Logout succeed
Logout succeed. See you again!

Inhibition of miR-155 attenuates abdominal aortic aneurysm in mice by regulating macrophage ... PDF
Preview Inhibition of miR-155 attenuates abdominal aortic aneurysm in mice by regulating macrophage ...
Bioscience Reports: this is an Accepted Manuscript, not the final Version of Record. You are encouraged to use the Version of Record that, when published, will replace this version. The most up-to-date version is available at http://dx.doi.org/10.1042/BSR20171432. Please cite using the DOI 10.1042/BSR20171432 Inhibition of miR-155 attenuates abdominal aortic aneurysm in mice by regulating macrophage-mediated inflammation Zhidong Zhang, Kai Liang, Gangqiang Zou, Xiaosan Chen, Shuaitao Shi, Guoquan Wang, Kewei Zhang, Kun Li, Shuiting Zhai* Department of Vascular and Endovascular Surgery, Henan Provincial People's Hospital,NO.7Weiwu Road, Zhengzhou, Henan 450003. P.R. China. *Corresponding author: Shuiting Zhai, PhD, Department of Vascular and A C C Endovascular Surgery, Henan Provincial People's Hospital, NO.7 Weiwu Road, EP T E D M Zhengzhou, Henan 450003, P.R. China. AN U S C R TEL: +86- 15838127197 IP T E-mail: [email protected] Use of open access articles is permitted based on the terms of the specific Creative Commons Licence under which the article is published. Archiving of non-open access articles is permitted in accordance with the Archiving Policy of Portland Press ( http://www.portlandpresspublishing.com/content/open-access-policy#Archiving). Abstract The aim of this study was to identify abdominal aortic aneurysms (AAA)-associated miR-155 contributing to AAA pathology by regulating macrophage-mediated inflammation. Angiotensin II (AngII)–infused apolipoprotein E-deficient (ApoE-/-) mice and THP-1 cells model of miR-155 over-expression and deficiency were used inthe experiments. The expression of miR-155 was detected by quantitative reverse transcription polymerase chain reaction (qRT-PCR). Cytokines were evaluated using enzyme-linked immunoabsorbent assay(ELISA). Western blotting was used to measure the levels of MMP-2, MMP-9, iNOS and MCP-1 proteins. Immunostaining and transwell was used to determine CD68, elastic collagen, proliferation and migration of vascular smooth muscle cells (VSMC). The results showed that miR-155 and cytokines were up-regulated in AAA patients or ApoE-/- mice. Overexpression of miR-155 enhanced MMP-2, MMP-9, iNOS and MCP-1 levels, and stimulated the proliferation and migration of vascular smooth muscle cells (VSMC), Meanwhile, inhibitionof miR-155 had theopposite effect. In addition, histology demonstrated accumulation of CD68 and elastic Collagen-positive areas significantly decreased in miR-155 antagomir injection group. In conclusion, the results of this study suggest that inhibiting miR-155 is crucial to prevent development of AAA by regulating macrophage inflammation. Keywords: AAA, miR155, macrophage, inflammation 2 Introduction Abdominal aortic aneurysms (AAA) are defined as focal dilatation of the abdominal aorta is 50% greater than its normal diameter or when it is more than 3 cm in the abdominal aorta diameter. AAA is a common disease with an irreversible dilatation of the abdominal aorta, which is characterized by a high mortality and asymptomatic[1].Rupture is the most dreaded complication of AAA, resulting in approximate 90% mortality rates [1, 2]. Theprogress ofAAAis strongly associated to advanced age, sex, smoking, atherosclerotic disease and dyslipidaemia, the presence of hypertension and family history[3-6]. However there are no treatment measures currently to effectively restrict AAA growth and the mechanism of AAA remains unknown. The present understanding characterizes AAAas a chronic inflammatory disease. Macrophages in AAA formation and rupture have significant effect [7]. Macrophage are localized in AAA lesions suggesting that they may play a key in the inflammatory cascade precede the disease [8]. The pathogenesis likely occurs with the injury of endothelial and vascular smooth muscle cells (VSMC), which recruits an inflammatory response to lead to destroy the integrity of the vessel wall [9]. The inflammatory infiltration leads to a loss of the internal elastic lamina, myointimal hyperplasia and ectopic distribution of VSMC in vascular disease [10]. Research have shownthat phenotypictransition of VSMC drives the progression of vascular diseases, such as atherosclerosis, diabetes, restenosis and hypertension[11]. VSMCs are associated with vessel injury and remodeling in the pro-inflammatory environment 3 [12, 13]. In the normal vessel wall, VSMCs are static, differentiated, contractile and low rate of proliferation, and express high levels of contractile proteins such as (cid:302)-(cid:86)(cid:80)(cid:82)(cid:82)(cid:87)(cid:75)(cid:3)(cid:80)(cid:88)(cid:86)(cid:70)(cid:79)(cid:72)(cid:3)(cid:68)(cid:70)(cid:87)(cid:76)(cid:81)(cid:3)(cid:11)(cid:302)-SMA) [14]. The injury of vascular wall causes change of VSMC phenotype, which embodies as high expression of osteopontin (OPN) protein, then VSMC suffer to dedifferentiate, proliferate, and migrate into the vessel lumen [15]. In the last decade, there is increasing attention to identifying genetic that could perform more targeted screening for mechanism of limiting AAA growth to helpexploreAAA pathogenesis[16-18]. The microRNAs (miRNAs) are small noncoding, double-stranded RNA molecules that can influence stability of messenger RNAs (mRNAs) [19-21]. They are prominently expressed in many hematopoietic cell types and have emerged as potent regulators of vascular inflammation and cancer [22, 23]. A recent study have highlighted the significance of miR-155 as regulatory elements of immune responses in various inflammatory transmitters [24]. It has been reported that miR155 level is increased in mouse and human with AAA, and there are a correlation between miR155 and proinflammatory cytokine under various conditions [25-27]. Macrophages are one of the critical cells of inflammation and immunology, which could serve as a mediator in the deterioration of AAA [28]. The existence of macrophage can weaken the arterial wall, because vessel collagens are disintegrated by MMP from macrophages [29]. However, the mechanisms by which macrophage may contribute to AAA pathogenesis remain undefined. Based on these premises, we analyzed that miR-155 mediates AAA formation in vivo and vitro by macrophages, 4 and macrophages participate inthe destruction of vascular structures and worsening of the inflammatory process in AAA. Materials and Methods Clinical specimens The biopsies and serum from patients undergoing elective open AAA repair (n = 11, Age = 66±5), and control subjects were selected from normal volunteer of the same age and sex without AAA (n = 15, Age = 64±6). Biopsies were obtained from the body of the AAA at the site of maximum AAA dilatation (AAA body) and from the macroscopically non dilated AAA neck (AAA neck), which were collected in Ambion® RNAlater® Tissue Collection (ThermoFisher Scientific, Waltham, MA) and stored at -20ºC. The AAA neck samples were used as controls, since previous studies suggest that aortic histology is relatively normal in these biopsies [30]. The blood samples from patients with AAA and normal volunteer. The blood samples were incubated for 30 min at 37(cid:263), in water bath kettle to obtain serum or used to macrophageisolation. Patients with AAAs were defined as maximum aortic diameter (cid:149) 50 mm. This study was approved by the Ethics Committee of Henan Provincial People’s Hospital and all patients provided informed consent. Model establishment and grouping All animal experiments followed the guidelines of the Institutional Animal Care and Use Committee (IACUCs) of local. The AAA is defined as a 50% increase in 5 external diameter of the abdominal aorta[31]. Eight -week-old male ApoE-/-micewere provided byShanghai Slac Laboratory Animal Co, Ltd (Shanghai, China). Mice were divided into two groups, a group were used as AAA model(cid:708)n = 70(cid:709)and another group turn into control (n = 20). AAA was induced by chronic pour 800 ng/kg/min AngII (Cat.no.9525, Sigma Aldrich, St. Louis, USA) into ApoE-/-mice via mini-osmotic pumps (Model 1004, Alzet, CA, USA) for 28 days [32-35]. In another two set of ApoE-/-mice were infused with saline which served as control mice. After 28 days, 36 AAA model mice and 16 controls mice were obtained. One group mice model (n = 6)and control (n = 6) was sacrificed. The aorta was removed and fixated in RNAlater for 24h thereafter frozen in -20(cid:263) and blood was taken to extract serum. In order to study the significance of miR-155inhibitors in AAA development, therest ofAAA model (n = 30) mice were divided three groups (10mice everygroup). Groups were divided as follow; miR-155 antagomir group, antagomir NC group (group were treated with the Meaningless fragments), AngII (without treatment) and a saline treatment group was used as the control (n = 10). miR-155 antagomir and antagomir NC (Ambion; Austin, TX) were injected into the abdominal aorta of AAA model mice fortwice a week. on the 7 th day, aneurysm specimens of mice were quicklycollected and frozen to -80(cid:263) until analysis. Macrophageisolation Peripheral bloodmononuclear cells (PBMCs) from the blood (15mL) of patients with AAA (n = 11) and normal volunteer (n = 15) using Lymphocyte Separation Medium 6 (HaoyangBiological Manufacture Co.,Tianjin,China).Briefly, the heparinized blood was dilutedwith phosphatebufferedsalinein proportionof1: 1, then layered over lymphocyte separation medium (1:1). PBMCs were obtained by centrifugation[36], andincubated with mouse-anti-human CD68 (1:400; Dako, Glostrup, Denmark) and goat anti-mouse IgG conjugated magneticbeads (Dynal, Oslo,Norway) according tothe manufacturer’s instructions. CD68+cells wereisolated using flow cytometry (BD Biosciences,SanJose,CA, USA). The cell suspension was cultured in (cid:302)-(cid:80)(cid:76)(cid:81)(cid:76)(cid:80)(cid:88)(cid:80)(cid:3) (cid:72)(cid:86)(cid:86)(cid:72)(cid:81)(cid:87)(cid:76)(cid:68)(cid:79)(cid:3) (cid:80)(cid:72)(cid:71)(cid:76)(cid:88)(cid:80)(cid:3) (cid:11)(cid:505)(cid:80)(cid:72)(cid:80)(cid:15)Gibco, Invitrogen, Waltham, MA, USA) supplemented with 10% Fetal Bovine Serum (PAA,Basel, Switzerland), (cid:20)(cid:19)(cid:19)(cid:3)(cid:541)(cid:48)(cid:3)(cid:51)(cid:18)(cid:54)(cid:3) (Sigma-Aldrich) (cid:68)(cid:81)(cid:71)(cid:3) (cid:21)(cid:24)(cid:3031)(cid:81)(cid:74)(cid:18)(cid:80)(cid:47) monocyte colony-stimulating factor (M-CSF, Peprotech, London,UK). Cell culture and miRNA mimic and inhibitor transfection The human cell line THP-1 and human vascular smooth muscle cells (HVSMC) were purchased from ATCC (American Type Culture Collection, Nr. TIB-202, Wesel, Germany). The human cell line THP-1 was cultured in RPMI-1640 media (Thermo Scientific, Waltham, USA) supplemented with 10% Fetal Bovine Serum (PAA) and (cid:20)(cid:19)(cid:19)(cid:3)(cid:541)(cid:48)(cid:3)(cid:51)(cid:18)(cid:54)(cid:3)(cid:11)(cid:54)(cid:76)(cid:74)(cid:80)(cid:68)-Aldrich). Cells were maintained at densities between 0.5 and 1.0x106cells/ml in culture. HVSMCs were grown in medium DMEM/F12 (Gibco. Grand Island, NY) supplemented with 20% Fetal Bovine Serum (PAA) (cid:68)(cid:81)(cid:71)(cid:3)(cid:20)(cid:19)(cid:19)(cid:3)(cid:541)(cid:48)(cid:3) P/S (Sigma-Aldrich). Cells were incubateda(cid:87)(cid:3)(cid:22)(cid:26)(cid:219)(cid:38)(cid:3)(cid:68)(cid:81)(cid:71)(cid:3)(cid:24)(cid:8)(cid:3)(cid:38)(cid:50) (cid:237)95% air. 2 The miR-155 mimic (Thermo Fisher, Waltham,MA, USA) 7 andmiR-155inhibitor (Exiqon Inc, Woburn, MA,USA) were transfected intoTHP-1cells by using X-treme GENE siRNA transfection reagent (Mirus Bio LLC, Madison, WI, USA). Cells were transfected with nonsense sequence as controls (cid:708)mimicNC andinhibitor NC). Inhibitor sequence were as follow: nonsense control (inhibitor NC) GTGTAACACGTCTATACGCCCA (Exiqon; 199020-00) and miR-155 inhibitor sequences were GTGTAACACGTCTATACGCCCA (Exiqon; 428232-00). miR-155 mimic sequences were UUAAUGCUAAUUGUGAUAGGGGU/AM17100 and miR control sequences were AM17111. THP-1 cells were transfected for approximately 48 h before transfection reagents were removed. Transwell The migration assay of VSMC was performed in a transwell culture system, (cid:88)(cid:86)(cid:76)(cid:81)(cid:74)(cid:3)(cid:68)(cid:3)(cid:24)(cid:3)(cid:541)(cid:80)(cid:3)(cid:80)(cid:72)(cid:80)(cid:69)(cid:85)(cid:68)(cid:81)(cid:72)(cid:3)(cid:83)(cid:82)(cid:85)(cid:72)(cid:3)(cid:86)(cid:76)(cid:93)(cid:72)(cid:3)(cid:11)Transwell, CorningCostar, NY, USA), and 24 well culture plate. Briefly, 5×104VSMCs were seeded into the upper chamber containing 200 ul non-serum DMEM medium, put into a 24-well plate filled with 600 ul DMEM containing 10% FBS and 50% macrophage culture supernatants, and incubated for 24 hours. Cells were fixed with 4% paraformaldehyde, and cells on the upper side of chamber were removed using a cotton swab. Then, cells on the lower side of chamber were stained with 0.1% crystal violet for 10 minutes. The cells that through the chamber were counted under a microscope and five random images ware selected to quantitatefor each chamber. 8 RNA isolation and qRT-PCR analysis Total miRNA was extracted from AAA body, AAA neck and serum of human or animal model of AAA or isolatedmacrophage using the miRVana miRNA Isolation kit (Ambion, Austin, TX, USA) and miRNeasy Serum/Plasma kit (Qiagen, Hilden, Germany) according to manufacturer specifications. miRNA concentration was quantified using a Nanodrop Spectrophotometer (Molecular Devices, Corp., Downingtown, PA). cDNA was synthesized by a TaqMan miRNA reverse transcription kit (Applied Biosystems, CA, USA) as per manufacturer’s instructions. The following primers were used in the PCR experiments: Human miR-155, forward primer: 5´-CGGTTTAATGCTAATCGTGA-3´, reverse primer: 5´-GAGCAGGGTCCGAGGT-3´; U6, forward primer: 5´- CTCGCTTCGGCAGCACA -3´, reverse primer: 5´- AACGCTTCACGAATTTGCGT-3´. Mouse miR-155, forward primer: (cid:24)(cid:397)-AATGCTAATTGTGATAGGGGT-(cid:22)(cid:397)(cid:15)(cid:3)(cid:85)(cid:72)(cid:89)(cid:72)(cid:85)(cid:86)(cid:72)(cid:3)(cid:83)(cid:85)(cid:76)(cid:80)(cid:72)(cid:85)(cid:3)(cid:90)(cid:68)(cid:86)(cid:3)(cid:83)(cid:85)(cid:82)(cid:89)(cid:76)(cid:71)(cid:72)(cid:71)(cid:3)(cid:76)(cid:81)(cid:3)(cid:87)(cid:75)(cid:72)(cid:3)(cid:78)(cid:76)(cid:87)(cid:30)(cid:3)(cid:56)(cid:25)(cid:15)(cid:3) forward primer: CTCGCTTCGGCAGCACA -3´, reverse primer: 5´- AACGCTTCACGAATTTGCGT -3´.. QRT-PCR was performedusing theSYBR GreenPCR coreReagent kit (Applied Biosystems, CA, USA). Reaction mixture was run in a 7500 Fast Real-Time PCR System (Applied Biosystems, USA) with denaturation step at 95°C for 10 minutes, followed by 45 cycles of denaturation at 95°C for 10 s and primer annealing/extension at 60°C for 60 s. Relative quantification of The target gene was analyzed us(cid:76)(cid:81)(cid:74)(cid:3)(cid:87)(cid:75)(cid:72)(cid:3)(cid:70)(cid:82)(cid:80)(cid:83)(cid:68)(cid:85)(cid:68)(cid:87)(cid:76)(cid:89)(cid:72)(cid:3)(cid:38)(cid:87)(cid:3)(cid:11)(cid:507)(cid:507)(cid:38)(cid:55)(cid:12)(cid:3) 9 methodand normalized to U6 expression[37,38]. Western blotting Proteins were extracted from THP-1 transfected with miR-155 mimic or miR-155 inhibitor, HVSMC treated with supernatant of the transfection cells as above and tumor tissue from mouse. Western blotting was performed to assess the rabbit anti-MMP2 antibody (1:1000; Thermo Scientific, USA), goat anti-MMP9 antibody (1:500; Santa Cruz Biotechnology, USA), rabbit anti-monocyte chemoattractant protein (MCP-1) antibody (1:500; Bio-Rad Laboratories, USA), anti-iNOS antibody (1:100, Santa Cruz), anti-(cid:55)(cid:49)(cid:41)(cid:302) (1:1000, Sigma, Aldrich), anti-(cid:302)-SMA antibody (1:1000; Millipore USA) and anti-Osteopontin antibody (1:500; Millipore, USA). , were. Briefly, proteins (30 μg) were separated using 12% SDS gel electrophoresis andelectrotransferredontothe polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford,MA,USA). Then membranes were blocked with 5% non-fat dry milk in TBS-Tween for 1 h at room temperature, and incubated with primary antibodies at 4oC overnight. Horseradish peroxidase (HRP)-conjugated secondary antibody was used at a 1:5000 dilution (DAKO) for2 hat room temperature. Bands were visualised using enhanced chemiluminescence (ECL Advance™; GE Healthcare). Protein expression was quantified with densitometric analysis using the ChemiDoc(cid:149)(cid:0)imaging system (Bio-Rad Laboratories) and QuantityOne(cid:149)1-D Analysis Software (Bio-Rad Laboratories). 10