ID PFD1105w), that harbors a predicted signal sequence, a C-terminal transmembrane region and whose transcription and translation patterns are similar to some well characterized merozoite surface/apical proteins.PfAARPwaslocalizedtotheapicalendofthemerozoitesbyGFP-targetingapproachusinganinducible,schizont- stageexpressionsystem,byimmunofluorescenceassaysusinganti-PfAARPantibodies.Immuno-electronmicrosopicstudies showed that PfAARP is localized in the apical ends of the rhoptries in the merozoites. RBC binding assays with PfAARP expressed on COS cells surface showed that it binds to RBCs through its N-terminal region with a receptor on the RBC surfacethatissensitivetotrypsinandneuraminidasetreatments.SequencingofPfAARPfromdifferentP.falciparumstrains aswellasfieldisolatesshowedthattheN-terminalregionishighlyconserved.Recombinantproteincorrespondingtothe N-terminal region of PfAARP (PfAARP-N) was produced in its functional form in E. coli. PfAARP-N showed reactivity with immune sera from individuals residing in P. falciparum endemic area. The anti-PfAARP-N rabbit antibodies significantly inhibited parasite invasion in vitro. Our data on localization, functional assays and invasion inhibition, suggest a role of PfAARP inerythrocyte bindingand invasionby the merozoite. Citation:WickramarachchiT,DeviYS,MohmmedA,ChauhanVS(2008)IdentificationandCharacterizationofaNovelPlasmodiumfalciparumMerozoiteApical ProteinInvolvedinErythrocyteBindingandInvasion.PLoSONE3(3):e1732.doi:10.1371/journal.pone.0001732 Editor:DeniseL.Doolan,QueenslandInstituteofMedicalResearch,Australia ReceivedJuly24,2007;AcceptedJanuary17,2008;PublishedMarch5,2008 Copyright:(cid:1)2008Wickramarachchietal.Thisisanopen-accessarticledistributedunderthetermsoftheCreativeCommonsAttributionLicense,whichpermits unrestricteduse,distribution,andreproductioninanymedium,providedtheoriginalauthorandsourcearecredited. Funding:TWwassupportedbyInternationalPost-doctoralresearchfellowshipfromICGEB. CompetingInterests:Theauthorshavedeclaredthatnocompetinginterestsexist. *E-mail:[email protected](AM);[email protected](VSC) .Theseauthorscontributedequallytothiswork. Introduction combinationofantigensinvolvedatdifferentstagesofinvasion.In addition,identificationofnewtargetantigensisalsoimportantfor Malariaisstillamajorparasiticdiseasedespiteeffortsspanning the development of future vaccines, since no fully protective more than a century to control or eradicate it. Every year about vaccine has been assembled so far. Availability of P. falciparum 300–500millionpeoplegetinfectedwithmalariacausingabout1– genome sequence and proteome data has provided new oppor- 2milliondeaths[1].MostoftheclinicalsymptomsofP.falciparum tunity to identify novel drug and vaccine target candidates. malaria are attributed to the continuous cycles of asexual Recently, transcriptome analysis of the complete asexual intra- reproduction within the human erythrocytes that involve mero- erythrocytic developmental cycle (IDC) of P. falciparum identified zoite invasion, growth and schizogony. Merozoite invasion 262 ORFs that showed sharp induction of expression during late involves a series of highly specific, sequential interaction between schizont stages as in case of some of the well characterized merozoiteanderythrocytesurfaceproteins,andisacrucialstepin merozoite surface/apical proteins that play role in merozoite the parasite life cycle. Understanding the complex process of P. invasion and are the best-known malaria vaccine candidates [4]. falciparum merozoite invasion requires identification and charac- Of the 262 ORFs, 189 are of unknown function and represent a terization of numerous potential parasite ligands and their list of new putative vaccine candidate antigens. However it interactions with receptors on RBC. These include different remains to be determined whether some of these proteins are proteinsonthesurfaceofthemerozoitethatarepossiblyinvolved localized on the merozoite surface/apical organelles and are inweakinitialattachmentwiththeRBCs,aswellasthoseprotein involved in merozoite invasion process. Two main characteristics thatarereleasedfromthethreeapicalsecretoryorganellesofthe oftheproteinslocalizedonthesurfaceorapicalorganellesarethe merozoite,therhoptries,micronemesanddensegranules,priorto presence of an N-terminal signal sequence and the presence of a or during the host cell invasion and are involved in secondary C-terminal attachment motif such as GPI anchor or transmem- interactions [2]. A number of these antigens are considered as braneregion.Here,wehaveidentifiedandcharacterizedanovel promising vaccine candidates and some of these are presently at merozoite protein that contains both the N-terminal signal variousstagesofdevelopmentforclinicaltrials[3].However,ithas sequence and a C-terminal transmembrane region. We have been suggested that the most successful approach will require a localized this protein in the apical region of the merozoite and PLoSONE | www.plosone.org 1 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein nameditasapicalasparaginerichprotein(PfAARP).Wehavealso level of PfAARP was observed in late schizont stages (48 h after attempted to investigate the role of PfAARP during the invasion) whereas there was no detectable transcription in the erythrocyte invasion. earlyring,latering,trophozoitesandearlyschizontstages(8,16, 30 and 40h after invasion respectively). Quantitative PCR from Results thesamesetofcDNAsampleswerealsocarriedoutfortwoother P. falciparum proteins, erythrocyte binding antigen-175 (EBA-175) Identification and sequence analysis of PFD1105w -an and Falcipain 2 as controls. As expected EBA-175 transcript was asparagine rich protein ofP.falciparum (PfAARP) with C- alsofoundtobemaximumincDNAsamplesfromschizontstage terminal transmembrane region parasiteswhereasFalcipain-2showedmaximumtranscriptlevelin In our efforts to identify novel merozoite surface/apical trophozoitestageparasites.Northernblotanalysiswasalsocarried organelleproteinsthatmightbeinvolvedinmerozoiteattachment outusingtotalRNAsfromsynchronizedparasiteculturesatring, andinvasionofRBC,weinsilicoscreenedP.falciparumproteome trophozoite and schizont stages, PfAARP DNA probe detected database. P. falciparum gene PFD1105w that codes for a strong,1.8 kbmessageinthelateschizontstageRNA(Figure2B). A faintsignal was alsodetected inringstage RNA. hypotheticalproteinwasselectedasacandidategenebasedupon itsstructuralmotifsandstagespecifictranscriptionalprofilethatis Westernblotanalysisusinganti-PfAARPantibodieswithtotal similar to 28 other P. falciparum antigens which have been parasite lysates from cultures at different time point showed previouslyshowntoplayroleintheprocessofmerozoiteinvasion expression of PfAARP protein in late-schizont/merozoite stage parasites (Figure 2C), whereas it was not detected in parasites at [4]. PFD1105w is a 217 amino acid long protein that contains a trophozoite stages. In early ring stage parasite a faint band of putative N-terminal hydrophobic signal sequence and a C- PfAARP protein was observed that might represent left over terminal transmembrane domain. Other interesting features proteins after invasion of the merozoites. Our results on include an unusually high asparagine rich region of 63 residues transcription and translation analyses suggest that PfAARP is (108aa-170aa) in the C-terminal half of the protein and a run of expressed in the blood stage parasites specifically in the late proline residues (PPPPPPVPPPPPP) just before the transmem- schizont/merozoite stages as in case of other merozoite integral braneregion(Figure1A).HomologsofPFD1105wwereidentified membrane proteins. from P. berghei (PB402266.00.0), P. chabaudi (PC401501.00.0), P. vivax strain SaI-1 (Pv090210) and P. yoelii yoelii strain 17XNL (PY06454) from the genome database. An alignment of the PfAARP localize to the apical end of the merozoites predictedproteinssequencesofthesegenesisshowninFigure1B. To investigate the localization of PfAARP in the parasite, a CommonfeatureamongtheseproteinsarethepresenceofanN- GFP-targetingapproachusinganinducibleexpressionsystemthat terminalsignalsequenceandastretchofprolineresiduesnearthe directs strong, schizont-stage expression of transgene [7] was C-terminus.P.berghei,P.chabaudiandP.vivaxhomologalsocontain employed(Figure3A).Expressionofthefusionproteinconsisting asparaginerichregion,whichvariesinlengthfrom6–18residues. of secreted GFP and PfAARP was activated in the transgenic The homolog in P. vivax contains extra repeats of DVNG and parasites, by removing the repressor drug. These transgenic GNMN residuesjust beforetheasparagine rich region. parasiteswerestudiedforlocalizationofthePfAARP-GFPfusion protein.FluorescenceoftheGFP-fusionproteinwasobservedina Expression of N-terminal fragment of PfAARP and punctate manner in theschizonts, towards the apexof individual merozoites(Figure3B).ImmunofluorescenceassaysusingPfAARP specificity of antisera specific antisera also showed specific punctate staining in the An N-terminalfragment ofPfAARP(PfAARP–N; 20aa-107aa) schizontstageparasites(Figure3C,panelI);inthefreemerozoites was cloned in pET28a vector and expressed in E. coli. The the staining was observed towards the apical ends (Figure 3C, recombinantproteinwaspurifiedtohomogeneitythatmigratedas panel III). No staining was observed in the ring and trophozoite a single band on SDS-PAGE under reducing and non-reducing stage parasites (not shown). conditions(FigureS1A).RP-HPLCanalysisoftheproteinonaC8 TofurtherdefinethelocalizationofPfAARPinthemerozoites, columnrevealedsinglesymmetricalpeak(FigureS1B).Polyclonal co-localization studies were carried out using antibodies against antibodieswereraisedinrabbitsandmiceagainsttherecombinant microneme [EBA-175 and apical membrane antigen-1 (AMA-1)] protein. The specificity of the rabbit and mice antisera was and rhoptry [cytoadherence-linked asexual gene (RhopH1/ assessedbyWesternblotanalysisusingparasitelysatefrommixed Clag3.1)] resident proteins as well as merozoite surface protein- stagesparasiteculture.Theanti-PfAARP-Nantibodiesrecognized 1(MSP-1).Anti-MSP-1antibodystainingwasfoundonthesurface aspecificband(,35kDa)intheparasitelysate(FigureS2A).The of merozoites with PfAARP staining localized at the tip of molecularmassofPfAARPwithouttheputativesignalsequenceis merozoites(Figure4).AMA1waspresentovertheentiresurfaceof 22.4 kDa and its predicted pI is 4.3. The discrepancy in the merozoites but is most densely distributed at the apical tip predicted mass of the protein and band on the immunoblot is (Figure 5A), whereas EBA175 tends to be restricted to the apical consistent with differences seen in other highly acidic proteins end (Figure 5B) as shown earlier [8,9]. However, the PfAARP [5,6].AntiPfAARPantibodiesdidnotreactwiththelysateofthe stainingdidnotcolocalizewithEBA175,andshowedonlypartial uninfected RBCs. No band was detected in parasite lysate using co-localization with AMA-1 (Figure 5A and 5B), suggesting that pre-immune sera. (Figure S2B). the PfAARP may not be present in the micronemes. The anti- Clag3.1antibodiesshowedpunctatestaininginschizonts(Figure6, Analyses of transcription and translation of PfAARP in panel I) and stained the two rhoptry bulbs in the free merozoites asexual blood stage parasites (Figure6,panelII).ThePfAARPstainingdidnotcolocalizewith To ascertain the expression pattern of PfAARP during asexual Clag3.1stainingintheschizont(Figure6,panelI).Intheinvading blood stage life cycleof theparasite, cDNAswere preparedfrom merozoites, PfAARP staining was observed just above the two tightly synchronized parasite cultures at 8, 16, 30, 40 and 48h rhoptry bulbs, at the apical end facing towards the RBC after invasion and analyzed by real-time quantitative PCR using membrane(Figure6,panelII).TheseresultssuggestthatPfAARP genespecificprimers.AsshowninFigure2Amaximumtranscript ispresentattheapicalendofthemerozoitesclosetotherhoptry PLoSONE | www.plosone.org 2 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure1.(A)SchematicrepresentationofstructureofPfAARP(GeneIDPFD1105w)geneshowinglocationofsignalsequence(SS) andtrans-membrane(TM)region.Thelocationsofasparaginerichregionandconservedprolinerepeatregionarealsomarked,respectiveamino acid positions are also indicated. (B) Amino acid sequence alignment of PfAARP with that of four homologs from P. berghei (PB402266.00.0) P. chabaudi(PC401501.00.0)P.vivaxstrainSaI-1(Pv090210)andP.yoeliiyoeliistrain17XNL(PY06454).Aminoacidsthatareidenticalinatleastthreeof fivespecies(.60%)areshownindark,aminoacidsthataresimilarinatleastthreeoffivespecies(.60%)ortothoseshownindark,areshadedlight grey.Transmembraneregionisindicatedbysolidbar. doi:10.1371/journal.pone.0001732.g001 PLoSONE | www.plosone.org 3 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure2.StagespecificexpressionofPfAARPinasexualbloodstageparasites.(A)RelativetranscriptionofPfAARPassessedbyreal-time- RT-PCRusingtotalRNAextractedfromtightlysynchronizedparasiteculturesatearlyring(ER),latering(LR),trophozoite(T),earlyschizont(ES)and lateschizont(LS)stages(8,16,30,40and48hafterinvasion).StagespecificexpressionofEBA-175andFalcipain2wasanalyzedascontrols.(B) NorthernblotanalysisoftotalRNAsisolatedfromsynchronizedparasiteculturesatring(lane1),trophozoite(lane2),andschizont(lane3)stage hybridizedwithlabeledPfAARPprobe.EqualloadingofRNAinallthewellswasconfirmedbyethidiumbromidestainingofrRNAsinthegels(lower panel).(C)Westernblotsanalysesofequalnumberofhighlysynchronizedparasitesatring(lane1),trophozoite(lane2)andschizont(lane3)with anti-PfAARPantibodies.Anti-HRPIIantibodieswereusedtoprobeablotraninparalleltoshowequalloadingineachwells(lowerpanel). doi:10.1371/journal.pone.0001732.g002 neck. To confirm these results we carried out immuno-elctron construct (Table 1). The N-terminal half of PfAARP (construct microscopic studies using anti-PfAARP antibodies. PfAARP pRE4-PfAARP-N)alsoshowedRBCbindingwithequalefficiency stainingwasfoundtobelocalizedintheapicalendsofrhoptries, tothatoffullgene(Table1)suggestingthattheRBCbindingdomain close to the rhptry neck area, where the two rhoptries join in a is present in the N-terminal half of PfAARP. Treatment of RBCs commonductule(Figure7).Nostainingwasfoundintherhoptry with chymotrypsin did not affect binding with the PfAARP bulbs oranyother organelle of themerozoites. expressingCOScells,whereastrypsinandneuraminidasetreatment significantlyreducedthebinding.TheseresultssuggestthatPfAARP PfAARP binds with human RBCs through its N-terminal binds with a receptor on RBC that is resistant to chymotrypsin region treatmentbutissensitivetotrypsinandneuraminidase. ThefulllengthPfAARPgeneanditsN-terminalhalfthatlacksthe asparaginerichregionwereexpressedonthesurfaceofCOScellsin Reactivity of PfAARP with human immune sera order to test their binding with the human erythrocytes. The In order to examine whether antibodies against PfAARP were secretory signal sequence and transmembrane segment of Herpes elicited during natural infection with P. falciparum, recombinant simplex virus glycoprotein D (HSV gD) gene, in the pRE4 PfAARP was examined for its reactivity with sera collected from mammalian expression vector used [10], target these protein to individuals residing in P. falciparum endemic areas. Pooled sera the surface of transfected COS cells. A construct pHVDR22, from these individuals showed reactivity with the recombinant designedtoexpressP.vivaxDuffybindingproteinregionII(PvRII)in protein on a western blot (Figure 8). In ELISA, the recombinant same way [11], was used as the positive control in these assays. proteinwasrecognizedby.50%ofhumanserasamplesthatwere Immunofluorescence assay of the transfected cells using DL6 also positive for reactivity with recombinant PfMSP-1 protein, 19 antibodies (see materials and methods) confirmed expression of another leading blood stage malaria vaccine candidate antigen these proteins on their surfaces. The full length PfAARP gene (Figure S4). These reactions were specific as no reactivity was (constructpRE4-PfAARP-F) showedbindingwithhuman erythro- observed in western blot as well as in ELISA with sera from cytesalthoughit’sbindingefficiencywerelowerthanthatofPvRII individuals whohadneverbeenexposed tomalaria. PLoSONE | www.plosone.org 4 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure3.LocalizationofPfAARPtotheapicalendofthemerozoites.(A)SchematicdiagramofpTGFP-AARPplasmidconstructcontaining selectablemarker(humanDHFR)undercalmodulinpromoter(59CAM),transactivatorTati-3underMSP-2promoter(59MSP-2)andchimericgene consistingofsecretedGFP(withsignalsequence)andPfAARPunderthecontrolofTet-responsivepromoter.Expressionoffusiongeneisinduced whenahydrotetracycline(ATc)isremovedfromthecultures.(B)Fluorescentmicroscopicimagesoftransgenicparasitesatschizontstagesshowing localizationofPfAARPfusedtoaGFPreporterandexpressedinaninduciblesystemusingschizontstagespecificpromoter.Theparasitenucleiwere stainedwithDAPI(blue).Enlargedimagesofselectedindividualfreemerozoiteareshownintheinsets.(C)Immuno-fluorescenceassaytolocalize PfAARPintheschizont/merozoitestageparasitesusinganti-PfAARP(green)antibodies.TheparasitenucleiwerestainedwithDAPI(blue)andslides werevisualizedbyfluorescencemicroscope.S,schizontandM,freemerozoites. doi:10.1371/journal.pone.0001732.g003 Conservation of gene encoding PfAARP in different P. Recombinant PfAARP-N binds with RBCs and anti- falciparum isolates PfAARP-N antibodies inhibits this binding as well as ToassessthelevelofconservationofPfAARPgenesequencein erythrocyte invasion by the merozoites P.falciparum,PfAARPgenefromfivedifferentP.falciparumstrains As the RBC binding domain of PfAARP was found to be and five field isolates were amplified. Sequencing of these genes present in its N-terminal half, the recombinant protein corre- showedthattheN-terminalregionofPfAARPishighlyconserved sponding to this region, PfAARP-N, was tested for its ability to amongtheseisolatesandonlyoneresidueatposition103showed bindwiththehumanerythrocytesinaninvitroassaytoascertain variationfromNRSinfoursequences;variationinthelengthof its functionality. Purified PfAARP-N and P. vivax Duffy binding asparagine repeat region was observed among these isolates that antigen region II (PvRII) bound with human erythrocytes in this variedfrom51-63aa(25–28%ofthetotalaminoacidcomposition) assay whereas P. falciparum DNA helicase 60 (PfD60) did not (Figure S5). In addition, the transmembrane region and the (Figure 9A), validating that the recombinant PfAARP-N is proline stretch wasalso foundtobehighly conserved. functionally active. In addition, binding of recombinant PfAARP PLoSONE | www.plosone.org 5 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure4.ImmunofluorescenceassaytolocalizePfAARPbycoimmuno-stainingofP.falciparumparasiteswithanti-PfAARP(green) andanti-MSP-1(red)antibodies.TheparasitenucleiwerestainedwithDAPI(blue)andslideswerevisualizedbyfluorescencemicroscope.The apicalendsofthemerozoiteshavedensestructure.MSP-1stainingwasfoundaroundthemerozoitesandthePfAARPwaslocalizedattheapexofthe merozoites.MS,midschizont;LS,lateschizontandM,freemerozoites. doi:10.1371/journal.pone.0001732.g004 tohumanerythrocyteswassensitivetotrypsinandneuraminidase proteins get further distributed in to different trafficking routes treatments, as in case of COS cell surface binding assays depending upon additional signals [12,13,14,15]. A number of (Figure 9A). Further, ability of the anti- PfAARP-N antibodies to merozoiteproteinsthatarelocalizedonitssurfaceorresideinthe inhibit binding of PfAARP-N withRBCs wasassessed. As shown apicalsecretorycompartments,harborN-terminalsignalsequenc- in Figure 9B, antibodies purified from rabbit immunized with es.Theseproteinafterpassingthroughthesecretorypathway,get PfAARP-N inhibited RBC binding of PfAARP-N in a dose targeted to their final destination such as merozoite surface, dependentmanner.NoinhibitionwasobservedwithIgGpurified rhoptries or micronemes [12,13,16]. Many of these merozoite frompre-immune sera. surfaceproteins(MSPs)suchasMSP-1,-2,-4,and-5attachtothe The ability of anti-PfAARP-N antibodies to inhibit parasite plasma membrane via a C-terminal glycosylphosphatidyl inositol invasionwasassessedbyaninvitroparasitegrowthinhibitionassay. (GPI) whereas all known micronemal proteins are type I integral Anti-PfMSP-1 antibodies were used as positive control. As membrane proteins that contain a C-terminal transmembrane 42 shown in Table 2, anti-PfAARP-N antibodies significantly (up to domain and a short cytoplasmic domain [2]. The rhoptries also 70%) inhibited the parasite growth in a concentration dependent containseveralresidentproteinsthateitherhaveatransmembrane manner. The invasion inhibition by anti-PfAARP-N antibodies region,suchasrhoptry-associatedproteins1(RAP1)[17]orhave was comparable totheinhibitionby anti-PfMSP-1 antibodies. a GPI anchor such as rhoptry associated membrane antigen 42 (RAMA) [18]. Discussion ThestructuralfeaturesofPfAARPi.e.presenceofaC-terminal transmembraneregioninadditiontotheN-terminalhydrophobic Availability of the predicted proteome and transcriptome data signalsequenceanditsstagespecificexpressionpattern,ledusto forP.falciparumhasprovidedanimpetustofindnoveldrugtargets speculate that it might be a putative merozoite surface/apical and vaccine candidate antigens. In the present study we have protein. To confirm this hypothesis, we studied localization of identifiedPfAARPasonesuchcandidateantigen.Transcriptome PfAARPbyGFPtargetingapproachinatransgenicparasiteline. analysis of stage specific asexual blood stage parasites grouped A number of studies have used this approach to explore the PfAARP with 28 other P. falciparum proteins that are involved in localization and trafficking of the parasite proteins [14,19,20,21]. the process of merozoite invasion [4]. We have confirmed However, correct timing of expression of the transgene in P. expressionofPfAARPspecificallyatlateschizont/merozoitestage falciparum transgenic parasite lines has been shown to be a by quantitative real-time PCR and western blot analysis, prerequisiteforproteinsortingandcorrectsubcellularlocalization suggesting it to be essentially a merozoite protein. PfAARP [12,22]. In addition, constitutive over expression of some contains an N-terminal signal peptide and a C-terminal trans- transgenes encoding merozoite surface proteins might be toxic to membraneregion.TheN-terminalsignalsequenceindifferentP. the parasite [7]. Therefore, tolocalize PfAARP in the parasite, a falciprum proteins is responsible for entry of the proteins into the secreted GFP- PfAARP fusion protein was expressed in the ER-trans Golgi network (TGN) secretory system and then these parasiteunderthecontrolofaschizontstagepromoterofMSP-2 PLoSONE | www.plosone.org 6 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure5.SpatiallocalizationofPfAARPbyco-immunostainingstudieswithmicronemeresidentproteinsAMA-1(A)andEBA-175 (B).P.falciparumparasiteswereco-immunostainedwithanti-PfAARP(green)andanti-AMA-1oranti-EBA-175(red)antibodies.Theparasitenuclei were stained with DAPI (blue). Both the microneme markers and PfAARP showed punctate staining in the schizonts. In the late schizonts and merozoites,AMA-1waspresentovertheentiresurfaceofthemerozoitesbutismostdenselydistributedattheirapicaltip,whereasEBA-175staining wasrestrictedtotheapicalends.Enlargedimageofselectedindividualmerozoiteisshownintheinset.MS,midschizont;LS,lateschizontandM,free merozoites. doi:10.1371/journal.pone.0001732.g005 and a tetracycline-regulated transactivator, using a recently [2,24]. After the release of merozoites from schizont and during developed transfection vector [7,23]. The temporal expression of the invasion process, contents of both rhoptries and micronemes thetransgeneinthissystemmimicsthatofMSP-2[7]whichhasa get excreted through the ductules at the neck of the rhoptry similar transcriptional profile to PfAARP. The GFP- PfAARP [25,26]. Rhoptries contain a number of proteins including high fusion protein expressed in the transgenic parasite using this molecular mass proteins complex, RhopH complex, membrane approachwasfoundtobelocalizedtowardstheapicalendofthe associated Rhoptry proteins (RAMA) and rhoptry associated merozoites.Immunofluorescenceassaysandcolocalizationstudies proteins (RAP1, RAP2 and RAP3) that are focus of interest as further confirmed presence of PfAARP at the apical end of the vaccinecandidates.RhopHcomplexproteinslocalizetothebasal merozoites. Merozoites harbour a secretory complex at their bulboftherhoptries[27]andareinvolvedinerythrocytebinding apical end that consists of organelles like rhoptries and andinestablishmentofparasitophorousvacuole[28].RAMAhas micronemes. These organelles contain many of the key proteins been shown to be localized to inner face of the rhoptry bulb needed for directional attachment and invasion of the merozoite membrane in close apposition of RhopH3 and RAP1 [18]. PLoSONE | www.plosone.org 7 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure6.SpatiallocalizationofPfAARPbyco-immunostainingstudieswithrhoptryresidentproteinClag3.1.P.falciparumparasites were coimmuno-stained with anti- PfAARP (green) and anti-Clag3.1 (red) antibodies. The parasite nuclei were stained with DAPI (blue). Clag3.1 stainingwaspresentintherhoptrybulbinthefreeandinvadingmerozoites(lowerpanel).PfAARPwaslocalizedjustabovethesetworhoptrybulbs towardstheapexofthemerozoites.Enlargedimageofmerozoiteinvadinginthehosterythrocyteisshownintheinset.LS,lateschizontandM,free merozoites. doi:10.1371/journal.pone.0001732.g006 Micronemes contain several proteins involved in the process of totherhoptryneckthatmayplayroleinbindingandinvasionof merozoiteinvasionincludingduffybindinglikeproteins,EBA-175, themerozoites.TheseincluderhoptryneckproteinPfRON4that EBA-140 and EBA-180, that binds with the host RBC in a sialic is a homologue of Toxoplasma gondii rhoptry neck protein aciddependentmanner[2].Inthepresentstudy,PfAARPdidnot TgRON4. PfRON4 forms a complex with PfAMA1 during its colocalizewithanyofthemicronemalandrhoptryproteinstested, secretioninthecourseofmerozoiteinvasion[29].TgRON4also and was found to be discretely localized above these apical interacts directly with the TgAMA1 and participate in the secretorystructuresinthefreemerozoites.Ourresultsofimmuno- formationofmovingjunction,acircumferentialzonewhichforms electronmicroscopicstudiesclearlyshowthatPfAARPissituated attheapicaltipoftheparasiteduringitsinvasioninthehostcell in the apical ends of the secretory organelle rhoptries in the [30]. P. falciparum also expresses a family of proteins (PfRh1, merozoites. Someother P.falciparum proteins havebeen localized PfRh2a, PfRh2b, and PfRh4) that are orthologs of P. vivax reticulocyte binding proteins, these proteins also localize in the rhoptry neck at the merozoite apical end [2,31,32]. Recently, a GPI anchored merozoite protein Pf34 was also found to be localized totherhoptry neck [33]. Sinceanumberofmerozoiteapicalproteinsplayroleinbinding and invasion of RBC by the merozoites [2], we tried to assess a possible role of PfAARP in RBC binding. Our results of binding assays with COS cell surface expressed PfAARP suggest that PfAARP is involved in binding of the merozoite with the host RBC.Anumberofsurfaceproteinsareexpectedtobeinvolvedin initialbindingofthemerozoitewiththeRBCwhereasproteinsof apical organelles such as the members of DBL family and homologsofreticulocytebindingproteinsareinvolvedinbinding Table1.Binding ofnormaland treated erythrocyteswith Cos-7cells expressingfull lengthPfAARP oritsN-terminal fragment,PfAARP-N Construct No.ofrosettes1 Untreated Trypsin Neuraminidase Chymotrypsin PfAARP 52(68) 11(65) 16(64) 50(610) PfAARP-N 54(63) 8(66) 14(66) 52(68) pHVDR222 70(69) N/A N/A 5(62) 1ThenumberofCOS-7cellswithrosettesofbounderythrocyteswasscoredin Figure7.LocalizationofPfAARPbyimmuno-electronmicros- 20fieldsat6200magnification.Numberofrosettesofeachexperimentwas copy. Ultra thin sections of P. falciparum parasites at schizont/ normalizedaccordingtorespectivetransfectionefficiencyto5%.Meanvalue merozoite stages were labeled with anti-PfAARP antibody and gold of3independentexperimentsisreportedwithstandarddeviation. labeledsecondaryantibody.Labelingwasobservedintheapicalendof 2ConstructdesignedtoexpressP.vivaxDuffybindingproteinregionII(PvRII) therhoptriesinmerozoite.Scalebar=250nm. [11] doi:10.1371/journal.pone.0001732.g007 doi:10.1371/journal.pone.0001732.t001 PLoSONE | www.plosone.org 8 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Figure 8. (A) Anti-PfAARP antibodies are present in human immune sera from P.falciparumendemic area. Western blot analysis showing reactivity of recombinant PfAARP-N (lane 1) with humanimmunesera,PfMSP-1 (lane2)waskeptasapositivecontrol. 19 (B)CoomassiebluestainSDS-polyacrylamidegelraninparallel. doi:10.1371/journal.pone.0001732.g008 afterre-orientationofthemerozoite[2,24].Theparasiteutilizesa number ofreceptors ontheerythrocytesurface that interactwith these ligands including glycophorin A, B and C and unknown receptors E, X, Y and Z. These receptor–ligand interactions between the merozoite surface/apical proteins and erythrocyte surfacereceptorsarecharacterizedbytheirenzymesensitivitiesto neuraminidase,trypsin,andchymotrypsin[31,34].Wefoundthat PfAARPbindswithRBCinachymotrypsinresistantmanner,and shows sensitivity to trypsin and neuraminidase treatments suggesting that it utilizes a receptor similar to Glycophorin A or C on the RBC surface. Taken together the results of localization and binding assays suggested that the PfAARP is involved in bindingofthemerozoiteafterre-orientationduringtheprocessof invasion. Further the binding domain was localized in the N- Figure 9. Erythrocyte binding assay using recombinant PfAARP-Nandbindinginhibitionbyanti-PfAARP-Nantibodies. terminal half, suggesting that the repeat structure in the C- (A) Western blot using monoclonal anti penta histidine antibodies terminal half has no role in RBC binding. Repeat regions are showing detection of recombinant proteins in elutes from the RBC common in Plasmodium proteins located on the merozoite surface bindingassaysofproteinPfDH60(negativecontrol;lane1),PvRII(lane or in the apical secretory organelles [18,31,35,36]. Although the 2) and PfAARP-N (lane 3) using untreated human RBC, and in elutes roleoftheserepeatregionsisnotclear,ithasbeensuggestedthat fromsimilarbindingassaysofPfAARP-NusinghumanRBCstreatedwith trypsin (lane 4), neurminidase (lane 5) and chymotrypsin (lane 6). (B) thesemightactasimmunodominantepitopesthatmaycontribute Western blot of elutes from the RBC binding assays with the tomalaria immunity [37]. recombinant PfAARP-N protein pre-incubated in RPMI alone (lane 1) Malariaproteinsshowextensivepolymorphismthatissuggested orwithantibodiespurifiedfrompre-immunesera(100mg,lane2)and to be one of the main strategies of the parasites to evade host anti- PfAARP antibodies purified from rabbit immune sera (10, 25, 50 immune mechanisms, and the antigens that are under natural and100mg,lane3–6).Equalamountofrecombinantproteinwasused immune pressure tend to have higher levels of polymorphism. ineachassay. doi:10.1371/journal.pone.0001732.g009 [38,39]. On the other hand, it is also shown that residues that showpolymorphismduetoimmunepressurearedifferentthanthe areas, indicating that it contains epitope(s) that are target of functionally critical domains which are relatively conserved and antibody response generated during natural exposure to P. aremoresuitabletargetforvaccinedevelopment[40,41].Having falciparum.Presenceofanti-PfAARPantibodiesinhumanimmune foundoutthatPfAARPisinvolvedinRBCbinding,weassessedif seraandconservationPfAARPgeneacrossdifferentisolates/strain it is also conserved across different P. falciparum strains and field suggest that this antigen may induce effective host-immune isolates. Sequencing of PfAARP gene from different P. falciparum response against the parasite. We further evaluated the efficacy strainsandfieldisolatesshowedthatithasevolutionaryconserved of rabbit antibodies generated against the PfAARP-N to inhibit N-terminalhalfthatmaysignifythefunctionalimportanceofthe merozoite invasion. The recombinant PfAARP-N was functional N-terminal region of PfAARP for the parasite survival. These with respect to its binding activity with human erythrocytes and results in combination with our RBC binding assays suggest that thisbindingwasinhibitedbyanti-PfAARP-Nantibodiesinadose PfAARPplaysasignificantroleinbindingandinvasionofRBCby dependentmanner.Theseresultssuggestedthatbindinginhibitory themerozoite. antibodies are present in the rabbit immune sera that block A number of merozoite surface antigens are proposed to elicit receptor binding function of PfAARP. These antibodies also protectionagainsttheparasitebyantibodymediatedinhibitionof significantlyinhibitedinvasionoftheerythrocytesbyparasitesina merozoite invasion [42]. We assessed if there is any immune dose dependent manner. Our invasion inhibition data using responsegeneratedagainstPfAARPduringnaturalexposuretoP. bindinginhibitoryanti-PfAARPantibodiessuggestthatbindingof falciparum. The asparagine repeat region present in PfAARP is PfAARPtotheRBCisavitalstepduringtheprocessofmerozoite known to be common among many parasite proteins [43,44,45]. invasionandsupportPfAARPtobeaputativevaccine/drugtarget Therefore to avoid detection of cross reactive antibodies against candidate. Owing to the complexity of the invasion process, it is these regions, we used recombinant protein corresponding to N- essential that strategies for preventing malaria disease that are terminalhalfofthegene,PfAARP-N,thatcontainsthefunctional directed against merozoite invasion should include such parasite RBC binding domain. Recombinant PfAARP-N was recognized proteinsthatplayimportantrolesduringdifferentstepsofinvasion byimmuneserafromindividualsresidinginP.falciparumendemic using diverseligand-receptor interactions. PLoSONE | www.plosone.org 9 March2008 | Volume 3 | Issue 3 | e1732 PfAARPMerozoiteProtein Table2. InhibitionofP. falciparum invasionoferythrocytes bypurifiedrabbit anti-PfAARP antibodies.Anti-PfMSP-1 rabbit 42 antibodieswere used asacontrol. Group %ofparasitaemia1 %ofinvasioninhibition4 ConcentrationofIgG(mg/ml)2 ConcentrationofIgG(mg/ml) 0.5 0.25 0.125 0.0625 0.5 0.25 0.125 0.0625 Adjuvant 5.66(60.12)3 5.76(61.25) 6.13(60.32) 5.34(60.58) - - - control PfAARP 1.73(60.31) 2.63(60.58) 3(60.7) 3.24(6013) 69.41 54.34 51.10 39.4 immune MSP-142 2.07(60.12) 1.93(60.12) 2.86(60.31) 3.4(60.01) 63.50 66.50 53.30 36.3 immune 1Parasitaemiaistheaverageoftriplicatewells. 2FinalconcentrationofIgGinawell 3Standarddeviation 4Calculatedagainstwellswithantibodiesfromadjuvantcontrol(chi-squarestest,P#0.01). doi:10.1371/journal.pone.0001732.t002 Material and Methods were used following Blair et al. [51]. Quantitative real time PCR werecarriedoutintriplicateusingtheiCyclerversion3.0 Parasite culture, transfection plasmid construct and (Bio-Rad); each reaction was containing equal amount of parasite transfection cDNA, 100ng of both the gene specific primers and 16SYBR Plasmodium falciparum strains 3D7 were cultured on human Green PCR mix (Bio-Rad). Threshold cycle (Ct) values were erythrocytes (4% hematocrit) in RPMI1640 media (Invitrogen) calculated by using iCycler software. Standard curves for each supplemented with 10% O+ human serum using standard genewereobtainedbyusingdifferentdilutionsofwild-typegDNA protocol[46].Parasiteculturesweresynchronizedbytwosorbitol (100–1ng) as template, and these standard curves were used to treatmentsat4 hapartfollowingLambrosandVanderberg[47]. determinegenomeequivalentsofCtvaluesforeverygeneand18S Togenerateatransfectionvectorconstruct,thePfAARPgenewas rRNA in each RNA sample [51]. Genome equivalents of each amplified from P. falciparum 3D7 genomic DNA using primers: gene were normalized using that of 18S rRNA for all the RNA 500A- 59 CCG ACG CGT ATA TTG AGG AAT AAC AAA samples. AGT CAT AAC 39 and 501A- 59 CGG ACT AGT TTA GGG TAC TCC GAT TAA TTT TAA ACC 39. Amplified PCR Expressionplasmidconstruct,expressionandpurification product was digested with MluI and SpeI restriction enzymes and of recombinant protein, RP-HPLC and Generation of clonedinframetotheC-terminusofsecretedGFPintheMluIand polyclonal anti-sera SpeI sites of the transfection vector [5] to give pTGFP-AARP An N-terminal fragment of PfAARP gene (20aa- 107aa) was transfectionvector.Thisvectorcontainsfusionproteinofsecreted amplified by PCR from P. falciparum 3D7 genomic DNA using GFPandPfAARPundertetracycline-inducibleexpressionsystem. primers 513A (59 GGC GGA TCC ATA TTG AGG AAT AAC Synchronized P. falciparum 3D7 ring stage parasites were AAAAGTCAT39)and514A(59GACAAGCTTATCTTCATT transfected with 100mg of purified plasmid DNA (Plasmid Maxi GTC TTC TTC ATC 39). The amplified fragment was digested Kit, Qiagen, Valencia, CA) by electroporation (310V, 950mF) with restriction enzymes BamHI and HindIIII and cloned in the [48] and the transfected parasites were selected over 2.5 nM of BamHI and HindIII sites of pET28a expression vector (Novagen). WR99210 drug inpresenceof 5 mMAnhydrotetracycline. The resultant plasmid pET28a-PfAARP-N was transformed into expression cells BLR(DE3) for expression of the recombinant Isolation of DNA, total RNA, real time quantitative PCR, protein. These E. coli BLR(DE3) cells were grown in Luria broth northern blot analysis containingtetracycline(25mg/ml)andkanamycin(100 mg/ml)at The genomic DNA was isolated from in vitro culture of P. 37uC with shaking to an OD of 0.6–0.7 and expression of 600 falciparum following a standard protocol [49]. Total RNAs were recombinant protein was induced with isopropyl-b-thioglactopyr- isolatedfromsynchronizedP.falciparum3D7parasiteculturesusing anoside (IPTG) at a final concentration of 1mM. The cultures miniRNAisolationkit(Qiagen).Analiquotof50ngoftotalRNA were further grown at 37uC for 3–4h and the E. coli cells were wasusedtosynthesizecDNAusingcDNAsynthesiskit(Invitrogen) harvestedbycentrifugation.Thecellpelletwassuspendedinlysis followingmanufacturer’srecommendations.Genespecificprimers buffer (20mM Tris pH 8.0, 500mM NaCl, 1 mM benzamidine were designed using Beacon Designer4.0 software, for the genes hydrochloride and 1% Tween 20) and the bacterial cells were PfAARP(535A,59AAcGAATGAAGAAGAGGAAGG39and lysed by sonication (Torebeo Ultrasonic Processor 36800, Cole 536A,59TCTCATACTTAAATCAATAAAGGAACC39), Parmer). The lysate was centrifuged at 15,0006g for 30min at EBA175(EBA175RTF:59AATTTCTGTAAAATATTGTGA 4uC and the supernatant was incubated with Ni-nitrilotriacetic CCA TAT G 39 and EBA175RTR: 59GAT ACT GCA CAA acid(Ni2+-NTA)agaroseresin(Qiagne),pre-equilibratedwiththe CAC AGA TTT CTT G 39) and Falcipain 2 (Fal2F 59- lysis buffer, at 4uC for 1hr. The suspension was applied to a GCTTGTAGGTTTT GGTATGAAAGAA-39 and Fal2 R 59 column and washed with 10 bed volumes of the wash buffer AGATAGGTCCCTTTTTAAAATACTATTGAC-39) [50]; 18S (20 mMTris-HCl,pH 8.0,250mMNaCl5 mMimidazole).The rRNAcontrolprimers(18SF59-GCTGACTACGTCCCTGCCC- bound protein was eluted with 15ml of elution buffer (20mM 39; 18SR 59-ACAATTCATCATATCTTTCAATCGGTA-39) Tris and 250mM NaCl) containing 50mM imidazole. The PLoSONE | www.plosone.org 10 March2008 | Volume 3 | Issue 3 | e1732