Logout succeed
Logout succeed. See you again!

Identification of a novel human mitochondrial endo-/exonuclease Ddk1/c20orf72 necessary for maintenance of proper 7S DNA levels. PDF
Preview Identification of a novel human mitochondrial endo-/exonuclease Ddk1/c20orf72 necessary for maintenance of proper 7S DNA levels.
3144–3161 Nucleic Acids Research, 2013, Vol. 41, No. 5 Published online 28 January 2013 doi:10.1093/nar/gkt029 Identification of a novel human mitochondrial endo-/exonuclease Ddk1/c20orf72 necessary for maintenance of proper 7S DNA levels Roman J. Szczesny1,2, Monika S. Hejnowicz2, Kamil Steczkiewicz3, Anna Muszewska3, Lukasz S. Borowski1, Krzysztof Ginalski3 and Andrzej Dziembowski1,2,* 1Institute of Genetics and Biotechnology, Faculty of Biology, University of Warsaw, Pawinskiego 5a, 02-106 Warsaw, Poland, 2Institute of Biochemistry and Biophysics, Polish Academy of Sciences, Pawinskiego 5a, 02-106 Warsaw, Poland and 3Laboratory of Bioinformatics and Systems Biology, CENT, University of Warsaw, Zwirki i Wigury 93, 02-089 Warsaw, Poland Received September 28, 2012; Revised December 27, 2012; Accepted January 3, 2013 ABSTRACT genome, synthesized in the cytoplasm and then imported into mitochondria (1). Human mitochondrial Although the human mitochondrial genome has DNA (mtDNA) contains 37 genes, of which 13 encode been investigated for several decades, the proteins proteins of the oxidative phosphorylation system, responsibleforitsreplicationandexpression,espe- whereas expression of the 22 provides tRNA species, cially nucleolytic enzymes, are poorly described. and two encode rRNAs necessary for mitochondrial Here, we characterized a novel putative PD- gene translation (2). Physically, the human mitochondrial (D/E)XK nuclease encoded by the human C20orf72 genome is a circular double-stranded DNA molecule gene named Ddk1 for its predicted catalytic organized in nucleoprotein structures referred to as residues. We show that Ddk1 is a mitochondrially nucleoids (3,4). The copy number of mtDNA varies de- pendingoncelltypeandmetabolicconditions.Theorgan- localized metal-dependent DNase lacking detect- ization of human mitochondrial genetic information is able ribonuclease activity. Ddk1 degrades DNA notable for its compactness. Mitochondrial genes lack mainly in a 30–50 direction with a strong preference introns and in most cases are separated by only a few for single-stranded DNA. Interestingly, Ddk1 nucleotides, or even overlap. The longest non-coding requires free ends for its activity and does not mtDNA fragment lies between the genes coding for degrade circular substrates. In addition, when a tRNAPro and tRNAPhe. This fragment, called the chimeric RNA–DNA substrate is provided, Ddk1 non-coding region (NCR), encompasses most of the cis- can slide over the RNA fragment and digest DNA regulatoryelementsinvolvedinmtDNAtranscriptionand endonucleolytically. Althoughthelevelsofthemito- replication (1,2). chondrial DNA are unchanged on RNAi-mediated Single-stranded DNA (ssDNA) arising from the NCR, depletion of Ddk1, the mitochondrial single- 7SDNA,hybridizestosomemtDNAmoleculestoforma triple-strandedstructure(D-loop).Althoughtheroleof7S stranded DNA molecule (7S DNA) accumulates. On DNAandtheD-loopremainsunclear,theD-loopmaybe the other hand, overexperssion of Ddk1 decreases a product of stalled or aborted mtDNA replication or the levels of 7S DNA, suggesting an important role could play a role in protein recruitment to the primary of the protein in 7S DNA regulation. We propose a control region (5). structuralmodelofDdk1anddiscussitssimilarityto The mitochondrial genetic system requires the activity other PD-(D/E)XK superfamily members. of various RNA and DNA nucleases. Moreover, on stimulation of cell death pathways, mitochondria are known to release several nucleases, including the promis- INTRODUCTION cuousnucleaseEndoG,whichhasbothDNaseandRNase Mitochondriaplayapivotalrolebothinthelifeofthecell activity and is involved in apoptosis (6). Some mitochon- anditsfate.Theiruniquefeatureisthattheircomposition drial RNases have also been identified, for example, and function depend on genes encoded by two physically RNase P (7) and tRNase Z (8), which process primary separate genomes—nuclear and mitochondrial. Most of mitochondrial RNA (mtRNA) and subsequently excise mitochondrial proteins are encoded in the nuclear tRNAs; PDE12, which deadenylates mt-mRNA (9,10); *To whom correspondence should be addressed. Tel:+48 22 592 2033; Fax:+48 22 592 2190; Email: [email protected] (cid:2)TheAuthor(s)2013.PublishedbyOxfordUniversityPress. ThisisanOpenAccessarticledistributedunderthetermsoftheCreativeCommonsAttributionNon-CommercialLicense(http://creativecommons.org/licenses/ by-nc/3.0/),whichpermitsunrestrictednon-commercialuse,distribution,andreproductioninanymedium,providedtheoriginalworkisproperlycited. NucleicAcidsResearch,2013,Vol.41,No.5 3145 PNPase, which degrades mtRNA (11); and RNase L, Here, we characterized a novel putative PD-(D/E)XK which is involved in stress-induced degradation of nuclease named Ddk1 based on its predicted catalytic mtRNA (12,13). However, it is clear that the list of mito- residues. We show that Ddk1 is a metal-dependent chondrial RNases is far from complete, but their identifi- nuclease that localizes to mitochondria and is necessary cation using proteomic, enzymatic or bioinformatic for proper level of 7S DNA. Ddk1 lacks detectable ribo- approaches has so far been unsuccessful (14). nucleaseactivityanddegradesDNAmainlyina30–50 dir- Although DNA is regarded as a stable, low turnover ection with a strong preference for single-stranded DNA. molecule, its replication, repair and recombination Interestingly, Ddk1 requires free ends for its activity. require the activity of nucleases. In humans, the exo-/ Finally, we propose a structural model of Ddk1 and endonuclease Dna2 was shown to localize to both the discuss its similarity to other PD-(D/E)XK superfamily nucleus (15) and mitochondria (15,16). In vitro studies members. indicated that Dna2 is a structure-specific nuclease that preferentially acts on forked and flap DNA substrates MATERIALS AND METHODS (17).Thissupports therole ofhDna2inmtDNA stability and maintenance. Functional studies showed Bioinformatic analysis that RNAi-mediated depletion of the helicase/nuclease A sequence search for Ddk1 homologs was performed hDna2 decreases replication intermediate levels and against the NCBI non-redundant protein database impairs repair of mtDNA damage induced by hydrogen using PSI-BLAST (37) (two iterations, E-value threshold peroxide treatment (15,16). In nuclei, Dna2 cooperates 0.005). The resulting set of 244 sequences was clustered with the endo-/exonuclease FEN1 to process long flap with CLANS (38) to visualize relationships between structures that can form during Okazaki fragment matur- Ddk1-like sequences and other closely related ation or DNA repair (18–21). The presence of FEN1 in PDDEXK_1 (PF12705) protein family members. human mitochondria is a subject of debate, with some Multiple sequence alignment of the identified protein se- reports supporting a mitochondrial localization (16,22) quences was derived using PCMA (39) and manually and others finding no evidence for mitochondrial FEN1 adjusted. The sequence-to-structure alignment between (23). Moreover, functional studies on the involvement of Ddk1-like proteins and selected distantly related struc- FEN1inmtDNArepairareinconsistent.Zhengetal.(16) tures was built using a consensus alignment approach showed that immunodepletion of FEN1 from mitochon- and 3D assessment (40) based on the results of driallysatesimpairsthecapabilityoftheextracttoprocess Meta-BASIC and 3D-Jury (41), as well as conservation substratesthatmimicDNAlesions,indicatingthatFEN1 of critical active site residues and hydrophobic patterns. functions in mtDNA repair. In contrast, Tann et al. (24) A3DmodelofhumanDdk1wasgeneratedwithModeller suggested that EXOG, but not FEN1, is responsible for (42) using the Escherichia coli RecE crystal structure long-patch base excision repair in human mitochondria. (pdbj3h4r) (43) as a template. Cellular localization of The former protein was identified as a paralog of the Ddk1-like proteins was predicted with MultiLoc (44), EndoG nuclease (25). EXOG was shown to localize to TargetP (45) and Mitoprot (46) web services. the mitochondrial intermembrane space and/or inner membrane (25) and has both exo- and endonucleolytic Plasmid construction activity that acts in a 50–30 direction with a preference DNA cloning was performed using procedures described for single-stranded DNA substrates (25). Taken in Supplementary Data. All constructs are listed in together,knowledgeofmitochondrialDNasesisfragmen- Supplementary Table S1. tary, and there are likely nucleases that are yet to be revealed. For example, 7S DNA has a high turnover Ddk1 purification and multiangle light scattering analysis rate (26–28), but its degrading enzyme remains unknown. Many nucleases, including Dna2, belong to the Ddk1wasoverexpressedinE.coliasanN-terminalfusion PD-(D/E)XK phosphodiesterase superfamily, which is a with a 6xHis and SUMO-containing tag and purified by large and diverse protein group that encompasses many affinity chromatography. The fusion protein was cleaved nucleic acid cleavage enzymes involved in important bio- using SUMO protease and subjected to gel filtration. A logical processes such as DNA restriction (29), tRNA detailed protocol for protein purification and determin- splicing (30), transposon excision (31), DNA recombin- ationofabsolutemolarmassbymultianglelightscattering ation (32), Holliday junction resolution (33), DNA (MALS) can be found in Supplementary Data. repair (34) and Pol II termination (35). The common Substrates conserved structural core of PD-(D/E)XK proteins consists of a central, four-stranded, mixed b-sheet 50-endlabelling ofsubstrateswasperformed using[g-32P] flanked on either side by an a-helix (with a abbbab adenosine triphosphate (Hartmann Analytic) with T4 topology) to form a scaffold that exposes the catalytic polynucleotide kinase (NEB) and 30-labelling was residues from the relatively conserved PD-(D/E)XK performed using terminal transferase (NEB) with [a-32P] motif (36). In addition to this motif, other conserved dATP, respectively. After labelling, oligonucleotides were residues often contribute to active site formation and subjected to phenol–chloroform extraction, precipitated play various catalytic roles that include coordination of and purified by denaturing or native polyacrylamide gel up to three divalent metal ion cofactors. electrophoresis for single- or double-stranded substrates, 3146 NucleicAcidsResearch,2013,Vol.41,No.5 Table 1. Oligonucleotides used in this study Name Length Sequence Producer/reference v81 34 TTGCCGATGAACTTTTTTTTTTGATCGAGACCTT FutureSynthesis/(48) 24DNA 24 CGACTGGAGCACGAGGACACTGAC FutureSynthesis/this study 44DNA 44 CGACTGGAGCACGAGGACACTGACATGGACTGAAGGAGTAGAAA FutureSynthesis/this study 44DNAcomp 44 TTTCTACTCCTTCAGTCCATGTCAGTGTCCTCGTGCTCCAGTCG FutureSynthesis/this study 44DNA-RNA 44 CGACTGGAGCACGAGGACACTGACAUGGACUGAAGGAGUAGAAA Metabion/this study 44RNA-DNA 44 CGACUGGAGCACGAGGACACUGACATGGACTGAAGGAGTAGAAA Metabion/this study 44RNA-DNA-RNA 44 CGACUGGAGCACGAGGACACTGACATGGACTGAAGGAGUAGAAA FutureSynthesis/this study 44RNA 44 CGACUGGAGCACGAGGACACUGACAUGGACUGAAGGAGUAGAAA Metabion/(49) 44RNAcomp 44 UUUCUACUCCUUCAGUCCAUGUCAGUGUCCUCGUGCUCCAGUCG Metabion/this study RNA17-5A 23 CCCCACCACCAUCACUUAAAAA Metabion/(50) RNA17-2A 19 CCCCACCACCAUCACUUAA Metabion/(50) 34RNA 34 CGACUGGAGCACGAGGACACUGACAUGGACUGAA FutureSynthesis/this study 22RNA 22 CGACUGGAGCACGAGGACACUG FutureSynthesis/this study 20RNA 20 CCCCACCACCAUCACAAAAA FutureSynthesis/this study Ribonucleotides are underlined. respectively, as previously described (47). To obtain Table 2. StealthRNA used in this study double-stranded substrates, before electrophoresis, labelled oligonucleotides were mixed with complementary Name Gene Oligo ID oligonucleotides, heated for 10 min at 95(cid:2)C and slowly Ddk1A DDK1 HSS132389 cooled to room temperature. For circularization, 50 Ddk1B DDK1 HSS132390 labelled 44DNA oligonucleotides were treated with EXOGA EXOG HSS115057 CircLigaseIIssDNAligase(Epicentre,CL9021K)accord- EXOGB EXOG HSS115058 ing to the manufacturer’s instructions and purified by FEN1A FEN1 HSS103627 FEN1B FEN1 HSS103629 urea–polyacrylamide gel electrophoresis (PAGE). The DNA2A DNA2 HSS141856 RNA ladder was obtained by alkaline hydrolysis of DNA2B DNA2 HSS141857 34RNA oligonucleotide using the Alkaline Hydrolysis TwinkleA Twinkle HSS125596 Buffer (Ambion 9750G) according to manufacturer’s rec- TwinkleB Twinkle HSS125597 Neg Negative control StealthTM RNAi ommendations.The1–24-ntDNAladderwaspreparedby Negative Control mixing 24 synthetic oligodeoxyribonucleotides: 24DNA Med GC and its truncated derivatives missing consecutive 30 residues. The mixtures were subjected to 50 end labelling with T4 polynucleotide kinase (NEB). Oligonucleotides were purchased from Metabion (Germany) or at 37(cid:2)C and 5% CO . Exogenous gene expression was 2 FutureSynthesis (Poland), and the sequences are listed in induced by addition of tetracycline (25ng/ml) to the Table 1. culture medium. Nuclease assays siRNA transfection Thestandardenzymaticassaywasperformedina20mlof HeLacellswereplatedtoreach40–50%confluencein24h mixture containing 10 pmoles of substrate, 0.5 pmole andsubjectedtoStealthRNA(Invitrogen)transfectionon Ddk1, bovine serum albumin (BSA) (0.1mg/ml), NaCl the next day. Transfections were performed using (125mM), MgCl (5.12mM), Tris–HCl pH 8.0 (10mM) Lipofectamine RNAiMAX (Invitrogen) according to the 2 and DTT (1mM). Mixtures differing from this standard manufacturer’s recommendations. The Stealth RNA were are described in the figure legends. Reactions were used at a final concentration of 10nM and are listed in incubated at 37(cid:2)C for the indicated time and terminated Table 2. When indicated, cells were passaged 2 days after by adding an equal volume of formamide loading dye transfection and subjected to a second round of transfec- [90% formamide, 20mM ethylenediaminetetraacetic acid tion on the next day according to the same protocol and (EDTA), 0.03% bromophenol blue, 0.03% xylene cyanol collected on the next 2 and 4 days. in 1(cid:3) TBE] and immediately frozen by immersion in liquid nitrogen. Reaction products were resolved on Establishing stable cell lines denaturing 12, 15 or 20% polyacrylamide, 8M urea, 1(cid:3) Stable cell lines were established using Flp-In 293 T-REx TBE gels and visualized using autoradiography. cells (Invitrogen) according to theprotocol described pre- viously (51). Cell culture Localization studies HeLa or Flp-In 293 T-REx cells (Invitrogen) were cultured in Dulbecco’s modified Eagle’s medium (Gibco) For localization of transiently expressed FLAG-tagged supplementedwith10%fetalbovineserum(FBS)(Gibco) Ddk1, HeLa cells were cultured on glass cover slips for NucleicAcidsResearch,2013,Vol.41,No.5 3147 24h,thentransfectedwithDdk1-FLAGencodingplasmid inwater.To analysethelevelof mtDNA, totalDNAwas (pRS570)usingtheTransIT(cid:3)LT2020reagent(Mirus)and digested overnight with NcoI and DraI (both from subjectedtoimmunofluorescencestainingonthenextday Fermentas), and 2mg were resolved by standard agarose as described previously (51). Cells were incubated with (1%) gel electrophoresis. Subsequently, the gel was MitoTracker Orange CMTMRos (100nM) (Molecular immersed and mixed for 0.5h in each of the following Probes) for 20 min at 37(cid:2)C, washed 2 times with phos- solutions: depurination (0.2M HCl), denaturation (1.5M phate buffered saline (PBS) and fixed with 3.7% formal- NaCl, 0.5M NaOH) and neutralization (0.5M Tris–HCl dehyde for 25 min at room temperature. All subsequent pH7.0,1.5MNaCl)withbriefrinsingwithwaterbetween stepswerecarriedoutatroomtemperature.Thecellswere solutions.DNAwastransferredtoaNytran-Nmembrane washedthreetimeswithPBSandpermeabilizedwith0.5% (Whatman Schleicher & Schuell BioScience) by overnight TritonX-100in10%FBS/PBSfor15min.Afterwashing upward capillary transfer using 10(cid:3) SSC (1.5M sodium withPBS,cellswereblockedwithPBSsolutioncontaining chloride, 150mM sodium citrate) and immobilized by 10% FBS for 30 min. Primary and secondary antibodies ultraviolet cross-linking. Hybridizations were performed were diluted with blocking solution. Cells were incubated overnight in PerfectHyb Plus buffer (Sigma) at 64(cid:2)C. with primary anti-FLAG M2 antibody (Sigma, 1:250) Mitochondrial and nuclear DNA was detected using for 1h. Following three washes with PBS, secondary [a-32P] dATP-labelled probes (Hartmann Analytic) com- antibodies conjugated with Alexa Fluor 488 were plementary to the ND2 and 28rDNA genes, respectively, applied at 1:900 (Molecular Probes) for 1h. Cells were and prepared by random priming with the HexaLabel washed three times with PBS, and the nuclei stained DNA Labeling Kit (Fermentas). Polymerase chain by a 5 min incubation in Hoechst 33342/PBS solution reaction products amplified with the following (1mg/ml) followed by a subsequent PBS wash. Cells were primers were used as templates for probe preparation: mounted in ProLong Gold antifade reagent (Invitrogen) ND2—RSZ266 taatacgactcactatagggtctgagtcccagaggttac and subjected to microscopy analysis. Microscopy was and RSZ267 atttaggtgacactatagaattcaggtgcgagatagtag; performed on a FluoView FV10i (Olympus) confocal 28rDNA—RSZ547 gcctagcagccgacttagaactgg and microscope with a 60(cid:3) water immersion objective RSZ548 ggcctttcattattctacacctc (28rDNA). To analyse (NA 1.2). The same procedure was used for Ddk1-FLAG 7S DNA, the same procedure was applied, except that localization in stable 293 cell lines except that cells were the total DNA was digested overnight with EcoRI cultured on poly-D-lysine coated glass cover slips, and (Fermentas) and before electrophoresis, samples were slideswereanalysedusingaFluoView1000confocalmicro- heated for 6 min at 95(cid:2)C and cooled on ice. To detect scope (Olympus) with a PLANAPO 60.0(cid:3)1.40 oil object- 7S DNA, a polymerase chain reaction product spanning ive. To analyse Ddk1-EGFP localization, HeLa cells were bp 16109–16437 of mtDNA was used as a template to transfected with the appropriate DNA construct (pRS572) prepare radiolabelled probes. Following hybridization, using the TransIT(cid:3) LT2020 reagent (Mirus). On the next Elters were exposed to PhosphorImager screens day, cells were incubated with MitoTracker Orange (FujiFilm) that were scanned using a Typhoon FLA CMTMRos (100nM) (Molecular Probes) for 20 min at 9000 scanner (GE Healthcare). 37(cid:2)C, washed once with culturing medium and twice with PBS and fixed with 3.7% formaldehyde for 25 min at Western blot room temperature. After washing twice with PBS and Proteinsampleswerepreparedandprocessedasdescribed staining the nuclei as described earlier in the text, cells previously (51) using anti-FLAG M2 (1:2000, Sigma, were mounted in ProLong Gold antifade reagent F3165) or anti-Ddk1 (c20orf72) antibodies (1:300, (Invitrogen) and subjected to microscopy analysis using Sigma, HPA040913). Primary antibodies were detected a FluoView FV10i (Olympus) confocal microscope with a withgoatanti-mouseoranti-rabbitperoxidaseconjugated 60(cid:3) water immersion objective (NA 1.2). secondary antibodies (Calbiochem) and visualized using an Immun-Star WesternC Chemiluminescence Kit Isolation of total DNA and Southern blot analysis (Bio-Rad) according to the manufacturer’s instructions. Total DNA was isolated by phenol–chloroform extrac- tion. Cells (2–3(cid:3)106) were harvested in RSB buffer (10mM Tris–HCl pH 7.4, 10mM NaCl, 10mM EDTA) RESULTS containing proteinase K (400mg/ml, Fermentas) and Protein identification, structural and phylogenetic analysis RNase A (150mg/ml, Sigma) and lysed by addition of sodium dodecyl sulphate (0.9%). The cells were then We recently performed exhaustive distant similarity incubated for 3.5h at 37(cid:2)C with gentle mixing every searches to identify new PD-(D/E)XK superfamily 15–20 min. After incubation, DNA was extracted by members in the human proteome (36). These searches sequential extraction with equal volumes of phenol, identified a protein of unknown function having two as- phenol–chloroform and chloroform solutions (all from partates and lysine (DDK) in the predicted catalytic site. Sigma). DNA was precipitated by mixing with 0.1 Consequently, the protein encoded by the C20orf72 gene volume of 10M ammonium acetate and 1 volume of iso- wasnamedDdk1.Insilicopredictionofthecellularlocal- propanol,incubatingfor30minatroomtemperature,and ization of Ddk1-like proteins suggested that they can be centrifugation (16400g, 30 min, 18(cid:2)C). The precipitated targeted to mitochondria (see later in the text). Thus, we DNA was then washed with 75% ethanol and dissolved subjected Ddk1 to more detailed studies. 3148 NucleicAcidsResearch,2013,Vol.41,No.5 Figure 1. Ddk1belongstothePD-(D/E)XK phosphodiesterasesuperfamily. (A)3Dmodelforthe PD-(D/E)XKnuclease domainofhumanDdk1 (gij14042227).CatalyticPD-(D/E)XKsignatureresiduesareshowninred,whereasotherpotentiallyimportantactivesiteaminoacidsaredenotedin green. Secondary structure elements forming the structural core of the fold are coloured yellow (b-strands) and blue (a-helices). (B) E. coli RecE (pdbj3h4r) nuclease domain (the closest homologue of known structure). Ddk1-like proteins group together hypothetical and inhibitors (MEROPS inhibitor family I1, clan IA) that uncharacterized proteins that are present exclusively in are predominantly encoded by metazoan genomes and Opisthokonta (Monosiga, Capsaspora and Metazoa) but inhibit S1 family serine proteases (SMARTjSM00280). are not observed in all Drosophila species. One-to-one Interestingly, Ddk1-like nucleases group with Archaeal orthologs can be found in most of the sequenced and phage (prophage) exonucleases (Figure S1B). chordate genomes, which indicates that this protein has Most of these phages belong to Caudovirales, which an evolutionarily conserved function. Ddk1-like proteins infect cyanobacteria and proteobacteria from which are a subgroup of the large PDDEXK_1 protein family mitochondria are thought to originate. As the mitochon- (PF12705) that clusters >5000 sequences, including drialproteomeisknowntohaveundergonemultiplegain, various helicases and exonucleases that are largely loss and replacement events in early eukaryotic evolution involved in double-strand break repair. (53), high similarity to phage proteins is a characteristic Ddk1sharessignificantsimilaritywithseveralexonucle- feature of some nucleic acid processing mitochondrial ases of known structure, including E. coli RecE exonucle- proteins. For example, RNA polymerase (POLRMT), ase(pdbj3h4r)(Figure1)(43),aputativeexonucleasefrom DNA polymerase (POLG) and helicase Twinkle E. rectale (pdbj3l0a) and the E. coli RecB nuclease (3,53–55) have replaced the original a-proteobacterial (pdbj1w36) (52) as indicated by the distant homology de- equivalents. The observed similarity between Ddk1-like tection method Meta-BASIC that assigned highly reliable proteins and phage proteins may suggest a similar evolu- scores of 142, 99 and 88, respectively (predictions with a tionary scenario. score >40 are expected to have <5% chance of being in- correct). Moreover, human Ddk1 and its homologs Ddk1 localizes to mitochondria conserve sequence motifs described in RecE by Zhang Protein sequence analysis suggested that Ddk1 may be et al. (43). In addition to Motifs II and III that provide targeted to mitochondria (Figure 2A). To test this theinvariantcatalyticresiduesofthePD-(D/E)XKsigna- possibility, the coding sequence of Ddk1 was cloned in ture (D238, D251, K253 in Ddk1) (Figure 1A and fusion with an EGFP-encoding fragment at the Ddk1 Supplementary Figure S1A), Ddk1-like proteins also C-terminus, and the fusion protein was transiently retain additional residues that are identical to those in expressed in human HeLa cells (Figure 2B). RecE and support the active site: E223 (Motif I), Q271 Mitochondria were stained using the mitochondria (Motif IV), Y275 (Motif IV) and H180 (Motif V) specific-dye MitoTracker. Microscopy analysis revealed (Figure 1A and Supplementary Figure S1A). that the subcellular distribution of EGFP-tagged Ddk1 Ddk1-like proteins, with the exception of sequences overlaps entirely with the MitoTracker-labelled from Tunicata and Nematoda, possess a (cid:4)100 amino mitochondria, indicating a mitochondrial localization of acids long variable and mostly unstructured region at Ddk1 (Figure 2B). Because the length of EGFP itself is the N-terminus. Consequently, most Ddk1-like proteins similartoDdk1andthusmayaffectDdk1localization,we harbour no additional domains. However, a hypothetical confirmed these results using a much shorter FLAG tag protein from Platynereis dumerilii (gij83318955) carries a (nine amino acids). The C-terminal FLAG-tagged Ddk1 Kazal domain found in Kazal-type serine protease was expressed in HeLa cells and detected using NucleicAcidsResearch,2013,Vol.41,No.5 3149 Figure 2. Ddk1localizestomitochondria.(A)BioinformaticpredictionofDdk1-likeproteinslocalization.Probabilityformitochondriallocalization isshown.Webservicesusedforanalysisareindicated.Ddk1-likeproteinsfromthefollowingorganismswereanalysed:Homosapiens,Musmusculus, Gallusgallus,Anoliscarolinensis,Daniorerio,Caenorhabditiselegans.(BandC)SubcellularlocalizationoftaggedDdk1proteininHeLacells.Cells weretransientlytransfectedwithplasmidsencodingC-terminalfusionofDdk1withEGFP(B)orFLAG(C).MitochondriaandnuclearDNAwas labelled with MitoTracker and Hoechst, respectively. The bar represents 10mm. immunofluorescence (Figure 2C) that also showed was tested using DNA substrates. Wild-type or mutated colocalization solely with MitoTracker-labelled mit- Ddk1 was incubated with a 50-labelled 34 nucleotide ochondria. These results show that Ddk1 is a mitochon- ssDNA substrate, and the products of the reactions were drial protein. resolvedusingdenaturingurea-polyacrylamidegelelectro- phoresis (Figure 3C). Incubation of substrates with Recombinant Ddk1 has metal-dependent wild-type, but not the mutated form of Ddk1, led to deoxyribonuclease activity in vitro rapid substrate degradation (Figure 3C), indicating that Ddk1 has deoxyribonuclease activity and confirming Ddk1 was classified as a member of the PD-(D/E)XK that the predicted catalytic residues (D251 and K253) phosphodiesterase superfamily. To determine whether Ddk1 has nuclease activity, it was heterologously are required for this activity. overexpressed in E. coli as an N-terminal 6(cid:3) histidine- Subsequently, the optimal conditions for Ddk1 in vitro SUMO tag fusion protein and purified using a two-step activity were determined, including the effect of ionic approach with affinity chromatography followed by size strength, pH and the presence of reducing agent. Ddk1 exclusion separation. Because the full-length protein was activity was pH-sensitive with the nuclease activity being insoluble (data not shown), an N-terminal hydrophobic weakest at the lowest tested pH (6.8) and increasing with fragment corresponding to the predicted mitochondrial pH (Supplementary Figure S2). Further reactions were localization signal was deleted. This truncated Ddk1 performed using pH 8.0 at which Ddk1 has high activity lacked the 21 N-terminal amino acids and was purified and which corresponds to the estimated pH of the mito- to near homogeneity (Figure 3A). The protein exists as a chondrial matrix (56,57). Similarly, the presence of monomer as revealed by its migration on size exclusion reducing agent (DTT or beta-mercaptoethanol) also chromatography (data not shown), and this finding was affected Ddk1 activity, although to a lesser extent than confirmed by determining its absolute molecular mass pH (Supplementary Figure S2). Ddk1 is active across a using MALS (Figure 3B). The measured mass of Ddk1 broad range of monovalent cation (Na+or K+) concen- (37.2±1.4kDa) corresponds to that calculated for trations (>15mM, <200mM) and showed the highest the monomeric form of the protein (37kDa). In add- activity (cid:4)125mM salt concentration (Supplementary ition to the wild-type version of Ddk1, a mutated form Figure S2). To establish what concentration of divalent having substitutions at the predicted catalytic residues metal ions is optimal for reaction catalysed by Ddk1, we (D251N K253A) was also cloned and purified (Figure assessedDdk1activityinthepresenceofvariousamounts 3A). The mutated protein behaved as wild-type during of magnesium or manganese chloride (Supplementary purification. Figure S3), which both supported Ddk1 activity. The AlthoughbothDNasesandRNasescanbefoundinthe activity was higher in the presence of Mg2+ ions, with PD-(D/E)XK phosphodiesterase family, most members the optimal Mn2+ concentration (0.16mM) being one have deoxyribonuclease activity. Therefore, in the initial order of magnitude lower than the optimal Mg2+concen- experiments with Ddk1, the activity of purified proteins tration ((cid:5)2.56mM). Within a range of tested 3150 NucleicAcidsResearch,2013,Vol.41,No.5 Figure 3. PurifiedDdk1 isactiveinvitro.(A)Electrophoreticanalysisofpurifiedwild-typeormutatedDdk1. Increasingamountsofproteinswere loaded. Arrow indicates purified protein. (B) Multiple angle light scattering analysis of purified wild-type Ddk1. Curves represent: measured mass (black),detectedsignalat280nm(grey),voltage(lightgrey).(C)DNaseactivityofpurifiedproteinswastestedusingsingle-stranded50 labelledv81 substrate.Reactionswereperformedinstandardconditionsfortheindicated timewiththeexceptionthatalargeexcess oftheenzyme(0.5pmole) over substrate (0.06 pmole) was used. Samples were analysed using 15% urea–PAGE. concentrations(0.005–10.24mM),Ddk1activityincreased wild-type Ddk1 and not their mutated form, confirming concomitantly with the Mg2+concentration, whereas for that they arose owing to Ddk1 nucleolytic activity Mn2+, deviations from the optimal concentration (Figure 4A). In contrast, RNA substrates were not inhibited the activity (Supplementary Figure S3). The cleaved by Ddk1 (Figure 4B), which was unable to presence of metal ions is a pre-requisite for Ddk1 degrade 44-nt/bp single-stranded, double-stranded RNA activity, as their depletion with chelating agent (EDTA) or RNA hybridized to DNA (Figure 4B), even though completely abolishes its activity (Supplementary Figure anssDNAsubstratewasdegradedinareactionperformed S3).Interestingly,theactivityofDdk1istemperaturesen- simultaneously. To exclude the possibility that Ddk1 is sitive in the absence of BSA. Incubation of the enzyme specific for short RNAs and/or adenylated molecules, we without BSA for 20 min at 37(cid:2)C leads to its complete tested its activity using a 17-nt RNA substrate containing inactivation (Supplementary Figure S4); however, shortadeninetails.WedetectednoDdk1activitytowards addition of BSA to a reaction mixture stabilizes Ddk1 these oligoribonucleotides, although the activity of the activity (Supplementary Figure S4). protein towards DNA substrates was confirmed at the Human mitochondria contain both single-stranded (7S same time (Supplementary Figure S5). DNA) and double-stranded DNA molecules (full-length We thus concluded that Ddk1 is a deoxyribonuclease mitochondrial genome). Moreover, mammalian mtDNA, in vitro and has no detectable ribonuclease activity. including human, can also have stable tracts of DNA– RNA hybrids (R-loops) (58–61). Therefore, we tested Ddk1 is a linear substrate-specific endo-/exonuclease that acts from both substrate ends whether Ddk1 could be involved in the metabolism of each type of mentioned molecules. Ddk1 was incubated Many known nucleases act only in one direction. To in- forvaryingtimeswiththefollowinglinear44-nt/bplength vestigatewhetherDdk1manifestssuchpolarity,wetested substrates: ssDNA, blunt-ended dsDNA or DNA/RNA itsactivityusing44-ntssDNAsubstrateslabelledateither hybrid and reactions products were analysed on the 50- or 30-end (similar data were obtained using 80-nt denaturing PAGE (Figure 4A). Although Ddk1 ssDNA, data not shown). We assumed that detection of degraded all tested substrates, it displayed a (cid:4)10-fold partially degraded substrates only in the case of 50- or higher efficiency towards ssDNA in comparison with 30-labelled substrates would indicate that the enzyme dsDNA (Figure 4A). DNA/RNA substrate was even less works only in one direction. Detailed analysis revealed efficiently degraded than dsDNA (Figure 4A). Reaction the presence of partially degraded substrates in both products were observed only in samples containing cases (Figure 5A and Supplementary Figure S6 for NucleicAcidsResearch,2013,Vol.41,No.5 3151 Figure 4. Ddk1hasdeoxyribonuclease,butnotribonucleaseactivity.Denotedsubstrateswereincubatedwithwild-typeormutated(D251NK253A; Mut) Ddk1 in standard conditions for the indicated time and analysed on 15% urea–PAGE. 50-labelled 44DNA (A) or 44RNA (B) substrate in a single-strandedformorannealedtocomplementaryDNA(44DNAcomp)orRNA(44RNAcomp)wasanalysed.(A)Numbersrepresenttheamount of the final product generated in samples incubated for 20, 60 and 90min. Amounts were quantified by dividing the intensity of the signal corres- pondingtothefinalproductonlybythetotalintensitymeasuredinthreeentireanalysedlanes(i.e.sumofproduct,degradationintermediatesand final product). 3152 NucleicAcidsResearch,2013,Vol.41,No.5 longer exposure), suggesting that Ddk1 functions in both activity on a circular single-stranded substrate. However, directions. However, the amount of degradation inter- itwaspossiblethatDdk1couldhavesuchactivitytowards mediates was much higher for 50- than 30-labelled sub- linear substrates. strates (Figure 5A and Supplementary Figure S6), Totestthispossibility,weanalysedDdk1activityusing indicating that Ddk1 preferentially acts in the 30–50 direc- a 50-labelled single-stranded substrate composed of DNA tion.Moreover,ourdatasuggestthatDdk1isaprocessive flanked by RNA on both sides (RNA–DNA–RNA) enzyme, as the final digestion product is clearly visible (Figure 6B). As Ddk1 is incapable of RNA hydrolysis, while a large fraction of the substrate remains intact the appearance of degradation products would demon- (Figure 5A). strate Ddk1 endodeoxyribonuclease activity. Analysis of To confirm this directionality, we performed an experi- reaction products showed the presence of a partially ment that takes advantage of Ddk1’s inability to degrade degraded RNA–DNA–RNA substrate in which the RNAbyusingchimericsubstratescomposedofDNAand DNA was degraded while the RNA remained intact, sup- RNA fragments with labelling at the 50 end (Figure 5B). porting the ability of Ddk1 to catalyse endonucleolytic Two substrates with RNA at the 50 or 30 end were used cleavage (Figure 6B). Importantly, in a parallel control withtheexpectationthat,iftheenzymehasexonucleolytic reaction in which a RNA substrate was used, no Ddk1 activityandoperatespreferentiallyinonedirection,oneof activitywasobserved(Figure6B),whichexcludesthepos- thesubstrateswouldbedegradedwithverylowefficiency. sibility that the detected degradation of the RNA–DNA– Unexpectedly, the amount of full-length chimeric sub- RNA substrate resulted from RNA cleavage (Figure 6B). strate was decreased at a similar rate for both cases Similar to the previous analysis (Figure 5B), the presence (Figure 5B). Importantly, no degradation was observed of ribonucleotides at the end of the RNA–DNA–RNA in reactions carried out with inactive Ddk1D251N, K253A substrate precludes its complete degradation by Ddk1 (Figure 5B). In agreement with previous data showing (Figure 6B). However, in this case, the enzyme leaves that Ddk1 has no ribonuclease activity, the pattern of not two (Figure 5B), but one deoxyribonucleotide in the reaction products indicated incomplete degradation of final degradation product. chimeric substrates with labelled RNA at the 50 end. Finally, we determined the size of the end product of Comparison of reaction products with a reference RNA DNAseactivityofDdk1.AnssDNAsubstratewastreated fragment of the same length as the one present in the with Ddk1, and the migration of reaction products was chimeric RNA–DNA substrate, as well as to an RNA compared with a DNA ladder. This revealed that the ladder, showed that the major final product contained major final product is 2 nucleotides in length, which is two deoxyribonucleotides downstream of the RNA the same as observed for yeast EXO5 (48) (Figure 6B). fragment (Figure 5B). A similar feature was observed for Overall, we conclude that in vitro Ddk1 is a processive another PD-(D/E)XK nuclease EXO5 (48). The second endo-/exodeoxyribonuclease that preferentially acts from substrate (DNA–RNA) seemed fully degraded because the30tothe50end.Moreover,itrequiresafree30and/or50 the DNA portion of the molecule that was labelled can end for activity. be hydrolyzed; however, as Ddk1 has no RNase activity, we assume that the RNA portion remains, although not Silencing of DDK1 increases the level of 7S DNA visible in the autoradiogram (Figure 5B). Together, the results suggest that Ddk1 can function in both directions. WenextusedRNAinterferencemethodologytostudythe However, they did not exclude the possibility that this functionofDdk1invivo.HeLacellsweretransfectedwith enzyme functions preferentially from the 30 to 50 end and two different siRNAs specific for the DDK1 gene or has endonucleolytic activity. In this case, a substrate control siRNA designed not to affect expression of any having RNA at the 30 end would be efficiently degraded humangene.SilencingofDDK1geneexpressionwascon- evenifDdk1hadnoactivityinthe50–30direction.Internal firmed using western blot (Figure 7A). As biochemical cleavage of DNA would thus provide the substrate for studies of Ddk1 indicated that the protein might be exodeoxyribonucleolytic activity. involved in mtDNA metabolism, we used Southern To examine whether Ddk1 has endonuclease activity, blotting to measure mtDNA levels after DDK1 silencing the enzyme was incubated with radioactively labelled (Figure 7B). We observed no significant changes in single-stranded circular DNA or its linear counterpart, mtDNA levels 3 days after siRNA transfection and reaction products were analysed by electrophoresis (Figure 7B). Because the effect on mtDNA level might (Figure 6A). The nature of the substrates was confirmed require longer periods of Ddk1 depletion, we performed using exonuclease I and endonuclease DNase I an experiment in which cells were re-transfected with (Figure6A).Asthetypeofreactioncatalysedbynucleases siRNA 3 days after the first transfection and collected maydependonthetypeofionspresent[e.g.theribonucle- after an additional 2 and 4 days. Again, Southern aseDis3catalysesexo-orendonucleolyticreactionsinthe blotting revealed no changes in mtDNA levels even 7 presenceofMg2+orMn2+,respectively(62,63)],reactions days after siRNA transfection (Supplementary Figure were performed in the presence of magnesium or manga- S7A). Using the same experimental procedure, we were nese. The analysis of reaction products showed that even able to demonstrate that silencing of the helicase excess amounts of Ddk1 are unable to degrade circular Twinkle, a well-known factor involved in mtDNA repli- substrates (Figure 6A). Under the same conditions, the cation (64), results in mtDNA depletion, as expected corresponding linear substrate was efficiently degraded (Supplementary Figure S8). Therefore, we conclude that (Figure 6A), indicating that Ddk1 has no endonuclease withinthelimitedtimeframeofourexperimentalstrategy, NucleicAcidsResearch,2013,Vol.41,No.5 3153 Figure 5. Ddk1 can act in both directions. (A) Ddk1 activity was assayed using 50- or 30-labelled single-stranded 44DNA substrate and (B) 50 44RNA–DNA, 44DNA–RNA chimeric substrates and 44DNA, 44RNA substrates. Dashed rectangle marks the region of the gel subjected to quantitative analysis (graph, right). An RNA ladder and a reference RNA fragment (22RNA) were also resolved. (A and B) Reactions were performed in standard conditions using indicated amounts of the enzyme for indicated times. Products were resolved using 20 (A) or 15% (B) urea–PAGE.