loading

Logout succeed

Logout succeed. See you again!

ebook img

Impact of selenium supplementation on fish antiviral responses PDF

pages26 Pages
release year2016
file size2.7 MB
languageEnglish

Preview Impact of selenium supplementation on fish antiviral responses

Pacittietal.BMCGenomics (2016) 17:116 DOI10.1186/s12864-016-2418-7 RESEARCH ARTICLE Open Access Impact of selenium supplementation on fish antiviral responses: a whole transcriptomic analysis in rainbow trout Oncorhynchus mykiss ( ) fed supranutritional levels of Sel-Plex® D. Pacitti1,4, M. M. Lawan2, J. Feldmann2, J. Sweetman3, T. Wang1, S. A. M. Martin1 and C. J. Secombes1* Abstract Background: Selenium(Se)isrequiredforthesynthesisofproteins(selenoproteins)withessentialbiologicalfunctions. Selenoproteinshaveacrucialroleinthemaintenanceofcellularredoxhomeostasisinnearlyalltissues,andarealso involvedinthyroidhormonemetabolism,inflammationandimmunity.SeveralimmuneprocessesrelyonSestatusand canbecompromisedifthiselementispresentbelowtherequiredlevel.Previousworkhassupportedthenotionthat whenSeisdeliveredatlevelsabovethosedeemedtobetheminimalrequiredbutbelowtoxicconcentrationsitcan haveaboostingeffectontheorganism’simmuneresponse.BasedonthisconceptSe-enrichedsupplementsmay representavaluableresourceforfunctionalfeedsinanimalfarming,includingaquaculture. Results:InthisstudywetestedtheeffectsofSesupplementedasSel-Plexduringanimmunechallengeinducedby polyinosinic:polycytidylicacid(poly(I:C)),apathogen-associatedmolecularpattern(PAMP)thatmimicsviralinfection. Troutwerefedtwodietsenrichedwith1or4mgSeKg−1offeed(dryweight)bySel-Plexadditionandacommercial formulationascontrol.Thewholetrouttranscriptomicresponsewasinvestigatedbymicroarrayandgeneontology analysis,thelattercarriedouttohighlightthebiologicalprocessesthatwereinfluencedbySel-Plexsupplementationin theheadkidney(HK)andliver,themainimmuneandmetabolicorgansinfish.Overall,Sel-Plexenrichementupto 4mgSeKg−1inducedanimportantresponseinthetroutHK,elicitinganup-regulationofseveralgenesinvolvedin pathwaysconnectedwithhematopoiesisandimmunity.Incontrast,amoreconstrainedresponsewasseenintheliver, with lipid metabolism being the main pathway altered by Se supplementation. Upon stimulation with poly(I:C), supplementationof4mgSeKg−1increasedtheexpressionofprincipalmediatorsoftheantiviraldefences,especially IFN-γ,anddown-streammoleculesinvolvedinthecell-mediatedimmuneresponse. Conclusions:Supplementationofdietswith4mgSeKg−1usingSel-Plexremarkablyimprovedthefishresponsetoviral PAMPstimulation.Sel-Plex,beingahighlybioavailablesupplementoforganicSe,mightrepresentasuitableoptionfor supplementationoffishfeeds,toachievethefinalaimofimprovingfishfitnessandresistanceagainstimmune challenges. Keywords:Seleniumsupplementation,Sel-Plex,Poly(I:C),Immuneresponse,Antiviralresponse,Microarray,Fish *Correspondence:[email protected] 1ScottishFishImmunologyResearchCentre,InstituteofBiologicaland EnvironmentalSciences,UniversityofAberdeen,AberdeenAB242TZ,UK Fulllistofauthorinformationisavailableattheendofthearticle ©2016Pacittietal.OpenAccessThisarticleisdistributedunderthetermsoftheCreativeCommonsAttribution4.0 InternationalLicense(http://creativecommons.org/licenses/by/4.0/),whichpermitsunrestricteduse,distribution,and reproductioninanymedium,providedyougiveappropriatecredittotheoriginalauthor(s)andthesource,providealinkto theCreativeCommonslicense,andindicateifchangesweremade.TheCreativeCommonsPublicDomainDedicationwaiver (http://creativecommons.org/publicdomain/zero/1.0/)appliestothedatamadeavailableinthisarticle,unlessotherwisestated. Pacittietal.BMCGenomics (2016) 17:116 Page2of26 Background for the regulation of cellular redox status during an im- Selenium (Se) is an essential element in human and ani- mune response [14]. Tight control of radical oxygen spe- mal nutrition [1, 2]. Se deficiency is an endemic problem cies (ROS) produced during an immune challenge is in several parts of the world, that can affect both human crucialtoguaranteeeffectiveresponsestopathogens.ROS and livestock health. A low intake of this element can are generated in the early stage of immune activation and cause physiological dysfunctionand may maketheorgan- they function as mediators of intracellular signalling, as ism more susceptible eithertoinfection or environmental wellasparacrinemessengersforimmunecellrecruitment stressors[3,4].Sesupplementationinfarmedanimalfeed [15].ROSalsohaveamicrobial killing function in phago- may counteract problems caused by deficiency of this cyticleukocytes,suchasmacrophagesandneutrophils,i.e. mineral but also ameliorate the physiological response to via the oxidative burst [16]. However, oxygen radicals at infection, inflammatorydisorders and stress[5]. However, highlevels are cytotoxicbioproductscapableofdamaging Sesupplementationisstillcontroversial,because1)Sehas lipids, proteins and nucleic acids [17]. Se incorporated a narrow range between nutritive requirements and tox- within selenoproteins exerts its antioxidant activity by icity, 2) nutritional requirements may vary considerably maintainingthebalancebetweenthepositiveandnegative across species and 3) physiological conditions within an effects of ROS [14]. Other selenoproteins, strictly related organism, as well as environmental factors, can influence to inflammation and immunity, include the endoplasmic thedietaryneedsforthismineral. reticulum (ER) transmembrane proteins selenoprotein K Previous studies suggest that fish require between 0.1 (SelK) andS(SelS), whicharebothinvolved inprotection and 0.5 mg Kg−1 Se (dry mass): according to these data, of cells towards ER stress. SelS appears to be involved in fishcanregulateSebioaccumulationthroughexcretionup retrograde translocation of misfolded proteins from the to 3 mg Kgˉ1 (dry mass) but beyond this level Se starts to ER[18],whereasSelKisrequiredforCa2+fluxduringthe exert detrimental effects [6–8]. In accordance with these activation of different immune cell types (such as Tcells, studies, the European Union has legislated that if add- neutrophils,andmacrophages)[19]. itional Se is added to feed, the total level must not exceed Previous studies support the possibility that Se supple- 0.5 mg Kg−1 (dry mass) (Commission Regulation EU No mentation can have beneficial and boosting effects on an 432/2012). However these studies need to be updated as organism’s immune response. In this context, Se-enriched theyareprimarlybasedonfeedingtrialsusinginorganicSe feed additives have become an attractive resource for for- (mainly sodium selenite, Na SeO ) as supplement. Recent mulation of functional feeds for animal farming, including 2 3 evidence suggests that organic Se is more bioavailable and aquaculture. However, the use of Se supplementation to tolerated at higher concentrations than inorganic Se [9], improvefarmedfishdefencestowardsinfectionsisstillcon- whereselenomethionine(SeMet)iscurrentlythemostpre- troversial, since it is difficult to determine in different spe- ferredalternativeforsupplementation. cieswhichlevelcanbebeneficialbeforedetrimentaleffects An increasing number of feed suppliers for the aquacul- due to Se toxicity occur. From our previous study in rain- tureindustry are beginning to substitutefish meal and fish bow trout [20] it was clear that Se supplemented as Se- oil with plant sourced materials, which may further lower yeast (Sel-Plex) is well absorbed up to 8 mg Se Kg−1 (dry Se (and other oligonutrients) availability in fish diets. It is mass) without causing any evident sign of toxicity. In important that the diet formulations meet the mineral nu- addition the metabolic response of trout to Sel-Plex shows tritionalrequirementsoffishasthisiscrucialtoensureop- aclearchangeintheprofileofselenocompoundaccumula- timal growth and production efficiency in fish farming. In tion with increasing concentration of Sel-Plex inclusion: at line with this reasoning, a recent study carried out in sea concentrations≥4mgSeKg−1therewasevidentaccumula- bass (Dicentrarchus labrax) showed that fish may benefit tion of selenocysteine (SeCys) over SeMet, which may ac- from organic Se supplementation up to 5 mg Kg−1 (dry count for the higher selenoprotein synthesis (Lawan, pers mass) in the diet during larval development, due to en- observation). However, when the transcriptomic response hanced antioxidant protection during muscle development of several selenoproteins was analysed, a higher induction [10]. Other investigations in trout have shown that farmed oftheirmRNAexpressionwasseenprimarlywhen0.5and fish may require a higher content of Se in their diet, espe- 4 mg Kg−1 of Se was added to the diet. For continuity of cially when subjected to stress caused by crowded condi- these investigations, in this study we tested the effects tions.Introut,ithasbeenreportedthattheSerequirement of Sel-Plex supplementation during an immune chal- can increase up to 4 mg Kg−1 (dry mass) when the fish is lenge induced by poly(I:C), a double stranded RNA that subjectedtostressandahightolerancecanbeensuredifit mimics a viral infection. The whole trout transcrip- isdeliveredinanorganicform[11,12]. tomic response was investigated by microarray analysis Se plays an important role within the immune system and gene ontology (GO) analysis, the latter carried out to [5, 13]. Selenoproteins such as glutathione peroxidases highlight the biological processes that were most influ- (GPxs)andthioredoxinreductases(TrxRs)areresponsible enced by Sel-Plex supplementation in the head kidney Pacittietal.BMCGenomics (2016) 17:116 Page3of26 (HK) and liver, the principal immune and metabolic or- barrels.ThepelletsobtainedweredriedO/Nat35°Cina gansinfish,respectively. forcedaircirculator. Six fish per tank (ie 25 % of total fish used) were Methods weighed at the beginning of the feeding trial, and after Fishmaintenanceandexperimentaldesign two, four, six and eight weeks, and the average body All procedures were carried out under the UK Animals weight was recorded to allow adjustment of the feed (Scientific Procedures) Act 1986 and Home Office code quantity given. We have previously shown that at these of Practice guidance, under Home Office project license inclusionlevelsthereisnoimpactonfishgrowth(Pacitti PPL 60/4013, approved by the ethics committee at the et al., 2015). Fish were fed twice daily, an amount equat- UniversityofAberdeen. ing to 2 % of the average body weight. With fish of this Rainbow trout (~75 g) were obtained from Mill Trout size itistypical tokeep the feeding ration constant, asin Farm (Almondbank, Perth, UK) and kept in 1-m- this study. After ten weeks, ten fish from each tank were diameter fiberglass tanks supplied with recirculating injected with PBS and ten with 1.25 mg of poly(I:C) freshwater at 15±1 °C, containing 50 mg/l of dissolved (Sigma-Aldrich). For the poly(I:C) preparation, 100 mg oxygen, within the aquarium facilities in the School of were dissolved in 36 ml of nuclease-free water (Sigma- BiologicalSciences,UniversityofAberdeen.Forthefeeding Aldrich) plus 4 ml of 10X PBS (2.5 mg/ml final poly(I:C) trial, 216 fish were distributed in nine tanks; three tanks concentration), and 0.5 ml was injected intraperitoneally were assigned to each diet, giving 72 fish per diet (i.p.) into each fish. Fish injected with PBS and poly(I:C) group. After an acclimatization period of four weeks, a ten were marked differently using a panjet containing 2 % week feeding trial was carried out. Three diets were used: alcian blue (Sigma-Aldrich). Nine fish injected with PBS the acclimatization diet as control and two diets enriched and nine fish injected with poly(I:C) from each tank were with Sel-Plex to give an additional 1 or 4 mg Se Kg−1. All killed 24 h post injection for tissue harvest, a time previ- the diets were prepared by the Hellenic Centre for Marine ously shown by us to be optimal for in vivo gene expres- Research,Greece(HCMR,www.hcmr.gr)andthe compos- sion changes following i.p. injection of a PAMP such as itionisgiveninTable1andAdditionalfile3:TableS1.All poly(I:C) or recombinant cytokines [21–24]. All fish were the components were kept constant with the exception of killed by a schedule 1 method (http://www.nc3rs.org.uk/) thewheatmealandwheatglutenthatwerereducedinpro- inallexperiments. portion to the Sel-Plex addition (ie to ensure the oil and Liver and HK were placed on dry ice and subsequently protein content were the same between diets). Briefly, the processed for RNA extraction, and a portion of liver was vitamins and Sel-Plex were stirred in a small mixer (Ken- placedondryiceandfurtherprocessedforSebioaccumu- woodKM260),whilsttheremainingrawmaterials(exclud- lationanalysis. ingthefishoil)wereplacedinalargemixer(HobartA200 DT). After mixing for 15 min, the two components were combined together in the large mixer for an additional SebioavailabilityfromdietandSebioaccumulationin 15 min before adding the fish oil, and mixing for a further tissues 15min.Themixturewasextruded(ClextralEV0A107)at For total Se analysis of the diets and trout tissues, 50 °C, 70 °C, 80 °C, 91 °C and 100 °C, in five consecutive 100 mg of the lyophilized pellets/organs (three replicates of each) were weighed in a 50 ml Teflon vessel. 1 ml of Table1Dietaryformulationoftheexperimentaldiets.Allthe nitric acid was added to each vessel containing the sam- valuesareingKg−1 ples and allowed to stand overnight before 2 ml hydro- Acclimatizationdiet Dietsupplwith Dietsupplwith gen peroxide was added to the vessel, which was closed Controldiet 1mgSeKg−1 4mgSeKg−1 to prevent analyte loss. The samples were digested using a CEM mars microwave digester. The samples were Fishmeal 100 100 100 brought to 20 ml and analysed using inductively coupled Wheatmeal 198 199.5 198 plasma mass spectrometry (ICP-MS). The ICP-MS was Corngluten 190 190 190 operated with a forward power of 1380 W under normal Soya 160 160 160 conditions,withnickelsamplerandskimmercones.Car- Fishoil 173 173 173 rier gas flow was 1.27 L/min, coolant gas flow 14 L/min Wheatgluten 174 172 172 and nebuliser gas flow 0.86 L/min. Total Se concentra- tion was determined by monitoring 77Se and 78Se iso- Vitaminsand 5 5 5 minerals* topes by external calibration. Germanium was used as Sel-Plexaddition - 0.5 2 aninternalstandard.In ordertoevaluatetheaccuracyof (@~2mgSeg−1) the method, total selenium content in dogfish muscle *VitaminsandmineralscompositionisprovidedinAdditionalfile3:TableS1 (DORM – 2) was measured at the end of each time Pacittietal.BMCGenomics (2016) 17:116 Page4of26 point analysis and the percentage recovery range deter- measured. A preliminary qPCR screening was carried minedwasbetween99.5–102%. out to determine which of the two groups fed supra- nutritional levels of Sel-Plex showed a more significant RNAisolation response to the treatment. The expression of selected RNAwasextractedfrom100mgtissuebyhomogenization selenoprotein transcripts and mediators of the antiviral in1.4mlTRIzol(Sigma-Aldrich)usingastainlesstungsten response were measured, and based on these results one carbidebead(5mm,Qiagen)andtheTissueLyserIIsystem of the two experimental diet groups was selected to (Qiagen), at 30 Hz for 3 min. To extract RNA from the compareagainst the control. homogenate,300μl ofchloroformwasaddedtothetissue The experimental design (Additional file 1: Figure S1) lysates. The aqueous phase containing RNA was trans- was a common reference design for which the reference ferred to a fresh RNase-free 1.5 ml tube containing an sample was an equal mixture of all the experimental sam- equal amount of chilled isopropanol (Sigma-Aldrich). The ples and antisense RNA (aRNA) from the experimental RNA pellet was washed in 900 μl 70 % molecular grade groupswashybridizedagainstthiscommoncontrolaRNA ethanol (VWR International), air-dried and dissolved in sample. The experimental samples were a pool of equal 20μlofnuclease-freewater. amounts of RNA extracted from three different fish fed a Total RNA was first quantified by spectrophotometry control diet or a diet enriched with 4 mg Se Kg−1, and (ND-1000, NanoDrop) and the integrity of all the samples injectedwithPBSorpoly(I:C)(atotaloffourexperimental wasdeterminedusingRNANanoChipsandtheRNA6000 groups), with each fish from one of the three tanks NanoAssayKit(Agilent),withanAgilent2100bioanalyzer assignedperdiet.TheRNAwaspooledpriortotheaRNA (Agilent).TheRNAwasstoredat−80°Cuntilrequired. amplification. The aRNA was amplified using a Messa- geAmp™ aRNA Amplification Kit (Ambion). Briefly, 2 μg QuantitativePCR(qPCR) of total RNA was reverse transcribed and the cDNA was First strand cDNA was synthesized from 2 μg of total usedasatemplateforinvitrotranscriptioninthepresence RNA using 1 μl RevertAid™ reverse transcriptase (10,000 ofamiloallylmodifieddUTP,whichallowedthegeneration U, Fermentas) in the presence of 5 μl 5X Reaction Buffer, of amplified aRNA. For labelling, 3 μg aRNA was denatu- 1 μl dNTP (Bioline), made up to a final volume of 25 μl ratedat70°Cfor2mininavolumeof10μgtowhich3μl withwaterandincubatedat42°Cfor2h. of 0.5 M NaHCO (pH 9.0) and a 2 μl aliquot of Cy dye 3 QPCR was performed with a LightCycler 480 (Roche) (Dye Cy3™ and Cy5™ mono-reactive dye pack, Amersham toquantifytheexpressionofselected selenoproteintran- PA23001-PA25001) was added. Incorporation of dye was scripts and a set of common reference genes using the performedfor1hat25°C inthedark, and afterwardsex- primers given in Table 2. The primers employed for cess label was removed using a DyeExTM 2.0 spin kit qPCR were designed with at least one primer across a (QIAGEN).Thequantityofeachlabelleddyewaschecked predicted intron and pre-tested to ensure that each pri- using spectrophotometry (ND-1000, NanoDrop), and the mer pair could not amplify genomic DNA using the labelledaRNAwaseitherhybridizedimmediatelyorstored qPCR protocols. The qPCRs were performed in dupli- at−80°C. cate for each sample, along with a 10-fold serial dilution Themicroarraycommoncontrolwascreatedbymixing of references consisting of an equimolar mix of purified equal amounts of aRNA from every sample included in PCR products of each gene amplified from cDNA. The the experiment. The common control was labelled with transcript level was calculated using the quantitative fit Cy5, whereas the samples were labelled with Cy3 (de- points method in the integrated LightCycler 480 soft- scribed below). The four experimental groups were dis- ware. Thus, the relative expression level of the candidate tributedonthefourarraysofanAgilent4x44Kslide,with genes in different tissues was expressed as arbitrary differentreplicatesacrossslides.Atotaloffiveslideswere units, which were calculated from the serial dilution of usedforeachorgan(HKandliver).Howeveroneslidefor references run in the same plate and then normalised theHKwaslostduetoascannerfault,whereasonearray against the expression level of the house-keeping genes. fromoneslideforliverwaslostduetoadyesignalissue. The target gene expression was normalised against the Prior to hybridization, 825 ng of Cy3 labelled aRNA geometric mean of the expression of the house-keeping fromeachsample and 825 ngofCy5 labelled aRNAfrom genes elongation factor 1α (ef1a), DNA directed RNA the common control were mixed in a 1.5 ml tube. The polymerase II subunit I (drpII) and hypoxanthine phos- labelled template was fragmentated in the presence of phoribosyltransferase1(hprt1). 11 μl of 10X Blocking Agent (Agilent) and 2.2 μl of 25X Fragmentation buffer (Agilent), brought to a final volume Microarray of20μlwithnuclease-freeH Oandincubatedinthedark 2 The transcriptomic response of both HK and liver to at60°Cfor30min.Subsequentlythesolutionwascooled poly(I:C) stimulation after Sel-Plex supplementation was on ice for 1 min and then 57 μl of 2X GEx Hybridization Pacittietal.BMCGenomics (2016) 17:116 Page5of26 Table2PrimersusedforqPCR Genename Primername Primersequence(5’→3’) Productsize AccNumber Elongationfactor-1α EF1α-F CAAGGATATCCGTCGTCGTGGCA 327 AF498320 EF1α-R ACAGCGAAACGACCAAGAG DNAdirectedRNA DRPII-F TCACCCATGAAGTTGATGAGCTGA 176 BT073753 polymeraseIIIsubunitI DRPII-R CCGTGCAGACATAGTACAGCCTCA Hypoxanthine HPRT1-F GCCTCAAGAGCTACTGCAATG 256 ACH70616 Phosphoribosyltransferase1 HPRT1-F GTCTGGAACCTCAAATCCTATG Thioredoxinreductase3a TrxR3a-F AGTCAACCCCAAGAACGGTAAGG 297 HF969246 TrxR3a-R CAGAAGAGACTGTGGTACACCTCCAA Thioredoxinreductase3b TrxR3b-F CAAAGTCAACCCCAAGAATGGTAAGA 300 HF969247 TrxR3b-R CAGAAGAGACTGTGGTACACCTCCAG SelenoproteinPa SelPa-F GCTTGGTGCAGGCATCCTTATTG 276 HF969249 SelPa-R CATATCTCCCTGCCCTACTCCATCC SelenoproteinPb SelPb-F GACGACTTCCTGGTATATGACAGATGTG 275 HF969250 SelPb-F1 GATACCGTCAGCAACCCAGTTCC Interferon1a IFN-1aF CTGTTTGATGGGAATATGAAATCTGC 193 AJ580911 IFN-1aR CCTGTGCACTGTAGTTCATTTTTCTCAG Interferon1b IFN-1bF GATGGGAATAGGAATAGGAATAGGAAGTC 200 AJ582754 IFN-1bR GCCTCTGCACTGTAGTTCATTTTTCTC Interferonγ1 IFN-γ1F CAAACTGAAAGTCCACTATAAGATCTCCA 210 AJ616215 IFN-γ1R TCCTGAATTTTCCCCTTGACATATTT Interferonγ2 IFN-γ2F CAAACTGAAAGTCCACTATAAGATCTCCA 188 FM864345 IFN-γ2R GGTCCAGCCTCTCCCTCAC Interferonγinducedprotein CXCL11-F CATCAGCTTCCTGGCCTGTC 187 AJ417078 CXCL11-R CCGTTCTTCAGAGTGACAATGATCTC Viperin VIG-F AGAACTCAACCCTGTACGCTGGA 227 AF076620 VIG-R GGCAATCCAGGAAACGCATATATTC Laboratoryofgenetics LGP2-F CAGGGACTTCCGAATGAAGATCAC 230 FN396358 andphysiology2 LGP2-R CGCCGGTCTTATAGTACCTCTCAAAGTC Melanomadifferentiation- MDA5-F CCTTTTCACGCTCTTTAAAGATAGCAAAG 229 FN396357 associatedgene5 MDA5-R GCAAGCTTTTACTCCGACCTCCTC Toll-likereceptor3 TLR3-F GAACGTTCTGATCAACCGTACGCT 297 AY883999 TLR3-R TGGGCCATGAACTGTCGACA Toll-likereceptor9 TLR9-F GGCTGCTGGATGAAAAGGTGGA 212 EU627195 TLR9-R CTCGTTGACGTTGCTGTCGTAGGA MXprotein2 MX2-F CCTTCTGAAAACAGCAAAGACTAAGA 184 OM47945 MX2-R AACTAACTCTCCCTCCTCCAACTC SerumamyloidA SSA-F GGTGAAGCTGCTCAAGGTGCTAAAG 162 AM422447 SSA-R GCCATTACTGATGACTGTTGCTGC Suppressorofcytokine SOCS3-F CACAGAGAAACCGTTAAAAGGACTATCC 228 AM748723 signalling3 SOCS3-R AAGGGGCTGCTGCTCATGAC Cathelicidin1 CATH1-F ACCAGCTCCAAGTCAAGACTTTGAA 275 AY594646 CATH1-R TGTCCGAATCTTCTGCTGCAA Hepcidin HAMP-F GCTGTTCCTTTCTCCGAGGTGC 165 CA369786 HAMP-R GTGACAGCAGTTGCAGCACCA Insulin-likegrowthfactor IGFBP-1b1F ATCCCAGACCCCTCCACTCC 258 JX565545 bindingprotein IGFBP-1b1R GCTGAGAGCTGGTTATCTTGTCC Pacittietal.BMCGenomics (2016) 17:116 Page6of26 buffer(Agilent)wasaddedtothemixtostopthefragmen- Statisticalanalysisofthearrayswasperformedusingthe tation reaction. Immediately afterwards 103 μl of each Genespring GX analysis platform (version 9.5; Agilent hybridization solution was dispensed onto the Agilent Technologies). Quality control of the data was performed 4x44K gasket slides. Next the rainbow trout “Trout 2013” within Genespring and included removal of saturated oligoarraywasplacedontothegasketslideandthe“sand- probe features, non-uniform features, population outliers wich”placedinthehybridizationchamber.Thehybridiza- and those features showing intensities not significantly tionswereperformedinaMicroarrayHybridizationOven differentfrombackgroundintheCy3orCy5channels. (Agilent)overnight(18h)at65°C.Forwashing,theslides After these relatively stringent procedures, a number were rinsed using two different wash solutions: Gene between25,000and30,000oftheoriginal45,220arrayfea- Expression wash buffer 1 (Agilent) and Gene Expression tures were maintained for subsequent analyses. The Gene- washbuffer2(Agilent).Priortothewashing0.005%Triton spring statistical tool was used to analyse the differences X-102 (Agilent) was added to the Gene Expression wash amongst the treatment groups included in the microarray bufferstoreducethepossibilityofarraywashartefacts.The experiment. Benjamini and Hochberg False Discovery was slideswerethenscannedonanAxon4200Ascanner(Axon thecorrectionappliedtothedata,withsignificantdifferen- Instruments) at a resolution of5 μm and the images saved tial expression established by either one-way ANOVA as*.TIFfiles. (p<0.05) followed by Tukey's post hoc test or two-way Images were extracted and initial analysis was per- ANOVA(p<0.05),dependingonthe kind of comparison formed by Feature extraction v9.5.3 (Agilent), perform- being made. Further filtering on fold change was con- ing background correction of feature intensities (within ducted and only transcripts showing ≥2 fold change in the software). A Lowess normalisation of background expression were considered further. The experimental corrected data was next conducted and all intensity hybridisations are at the European Bioinformatics Insti- values <1.0 weresetto1.0. tute, archived under accession number E-MTAB-2982. The trout array used in this study (“Trout 2013”) was updatedwithalltroutcDNA sequencespublished within Geneontology(GO)analysis the NCBI gene database and all the trout selenoprotein For enrichment analysis of biological process ontology sequences cloned in our previous work [25, 26] were (gene ontology, GO), the up- and down-regulated included. Probes matching sequences for selenoproteins transcripts were analysed as two dependent clusters or molecules involved in selenoprotein synthesis (e.g. within ClueGO, a Cytoscape plug-in that visualizes the DIOs, Fep15, SelJ, SelK, SelL, SelP, SelR, SelS, SPS2 and non-redundant biological processes in a functionally EFsec) retrieved in silico were added to the array in du- grouped network [27]. The HGNC symbols correspond- plicate. All the non-annotated sequences and all the ing to the up- and down- regulated trout transcripts ones having an E>0.001 when using blast with the from each comparison list of interest were inputted into tBLASTx function at NCBI gene bank were excluded. ClueGO and aminimum of three genes was used as cut- Furthermore, all the duplicate probes matching to the same target were eliminated with a similar approach. A off to find the GO term. The two-sided hypergeometric uniqueprobepertargetwaschosenbasedontheEvalue method was used for statistical testing and the p values given after tBLASTx within NCBI gene bank; probes were corrected with the Bonferoni step-down method. with the same identity for a unique target were further Only terms with a p<0.05 are shown. A Kappa score selected based on their identity with the corresponding equal to four was used as the cut-off for GO term human orthologue after BLASTx within the Ensemble grouping for thenetwork analysis. human genome database http://www.ensembl.org/ index.html), and an official genome symbol was assigned Results using the HUGO Nomenclature Committee (HGNC, SebioaccumulationandpreliminaryPCRscreening http://www.genenames.org/). Se concentration in the experimental diets and its bio- accumulation in liver tissue were determined using in- ductively coupled plasma mass spectrometry (ICP- MS) Statisticalanalysis (Fig. 1a). The Se concentration in the control diet was Data from ICP-MS and qPCR are presented as means+ equal to 1.10±0.05 mg Kg−1, likely due to the animal S.E.M., plotted using GraphPad Prism software (V5), source components of the diet (i.e. fish meal and fish and analyzed using the SPSS package 21.0 (SPSS Inc. oil). Thus the expected Se concentration in the supple- Chicago). Significant differences were indicated at mented diets was 2.1 and 5.1 mg Kg−1 and when the Se p<0.05 using one way-analysis of variance (ANOVA) in these two diets was measured the Se content was and Tukey's post hoc test, or two-way analysis of found to be 2.61±0.09 and 6.35±0.16 mg Kg−1 respect- variance (ANOVA). ively. In the liver of fish fed the control diet, 8.3±0.5 mg Pacittietal.BMCGenomics (2016) 17:116 Page7of26 Fig.1Seconcentrationinliver(a),andtranscriptionalmodulationofselectedselenoproteingenesinliver(b).TotalSeconcentrationwas determinedinlivertissueusingICP-MSinreactioncellmode.Theresultsrepresentthemean+SEMof12fishfromthreedifferenttanksfor eachdietgroup.TheexpressionofgenetranscriptswasquantifiedbyqPCRandnormalizedagainstthegeometricmeanofthreehousekeep- inggenes(ef1α,drpII,hprt1),andthenusedforstatisticalanalysis.Thetranscriptexpressionisreportedasarbitraryunitsandafoldchange,calculated astheaverageexpressionleveloffishfedthecontroldietdividedbythatoffishfedtheexperimentaldiets,isreportedabovethebars.Theresults representthemean+SEMfrom18fishfromthreereplicatetanksforeachexperimentalgroup.Thelettersabovethecolumnsindicatestatistically significantresultsversusthecontrols,asassessedbyone-wayANOVA(p<0.05),withdifferentlettersindicatingsignificantdifferencesbetween thetreatments Kg−1 of Se was bioaccumulated, whereas 19.9±1.8 and Furthermore, we analysed the differential response of 43.5±2.6 were detected in the groups fed the 1 and 4 mg selected antiviral response mediators in the HK of fish fed Se Kg−1 enriched diets respectively. From the Se results, it the experimental diets and subsequently stimulated with is possible to assert that Se can be efficiently and propor- poly(I:C) (Fig. 2). Upon inspection of the interferon (IFN) tionally assimilated in the diets. No impact on fish health gene response, a differential trend was observed for type I wasnoted,andnodeathswererecordedduringthefeeding IFN(predominantly ifn-aandifn-b)andtypeIIIFN(ifn-γ) trial. There were no significant differences in average body in the two groups fed diets enriched with 1 and 4 mg weight between the three groups at the end of the Se Kg−1. In the PBS injected individuals, the ifn-α tran- experiment. script was up-regulated after feeding the diet with the Next, we measured in liver the transcript expression of lower concentration of Sel-Plex but was unchanged with trxr3andselp(selenoproteinP)isoforms(Fig.1b),asindi- theotherexperimentaldiet.A similartrendwasseenafter catorsforSebioassimilationintrout[20].Alltheselected poly(I:C) stimulation, with the group fed the diet enriched transcriptsshowedasignificantinductioninthegroupfed with 1 mg Se Kg−1 showing a higher induction of ifn-α. 4mgSeKg−1. The interaction of the lower Sel-Plex augmentation and Pacittietal.BMCGenomics (2016) 17:116 Page8of26 Fig.2(Seelegendonnextpage.) Pacittietal.BMCGenomics (2016) 17:116 Page9of26 (Seefigureonpreviouspage.) Fig.2TranscriptionalmodulationofselectedantiviralmediatorsinHK.After10weeksoffeeding,thefishwereinjectedwithvehicle(PBS)or poly(I:C)(2.5mg/ml)and24hlatertissueswereharvested.TheexpressionofgenetranscriptswasquantifiedbyqPCRandnormalizedagainstthe geometricmeanofthreehousekeepinggenes(ef1α,drpII,hprt1),andthenusedforstatisticalanalysis.Thetranscriptexpressionisreportedas arbitraryunitsandafoldchange,calculatedastheaverageexpressionleveloffishinjectedwithpoly(I:C)dividedbythatoffishinjectedwith PBS,isgivenabovethebars.Theresultsrepresentthemean+SEMfrom27fishfromthreereplicatetanksforeachexperimentalgroup.The lettersabovethecolumnsindicatevaluesthatarestatisticallysignificantversusthecontrolsassessedbyone-wayANOVA(p<0.05),withdifferent lettersindicatingsignificantdifferencesbetweenthetreatments.Theasterisksindicatethetranscriptsthatshowasignificantinteractionbetween poly(I:C)stimulationandSesupplementation,asassessedbytwo-wayANOVA theifn-aresponsetopoly(I:C)stimulationwasfurthercon- Several transcripts in the HK showed a differential firmedbytwo-wayANOVAanalysisasshowninFig.2. response to poly(I:C) between the control diet group Ifn-b transcript expression was instead inhibited by and the fish fed a diet enriched with 4 mg Se Kg−1, increasing concentration of Sel-Plex, with a significant whereas transcripts within the liver were altered by down-regulation detected in the group supplemented with the diet. 4mgSeKg−1andinjectedwithPBS.Incontrast,ifn-γiso- To examine the overall effects of poly(I:C) and Sel-Plex forms both showed a significant interaction between Se supplementation on gene transcription, signal inten- supplementationandresponsetopoly(I:C),primarlyinthe sity values of all probes with significant expression groupfedthedietenrichedwith4mgSeKg−1.Thehigher were subjected to principle component analysis (PCA) foldchangeforifn-γisoform1expressionwaslikelydueto (Additional file 2: Figure S2). The PCA results indicated aslightbutnotsignificantinhibitionofthesametranscript thatwithintheHKthereisaninteractionbetweentheim- due to the experimental diet, whereas with isoform 2 a munechallengeandthediet,likelyduetoalargeeffectof strong induction in response to the poly(I:C) was seen the experimental diet on transcript expression within this regardless of the response in the vehicle group. For both tissue. However, in the liver there was an effect of both isoforms of ifn-γ, a strong interaction between the dietary the poly(I:C) injection and Sel-Plex supplementation but treatment and immunological response was further con- nointeractionwasfound. firmed statistically. Viperin and CXCL11 transcripts, two Overall, the challenges resulted in large global alter- importantmediatorsoftheIFNresponse,showedasimilar ations in transcriptional activity; 5063 probes were pattern of expression to that of ifn-γ isoform 2, with a detected as being significantly modulated in the HK and significantly higher up-regulation in the group fed thediet 5596 in the liver, by the two treatments. Looking specif- enrichedwith4mgSeKg−1. ically at the diet effects, it is evident that Sel-Plex had a Finally the expression of receptors involved in antiviral larger effect on the HK than on the liver (Fig. 3), further sensing were examined, including relevant toll-like recep- confirming a strong effect of supplementation on this tors (TLR) and members of the retinoic acid-inducible tissue. A list of 2409 and 2385 transcripts that were gene I (RIG-I)-like helicase (RLH) family. The transcript expression of melanoma differentiation-associated gene 5 (MDA5) and laboratory of genetics and physiology 2 (LGP2) genes was not affected by Sel-Plex supplementa- tion, and only the mda5 transcript showed a significant interaction between poly(I:C) stimulation and Se supple- mentation, as assessed by two-way ANOVA. Tlr3 tran- script expression was also not modulated by either treatment, whereas tlr9 mRNA was induced by poly(I:C) inallthesegroups. Fig.3GenesexpressedatdifferentlevelsinHKandliverupon dietarysupplementationwithSel-Plex.TheVenndiagramshowsthe Overviewoftranscriptomicresponseanalysis genesidentifiedbymicroarrayanalysis,differentiallyexpressedinHK From the preliminary qPCR screening, modulation of the andliverfromtroutfedadietsupplementedwith4mgSeKg−1 transcript expression for selected selenoproteins and anti- relativetothegroupfedacontroldiet.Allthegenespresentedas viral mediators was mostly seen in the group fed a diet up-regulatedanddown-regulatedaresignificantlyalteredinexpression enriched with 4 mg Kg−1 Sel-Plex. Therefore this diet astestedbyone-wayANOVAandTukey’sHSDmultiplecomparisons test(p<0.05andBenjamini-Hochbergcorrection)with≥2foldchange group was selected to be compared to the control group inexpression withinthemicroarrayexperiment. Pacittietal.BMCGenomics (2016) 17:116 Page10of26 significantly modulated with a fold change≥2 in at least LivertranscriptomicresponsetoSel-Plex one of the contrasts of interest in the HK and liver, supplementation respectively,wasobtained(Fig. 4). Intheliver,133transcriptsweresignificantlyalteredwhen Due to the large transcriptomic response encountered comparing the response to the experimental diet of this in both tissues, we first determined the main biological tissue and HK (Fig. 3). Among these, only 20 transcripts pathways involved in this response before examining were found to be involved in significant GO the modulated transcripts, looking into the most sig- terms (Table 3), and due to the size of the gene cluster nificant processes highlighted by the gene ontology it was not possible to determine clearly between the (GO) analysis. To this end, the up- and down-regulated up- and down-regulated transcript clusters as to which transcriptswereanalysedastwodependentclusterswithin had the major contribution to the biological processes ClueGO, a Cytoscape plug-in that visualizes the non- found to be modulated. The main biological pathways redundant biological processes in a functionally grouped highlighted by the GO analysis were processes involved network[27]. in the regulation of lipid metabolism, more specifically The microarray output was confirmed by real time steroids, lymphocyte mediated immunity, response to qPCR analysis, measuring the transcript expression of ROS and sarcomere organization (Fig. 5). genes encoding for components of the immune re- The transcripts for Apolipoprotein A-IV (APOA4), sponse and selenoproteins in the three comparisons of cAMP responsive element-binding protein (CREB1) and interestthatwereselected(Additionalfile4:TableS2).For superoxide dismutase 1 (SOD1) were the up-regulated allgenestheexpressionpatternshowedthesamedirection targets involvedinlipid/steroidmetabolism; whereasfatty of response between microarray and qPCR analysis albeit acid binding protein (FABP1), growth hormone secreta- themagnitudeoftheexpressiondifferencesvariedbetween gogue receptor (GHSR), interleukin 1-β (IL-1β) and thetwoplatforms. vitellogenin 2 (associated to human apolipoprotein B, APOB) were down-regulated. Vitellogenin in fish is mainly involved in reproduction, and its production might be affected by lipid intake and metabolism [28]. C-reactive protein (CRP) and cholesteryl ester transfer protein (CETP) mRNA were respectively up- and down- regulated, and both are involved in macrophage differenti- ation to foam cells. SOD1, together with haemoglobin β (HBB) were found to positively contribute to the response to ROS, whereas trout cyclin-dependent kinase 2 (corre- sponding to human cyclin-dependent kinase 1) was inhib- ited.Atroutsequence correspondingtothegeneencoding for major histocompatibility complex class I-related (MR1) in humans and lysosomal-associated membrane protein 1 (LAMP1) were also induced and are primarily involved in lymphocyte mediated immune processes together with IL- 1β. The transcripts for a few genes involved in sarcomere organization were significantly down-regulated: namely β-adducin (corresponding to human adducin 2 (beta), ADD2), myosin alkali light chain (specifically myosin, light polypeptide 4, alkali; atrial, embryonic1, MYL4), vacuolar protein sorting 72 homolog (VPS72), type II keratin E2 (similar to human keratin 8, KRT8) and two Fig.4GenesexpressedatdifferentlevelsinHK(a)andliver(b) upondietarysupplementationwithSel-Plexandimmunechallenges. sequences matching to the human leucine rich repeat TheVenndiagramshowsthegenesidentifiedbymicroarrayanalysis containing 16A (LRRC16A) and Telethonin (TCAP) re- significantlyalteredinexpressionastestedbyone-wayANOVAand spectively, the latter transcript was also down-regulated Tukey’sHSDmultiplecomparisonstest(p<0.05andBenjamini- in the HK by the diet. Within the same GO term, only Hochbergcorrection),with≥2foldchangeinexpression.The the mRNA level of troponin T type 2 (TNNT2) was genesup-regulatedanddown-regulatedinthegroupfedthe 4mgKg−1Sel-Plexenricheddietrelativetothegroupfedacontrol found to be positively correlated. dietarenamedSeC.Thegenesup-regulatedanddown-regulatedin The transcript for Apoa4 was the most up-regulated thegroupfedacontroldietora4mgSeKg−1enricheddietand by Sel-Plex supplementation. In mice, it is known to en- injectedwithpoly(I:C),relativetothesamedietgroupsinjectedwith hance triglyceride secretion from the liver, preventing PBS,areindicatedasCPandSePrespectively over-accumulation of lipids, which can cause toxic

See more

The list of books you might like