Logout succeed
Logout succeed. See you again!

Innate immune evasion mediated by the Ambystoma tigrinum virus eIF2α 1 homologue 2 3 James ... PDF
Preview Innate immune evasion mediated by the Ambystoma tigrinum virus eIF2α 1 homologue 2 3 James ...
JVI Accepts, published online ahead of print on 9 March 2011 J. Virol. doi:10.1128/JVI.01488-10 Copyright © 2011, American Society for Microbiology and/or the Listed Authors/Institutions. All Rights Reserved. 1 Innate immune evasion mediated by the Ambystoma tigrinum virus eIF2αααα 2 homologue 3 4 James K. Jancovich and Bertram L. Jacobs* 5 D 6 Arizona State University, School of Life Sciences and The Biodesign Institute, Center ow n 7 for Infectious Diseases and Vaccinology, Tempe, AZ 85287-5001 lo a d e 8 d f r 9 Running title: ATV innate immune evasion om h 10 tt p : / 11 * To whom reprint requests should be addressed /jv i. a 12 email: [email protected] s m . o 13 Phone: 480-965-4684 r g / o 14 Fax: 480-727-7615 n A 15 pr il 1 16 4 , 2 17 Abstract word count: 200 01 9 18 Manuscript word count: 6,091 by g 19 ue s t 20 21 1 ABSTRACT 2 Ranaviruses (family Iridoviridae; genus Ranavirus) are large, double-stranded 3 DNA viruses whose replication is restricted to ectothermic vertebrates. Many highly 4 pathogenic members of the genus Ranavirus encode a homologue of the eukaryotic 5 translation initiation factor 2α (eIF2α). Data in a heterologous vaccinia virus system D o 6 suggests that the Ambystoma tigrinum virus (ATV) eIF2α homologue (vIF2αH; ORF w n 7 57R) is involved in evading the host innate immune response by degrading the loa d e 8 interferon-inducible, double-stranded (ds) RNA activated protein kinase, PKR. To test d f r o 9 this hypothesis directly, the ATV vIF2αH gene (ORF 57R) was deleted by homologous m h t 10 recombination and a selectable marker was inserted in its place. ATV∆57R has a small tp : / / 11 plaque phenotype and is 8-fold more sensitive to interferon than wtATV. Infection of fish jv i. a s 12 cells with ATV∆57R leads to eIF2α phosphorylation in contrast to infection with wtATV, m . o r 13 which actively inhibits eIF2α phosphorylation. The inability of ATV∆57R to prevent g / o n 14 phosphorylation of eIF2α correlates with degradation of fish PKZ, an interferon-inducible A p r 15 enzyme that is closely related to mammalian PKR. In addition, salamanders infected il 1 4 16 with ATV∆57R displayed an increased time to death as compared to wtATV infected , 2 0 1 17 salamanders. Therefore, in a biologically relevant system, the ATV vIF2αH gene acts as 9 b y 18 an innate immune evasion factor thereby enhancing virus pathogenesis. g u e s t 1 INTRODUCTION 2 Ranaviruses (family Iridoviridae, genus Ranavirus) are large, dsDNA viruses that 3 can infect a wide variety of ectothermic vertebrates, including amphibians, reptiles and 4 fish (13, 70). However, the ecological and economical impact of ranavirus infections is 5 currently unknown even though ranavirus infections of lower vertebrates have increased D 6 over the past few decades (13, 70). In addition, the mechanisms that enable o w n 7 ranaviruses to infect such a diverse group of hosts and cause, in some cases, high lo a d 8 rates of morbidity and mortality have not been fully uncovered. While there are major ed f r 9 epidemics associated with ranavirus infections in threatened amphibian species, o m h 10 commercially valuable fish and reptiles (1-3, 8, 15, 17-19, 22, 23, 26, 28, 31, 33, 34, 40, t t p : / 11 42-45, 52, 63, 64, 73, 75), ranaviruses are also thought to spread with fish, amphibians /jv i. a 12 and reptiles that are moved globally for bait, food, and as pets (11, 15, 29, 49, 60). s m . o 13 Because of the economical and ecological impact these viruses have on ectothermic r g / 14 vertebrates it is essential to begin to uncover the determinants of ranavirus host range on A 15 and pathogenesis. p r il 1 16 Genomic sequencing of Ambystoma tigrinum virus (ATV), originally isolated from 4 , 2 17 tiger salamanders (Ambystoma tigrinum stebbinsi) in southern Arizona, USA (28), 0 1 9 18 revealed a number of genes that may enhance viral pathogenesis based on homology b y g 19 to other known proteins in the database (30). One gene in particular, the ATV u e s t 20 homologue of the eukaryotic translation initiation factor 2α (vIF2αH; ATV ORF 57R), 21 has been suggested to be important for ranavirus pathogenesis (40). In addition, we 22 have recently shown using a heterologous vaccinia virus (VACV) system that the ATV 23 vIF2αH may play an important role in evading the host innate immune response (68). 1 By replacing the VACV innate immune evasion gene, E3L (9, 10, 16, 36, 37, 55, 61, 2 62), with the ATV vIF2αH gene, there is a rapid degradation of cellular PKR, an 3 important cellular antiviral molecule that upon activation phosphorylates the eukaryotic 4 translation initiation factor eIF2α (38, 59) thereby inhibiting protein synthesis. Therefore, 5 we hypothesized that in a more relevant system (i.e. ATV-salamander model system) D o 6 the ATV vIF2αH gene may influence viral pathogenesis by evading the host innate w n lo 7 immune response (i.e. degrading cellular PKR). Using methods similar to those a d e 8 described for generating a recombinant Bohle iridovirus (47), we have generated a d f r o 9 knock-out recombinant ATV deleting the ATV ORF 57R and then characterize this m h 10 recombinant virus in cells in culture and in a salamander model. This research offers ttp : / / 11 insight into a ranavirus immune evasion pathway and suggests that there is a yet jv i. a s 12 uncharacterized innate immune response in salamanders, the natural host of ATV. m . o 13 rg / o n A p r il 1 4 , 2 0 1 9 b y g u e s t 1 MATERIALS AND METHODS 2 Cells and virus. Fathead minnow (FHM; ATCC # CCL-42) cells were 3 maintained in Minimal Essential Medium (MEM) with Hank’s salts (Gibco) supplemented 4 with 5% fetal bovine serum (FBS) (HyClone), and 0.1 mM non-essential amino acids 5 and vitamins (Invitrogen). Epitheloma papilloma ciprini [EPC; (20)] and bluegill fry (BF2; D 6 ATCC # CCL-91) cells were maintained in MEM supplemented with 10% FBS and 0.1 o w n 7 mM non-essential amino acids and vitamins (Invitrogen). All cells were incubated at 20 lo a d 8 – 22oC in the presence of 5% CO2. The viruses used in this study are the Ambystoma ed f r 9 tigrinum virus (wtATV), isolated from tiger salamanders in 1996 (28), and the o m h 10 recombinant virus made in this study. The ATV deletion mutant lacking the vIF2αH gene tt p : / / 11 (ORF 57R) was designated ATV∆57R. jv i. a 12 Recombinant ATV DNA construct and PCR reactions. The PCR construct sm . o 13 used in the in vivo recombination (IVR) reaction contains a 200 base pair (bp) region rg / o 14 upstream of the ATV immediate early 18K gene (pICP18) that promotes the expression n A p 15 of the G418 (neomycin)-resistance gene (G418R). This cassette is flanked by 1.2 r il 1 16 kilobase pairs (kb) of sequence homologous to the 5’ (left) and 3’ (right) regions 4 , 2 0 17 surrounding the ATV vIF2αH gene. The homologous flanking arms recombine with the 1 9 b 18 viral DNA generating the recombinant virus (Fig 1A). The following primers were used to y g u 19 amplify the above mentioned regions of the ATV genome and the G418-resistance e s t 20 gene: vIF2-Left-forward (5’ ATTTACCCAAAAATTGCGTTTC 3’); vIF2-Left-reverse (5’ 21 ATTTCCATATAACAGACAGTAG 3’); vIF2-Right-forward (5’ 22 TGAAAAAAGCTCTATCGAGCAG 3’); vIF2-Right-reverse (5’ 23 TCTCTCACGTTGAGGATAAAG 3’); G418R-forward (5’ 1 ATGAGGATCGTTTCGCATGATTG 3’); G418R-reverse (5’ TCAGAAGAACTCGTCAAG 2 3’); pICP18-forward (5’ AACTAGGTCCGCCGATGAGC 3’); pICP-18-reverse (5’ 3 GCTCATCGGCGGACCTAGTT 3’). Once individual PCR products were obtained using 4 the forward – reverse primer sets, overlapping PCR products were then generated. The 5 overlapping IVR PCR product was generated by first combining the IVP-18 PCR D 6 product with the G418R PCR product and adding primers pICP-18-forward and G418R- o w n 7 reverse to generate a 1.1 kb PCR product. This PCR product was then mixed with the lo a d 8 1.2 kb vIF2-left and vIF2-right PCR products and the PCR primers vIF2-Left-reverse, ed f r 9 pICP18-forward, G418R-reverse and vIF2-Right-reverse were added. This generated a o m h 10 3.5 kb PCR product cassette (pICP18- G418R) and this product was blunt-end cloned t t p : / 11 into a pUC19-based plasmid (Invitrogen) that was renamed, pJJ57. This plasmid was /jv i. a 12 then used as a template to PCR amplify large quantities of PCR product used in the IVR s m . o 13 reactions (see below) as well as for diagnostic PCR reactions. The generation of a r g / 14 recombinant ATV was confirmed by PCR amplification of the 57R locus using flanking on A 15 primers 57R-forward (5’ GAGGTATATTTTTGCAAGG 3’) and 57R-reverse (5’ p r il 1 16 TCTCAAACCTTTCCAATCG 3’). For amplification of 0.5 kb of the major capsid protein 4 , 2 17 (MCP), primers MCP4 and MCP5 primers (5’ GACTTGGCCACTTATGAC 3’ and 5’ 0 1 9 18 GTCTCTGGAGAAGAAGAA 3’, respectively) developed by Mao et al. (41) were used. b y g 19 All PCR reactions described above were performed using the following PCR reaction u e s t 20 conditions: 50 µl reactions containing 100 ng template DNA, 0.3 µM of each primer, 0.2 21 mM dNTP (total concentration of all four nucleotides), 1 unit of Taq polymerase in 1X 22 Buffer B (Promega) and 1.5 mM MgCl . Amplification cycles were initiated with a single 2 23 cycle of 94oC for 5 min, followed by 30 cycles of 94oC (30 seconds), 54oC (60 seconds), 1 72oC (60 seconds), and a final cycle of 72oC for 5 min. PCR products were visualized by 2 electrophoresis on 0.8% agarose gels stained with 0.5 µg/ml ethidium bromide. All PCR 3 products were isolated using the Wizard® SV Gel and PCR Clean-up system according 4 to the manufacturer’s instructions (Promega). 5 ATV in vivo recombination. The following protocol was adapted from Pallister D o 6 et al., (47) and used successfully to knock out the ATV vIF2αH gene. Homologous w n 7 recombination between PCR DNA and ATV DNA will result in a recombinant ATV in loa d e 8 which the vIF2αH gene (ORF 57R) has been replaced by the G418R gene (Fig 1A). d f r o 9 Lightly confluent monolayers of BF2 cells grown in 35 mm dishes were infected with m h 10 wtATV at a multiplicity of infection (MOI) of 10 and the virus was allowed to adsorb for ttp : / / 11 one hour at room temperature. While viral attachment was proceeding, 500 ng of ATV jv i. a s 12 recombination PCR DNA was added to FuGene6 transfection reagent (Roche m . o 13 Diagnostics) according to the manufacturer’s instructions. The solutions (i.e. DNA and rg / o 14 the FuGENE6 transfection reagent mix) were incubated for 25 minutes at room n A p 15 temperature. At that time, DNA/FuGENE6 complexes were added to the infected cells r il 1 16 and incubated at 20 – 22°C for 48 – 72 hours. The cultures were then harvested and 4, 2 0 17 frozen at -80oC, and the virus subsequently released by three cycles of freeze-thaw. 1 9 b 18 The IVR was passaged up to four times in FHM cells in the presence of 1 mg/ml G418. y g u 19 Moreover, virus was plaque purified three times in the presence of G418, then twice in e s t 20 the absence of G418. To confirm generation of a knock out virus, PCR and sequencing 21 of the ATV ORF 57R region was performed (see above). In addition, Western blot 22 analysis was performed to ensure that the G418 resistance gene was synthesized (see 23 below). 1 Plaque size determination. Plaque size phenotypes of both wtATV and 2 ATV∆57R were determined using the ImageQuant 5.2 software (GE Healthcare). FHM 3 cells were infected with wtATV and ATV∆57R. Once plaques were observed, the plates 4 were stained with a 20% ethanol and 1% crystal violet solution, photographed and the 5 images were loaded into the ImageQuant program. Initially, plaques are indicated as D 6 clear loci in a monolayer of blue-stained cells. To determine plaque sizes, the images ow n 7 were inverted so that each plaque was dark relative to the monolayer. Ten plaques for lo a d e 8 each virus were used to determine plaque size by the relative intensity of the pixels in d f r 9 each plaque. Using this approach, greater pixel intensity is indicative of a larger plaque om h 10 size. The pixel intensities of the 10 plaques were averaged and the standard error was tt p : / 11 determined. /jv i. a 12 Interferon-like activity. Interferon (IFN) -like activity was produced in FHM cells s m . o 13 by treating them with dsRNA, as described by others (46, 58). Briefly, 250 µg of r g / o 14 poly[I:C] was filter sterilized by passing through a 0.2 µm filter and mixed with 350 µl of n A p 15 FHM medium and 10.5 µl (3% final concentration) Fugene6 transfection reagent (Roche ril 1 4 16 Applied Sciences). Control transfections contained no poly[I:C]. This mixture was , 2 0 17 incubated at room temperature (20 – 22oC) for 20 minutes before being added to <50% 1 9 b 18 confluent monolayers of FHM cells in a 75 cm2 tissue culture flask. The transfection y g u 19 mixture was rocked for 1 hr at which time 9.5 ml of medium was added. Poly[I:C] treated e s t 20 and untreated FHM cells were incubated at room temperature for 24 hours. After the 21 incubation period the medium was removed, centrifuged at 1,000 x g for 10 minutes to 22 remove any cellular debris and then frozen at -80oC until assayed for activity. IFN-like 23 activity (hereafter referred to as IFN) was measured by plaque reduction assay. The 1 concentration of IFN that inhibits 50% of wtATV plaque formation is defined as 1 FHM 2 Unit of IFN. To assay for IFN activity, FHM IFN was 2-fold serially diluted and 1 ml of 3 each IFN dilution was added to 35 mm dishes containing approximately 50% confluent 4 monolayers of FHM cells. Mock-transfected cell medium was used as a control in these 5 experiments. After 16 - 24 hours of treatment, the IFN was removed and FHM cells D 6 were infected with ~200 plaque forming units (pfu) of wtATV or ATV∆57R or mock o w n 7 infected with medium alone. Cells were rocked for 1 hr and overlayed with a 1:1 mixture lo a d e 8 of 2X MEM with 20% FBS and 1.5% methylcellulose solution. Cells were incubated at d f r 9 room temperature in 5% CO2 for 6 to 8 days at which time the medium:methylcellulose om h 10 mixture was removed by aspiration and cells were stained with a 20% ethanol and 1% tt p : / 11 crystal violet solution. Plaques were counted and the percent plaque reduction was /jv i. a 12 determined by dividing the number of plaques for a particular dose of IFN by the s m . o 13 number of plaques in the mock treated cells. Data representative of multiple r g / o 14 independent experiments. n A 15 Single-cycle growth characteristics. FHM cells were seeded in 35 mm dishes pr il 1 16 and the following day pretreated with 1 FHM U/ml of IFN or untreated. After a 16 – 24 hr 4 , 2 17 incubation period the cells were infected with wtATV or ATV∆57R at a MOI of 5. 01 9 18 Infected cells were harvested at 6 and 48 HPI. Each time point was titered using a by g 19 standard plaque assay in EPC cells and stained with crystal violet. Virus yield was ue s t 20 calculated by subtracting the final virus titer (i.e. 48 HPI) from the starting titer (i.e. 6 21 HPI). Data are the average of multiple independent experiments. Statistical analysis 22 was performed using the single factor ANOVA option in SigmaStat (Systat Software, 23 Inc). 1 Cell extractions and Western blot analysis. Mock infected FHM cells or cells 2 infected with either wtATV or ATV∆57R at a MOI of 5 were collected at various times 3 post infection and pelleted by centrifugation at 1,000 x g at 4oC for 10 minutes. The cells 4 were then lysed using 50 µl of NP-40 lysis buffer [20 mM HEPES pH 7.5, 120 mM KCl, 5 5 mM Mg acetate, 1 mM DTT, 10% glycerol (v/v), 0.5% Nonidet P-40 (NP-40)]. Equal D 6 cell volumes of cellular extracts were subjected to SDS-PAGE on 12% polyacrylamide ow n 7 gels for 1 hour at 150 volts. Proteins were transferred to nitrocellulose at 100 volts for lo a d e 8 45 minutes in 10 mM CAPS, pH 11.0 with 20% methanol and 14 mM β-ME. The blot d f r o 9 was blocked for one hour in 1X TBS with milk (20 mM Tris-HCl, pH 7.8, 180 mM NaCl, m h 10 3% Carnation® nonfat dry milk). The blots were incubated overnight at 4oC with one of tt p : / / 11 the following primary antibodies at the appropriate dilution: α-G418 phosphatase (Ab- jv i. a s 12 Cam) 1:250 dilution; α-eIF2α-Pi Ser-51 (Cell Signaling) at 1:1,000 dilution; α-6X His tag m . o r 13 and α-Myc tag (Rockland) at 1:1,000 dilution each. Primary antibodies were removed g / o 14 and the blot was washed 3 times with 1X TBS containing milk for 0.5 hour at room n A p 15 temperature. The blot was then probed with 1:15,000 dilution of goat α-rabbit IgG- ril 1 4 16 peroxidase conjugate antibody (Sigma) for one hour at room temperature. These , 2 0 1 17 secondary antibodies were then removed and the blot was washed 3 times for 10 9 b 18 minutes each in 1X TBS with milk, and then washed 3 times for 5 minutes each in 1X y g u e 19 TBS without milk. The blot was developed by chemiluminescence. To ensure equal s t 20 loading of proteins, extracts were separated by SDS-PAGE and Coomassie stained. 21 eIF2αααα phosphorylation assay. FHM cells were seeded so that they were <50% 22 confluent at the time of treatment. Cell monolayers were pretreated with 1 FHM U/mL of 23 IFN for 16 - 24 hours. Cells were infected with either wtATV or ATV∆57R at a MOI of 5.