Logout succeed
Logout succeed. See you again!

Interplay between Ku, Artemis and DNA-PKcs at DNA ends PDF
Preview Interplay between Ku, Artemis and DNA-PKcs at DNA ends
JBC Papers in Press. Published on July 19, 2006 as Manuscript M603047200 The latest version is at http://www.jbc.org/cgi/doi/10.1074/jbc.M603047200 Interplay between Ku, Artemis and DNA-PKcs at DNA ends Jérôme Drouet, Philippe Frit, Christine Delteil, Jean-Pierre de Villartay1, Bernard Salles* and Patrick Calsou Institut de Pharmacologie et de Biologie Structurale, CNRS UMR 5089, 205 route de Narbonne, 31077 Toulouse, Cedex 4, France 1 INSERM, Hôpital Necker-Enfants Malades, U768, Unité Développement Normal et Pathologique du Système Immunitaire, Paris, F-75015 France; Université Paris Descartes, Faculté de Médecine René Descartes, Paris, F-75005 France. Running title : Artemis and DNA-PK interplay at DNA ends Corresponding author : Bernard Salles, Institut de Pharmacologie et de Biologie Structurale, CNRS, UMR 5089, 205 route de Narbonne, 31077 Toulouse Cedex 4, FRANCE. Tel. +33 5 61 17 59 36 ; Fax. +33 5 61 17 59 33 ; Email : [email protected] Repair of DNA double strand breaks (DSB) the activation of both DNA-PKcs and Artemis by the non-homologous end-joining pathway may avoid improper processing of DNA. D (NHEJ) in mammals requires at least seven ow n proteins involved in a simplified two-step DNA double-strand breaks (DSB) in cells lo a d process : (i) recognition and synapsis of the are produced by exogenous damaging agents e d DNA ends dependent on the DNA-dependent like ionizing radiation (IR) or radiomimetic fro m protein kinase (DNA-PK) formed by the molecules but also endogenously as by-products h Ku70/Ku80 heterodimer and the catalytic of oxidative metabolism or perturbation of the ttp://w subunit DNA-PKcs in association with DNA replication fork. In addition, tissue-specific w w Artemis, (ii) ligation dependent on the DNA DSB are produced during specialized processes .jb c ligase IV/XRCC4/Cernunnos-XLF complex. like meiosis in germinal cells or V(D)J .o rg The Artemis protein exhibits exonuclease and recombination in lymphocytes. Improper b/ y endonuclease activities that are believed to be signalling or repair of DSB in cells can lead to g u e involved in the processing of a subclass of cell death or cancer-prone genomic st o DSB. Here, we have analyzed the interactions rearrangements (1,2). n D of Artemis and NHEJ proteins both in a DSB are mainly repaired through two ec e m context of human nuclear cell extracts and in distinct pathways : homologous recombination b e cells. DSB-inducing agents specifically elicit and non-homologous end joining (NHEJ), but r 2 5 the mobilization of Artemis to damaged DSB are mainly processed by the latter pathway , 2 0 1 chromatin together with DNA-PK and in mammalian cells. NHEJ requires several 8 XRCC4/ligase IV proteins. DNA-PKcs is factors that recognize and bind the DSB, necessary for the loading of Artemis on catalyze the synapsis of the broken ends and damaged DNA and is the main kinase that then process and reseal the break (3-5). phosphorylates Artemis in cells damaged with Although alternative sub-pathways for NHEJ highly efficient DSB producers. Under kinase may operate in cells (6,7), the major pathway preventive conditions, both in vitro and in relies on a set of core proteins, the individual cells, Ku-mediated assembly of DNA-PK on deficiency of which elicits both IR-sensitivity DNA ends is responsible for a dissociation of and V(D)J recombination defect (2,8). In human the DNA-PKcs/Artemis complex. Conversely, or animals, these defects are responsible for a DNA-PKcs kinase activity prevents Artemis radiosensitive severe combined immuno- dissociation from the DNA-PK/DNA complex. deficiency (RS-scid) syndrome (9). Altogether, our data allow to propose a model The DSB is recognized and bound by the in which a DNA-PKcs-mediated phos- asymmetric ring-shaped heterodimer Ku70/Ku80 phorylation is necessary both to activate that recruits the DNA-dependent protein kinase Artemis endonuclease activity and to catalytic subunit (DNA-PKcs) (10). The maintain its association with the DNA-ends assembled DNA-PK holoenzyme then exhibits site. This tight functional coupling between serine-threonine protein kinase and DNA end- bridging activities (reviewed in (11,12)). One of Copyright 2006 by The American Society for Biochemistry and Molecular Biology, Inc. the kinase functions is to regulate DNA end- Moreover, Artemis could have another role in access to processing enzymes by mean of an the regulation of cell-cycle progression auto-phosphorylation operation (13-15). The following DNA damage, including UV XRCC4/DNA ligase IV complex is responsible irradiation (35,38), although this cell-cycle for the ligation step (16,17) and both Ku and function was not confirmed by others (39). DNA-PKcs components are necessary to load Nevertheless, Artemis has clearly a caretaker this complex to the site of the break (18,19). function since fibroblasts from Artemis-deficient Recently, a new core NEHJ factor with mice show genomic instability (27,28), Artemis- structural similarity to XRCC4, Cernunnos-XLF deficient patients as well as Artemis/p53 has been identified concomitantly as deficient in deficient mice (40) display chromosomal a human RS-scid syndrome (20) and as an instability and show a predisposition to XRCC4-interacting protein (21). The exact role lymphomas (41). of this factor is still unknown but it has been Although cellular studies have established postulated to function in all NHEJ events based a role for Artemis in the repair of minor DSB on its interaction with XRCC4 (21), the high IR- and biochemical experiments have documented sensitivity of the corresponding deficient cells its nuclease activity, this protein is still the (20,21) and their complete defect in NHEJ NHEJ factor for which the less is known about activity in vitro (20,22). its interactions with the other components of the Another NHEJ factor is Artemis that was reaction. It has been reported to form a complex D originally identified, like Cernunnos, as deficient with and to be phosphorylated by DNA-PKcs, o w n in a human RS-scid syndrome (23). Cells leading to the activation of its endonucleolytic lo a derived from these patients show an increased activity (29). However, under these experimental de d sensitivity to IR (24-26). Gene targeting in conditions with purified components, DNA- fro m mouse broadly reproduced these findings PKcs was activated without Ku and no role was h (s2tr7a,n2d8-)s. peAcrifteicm 5is’ teox h3i’b eitxso naunc leinastrei nascitci vsitiyn gblue-t othbes ehravierdp ifno ro pKeun iinng t hbey otvheer hAarntgem pirso/cDeNssAin-gP Knocsr ttp://ww w has also hairpin opening activity in vitro complex (29,42). This implies that important .jb mediated by its DNA-PKcs-dependent aspects of the interactions between Artemis and c.o rg phosphorylation (29). This corroborates the the other core NHEJ components may have been b/ y findings that a lack of Artemis in vivo leads to overlooked. With this in view, we have analyzed g u V(D)J recombination defects analogous to that the interactions of Artemis and NHEJ proteins es t o produced by a DNA-PKcs deficiency, that is on DNA ends by incubating human nuclear cell n D impaired coding joining in human cells (26,30) extracts with paramagnetic beads bearing ec e m and unresolved coding end hairpins in animals double-stranded oligonucleotides and characteri- b e (28). In addition, DNA-PKcs activates a zing proteins bound to DNA ends. We next have r 2 5 versatile endonuclease activity of Artemis that challenged and validated in cells our in vitro , 2 0 can cleave various substrates near the single- to results by using a detergent-based cellular 18 double-strand transition region (29,31) and the fractionation protocol which allows to assess in Artemis catalytic core for V(D)J recombination situ the DSB-induced recruitment NHEJ repair has been mapped (32,33). Although the initial proteins (19). kinetics of DSB repair is normal in Artemis cells (25), Artemis has been proposed to be MATERIAL AND METHODS responsible for the processing of some kinds of IR-generated DNA DSB since deficient cells Oligonucleotides substrates. Oligodeoxy- have a subtle defect in late repair of DSB ribonucleotides were purchased from Sigma- (34,35). DNA-PKcs-dependent phosphorylation Genosys (France). The blunt-end C0 double- sites in the C-terminal portion of the Artemis stranded (ds) DNA fragment was constructed by have been suggested to have an important annealing the 32 nucleotides oligomer 5’- regulatory role in the activity of the protein (31), TAAAGGGAACAAAAGCTGGGTACCGGTG most of them being not SQ or TQ consensus TTCG-3’ biotinylated on the 5’-end with the DNA-PKcs sites (31). In addition, an ATM- and complementary non-biotinylated oligonucleo- ATR-dependent phosphorylation of Artemis has tide. The 5' C(n) protruding oligonucleotides been reported in cells (34,36,37,38: Riballo, were constructed by annealing the 32-mer 2004 #23) but its relation to Artemis function in biotinylated as above with complementary non- DSB repair is not yet fully understood. biotinylated oligonucleotides bearing various protruding 5' ends (5’-CGCG-3’ for C2, 5’- Kirchgessner, Standford University School of CGATCG-3’ for C4 and 5’-CGTTAACG-3’ for Medecine, CA, USA) were maintained in D- C6, respectively). MEM-F12 1/1 medium. All cells were grown in a humidified atmosphere, at 37 °C with 5% Chemicals. Calicheamicin (cid:2)1 (Cal), a generous CO2. Nuclear protein extracts were prepared as gift from P. R. Hamann (Wyeth Research, Pearl previously described (18) except that the final River, NY, USA), was dissolved in ethanol and dialysis was performed for 3 hr at 4°C in excess stored at -70°C. Neocarzinostatin was a kind gift volume of dialysis buffer as follows : 50 mM from Dr V. Favaudon (Institut Curie, Orsay, Tris-HCl, pH 7.5, 10% glycerol, 100 mM France). It was stored as 1 mM stock solution in potassium glutamate, 1 mM EDTA, 1 mM 10 mM sodium citrate buffer, pH 4.0 at –80 °C dithiothreitol. After preparation, all the extracts and diluted in the same buffer before use. were immediately frozen and stored at -80°C. Cisplatin (cis-diamminedichloro-platinum-II) was a gift from Roger Bellon Cie. Cisplatin (3 Peptide and purified protein. The recombinant mM stock solution) was dissolved in 150 mM N-ter hexaHis-Ku70/Ku80 heterodimer was NaCl and stored at -20°C. Wortmannin (Sigma) expressed in Sf9 cells using baculovirus-based and NU7026 (Calbiochem) were dissolved in expression vector as previously described (44) DMSO (10 mM stock solution) and stored at - and purified on a Hitrap chelating column 20°C. Small aliquots of stock solutions (Amersham) charged with Ni2+ ions followed by D chemicals were used once. a HitrapQ HP (Amersham) anion exchange ow chromatography. The C80 peptide (GSGSEG- nlo a Antibodies. Anti-Ku70 (N3H10), anti-Ku80 GDVDDLLDMI) was synthetized by H. de d (clone 111), anti Ku70/80 (clone 162), anti-p460 Mazarguil (IPBS, Toulouse, France) and fro m (DNA-PKcs, clone 18.2) and anti-actin (clone corresponds to the last 12 C-terminal amino- h ANeCoTmNa0r5k)e rsm. oMnoocnloocnlaoln aal natinbtoibdoiedsy wanetrie c-fmroymc amcoidiest yo fa tK thue8 0N -wteitrhm ian uGs SaGs Sp ulbinliksehre dto ( 4a5 )b. ioTthine ttp://ww (clone 9E10), anti-phosphorylated H2AX peptide buffer used as control was 25 mM Tris- w.jb (JBW301) and anti laminA/C (clone 636) were HCl, pH 8.8. c.o from BD Biosciences, Upstate Cell Signaling brg/ Solutions and Santa Cruz Biotechnology, Ku immunodepletions and Artemis y g u respectively. Polyclonal rabbit antibody anti- immunoprecipitations. For Ku immuno- es XRCC4 and anti-ligase IV were from Serotec depletions, anti-Ku70/80 (162) antibodies were t on D and from Abcam, respectively. The polyclonal coupled to magnetic anti-mouse IgG beads ec e rabbit antibody anti-Rad51 and the monoclonal (Dynabeads M-450, Dynal) according to the mb e antiboby anti-HP1(cid:1) (clone 2HP-2G9) were gifts manufacturer recommendations. Then, 250 μg of r 2 5 from Dr M. Defais (IPBS, Toulouse, France) and nuclear protein extracts were incubated at 4°C , 2 0 Dr R. Losson (IGBMC, Illkirch, France), for 60 min under gentle agitation with 20 μl of 18 respectively. Peroxidase-conjugated goat anti- beads in dialysis buffer. The supernatant was mouse or anti-rabbit secondary antibodies were removed over a magnet (Dynal MPC, Dynal). A from Jackson Immunoresearch Laboratories. second depletion was performed immediately under the same conditions. For Artemis Cell culture and extracts. All culture media immunoprecipitation, anti-myc antibodies were were from Gibco-Invitrogen and were added to Guetel-A nuclear extracts in IP buffer supplemented with 10% foetal calf serum unless (25 mM Hepes-KOH (pH 7.5), 100 mM NaCl, indicated, 2 mM glutamine, 125 U/ml penicillin, 20% glycerol, 5 mM EDTA, 1 mM and 125 (cid:1)g/ml streptomycin. Guetel are SV40T- dithiothreitol, 0.05% NP40, 10 mM NaF, 0.2 transformed, telomerase immortalized Artemis- mM sodium orthovanadate, 1 mM cantharidin deficient fibroblasts and Guetel-A were obtained (Sigma) and protease inhibitor cocktail tablets as after transduction of Guetel with pMND- recommended by the manufacturer (Roche Artemis-myc-ires-GFP retroviral vector Applied Science) and incubated for 2h at 4°C expressing a C-ter myc-his tagged Artemis under agitation, then 20 μl of protein A- protein (37); both cell lines were grown in RMPI immunobeads (Dynal) were added per reaction medium. DNA-PKcs-deficient and - and further incubated for 90 min at 4°C under complemented cell lines (Fus9 - alias M059J, agitation. Then the beads were washed with IP and Fus1, respectively (43) – gift from Dr C. buffer and used as necessary. DNA-ends binding assay. Five pmol of ds DNA-damaging treatments and transfection. oligonucleotide as indicated were immobilized Before drug-exposure, exponen-tially growing on 10 μl streptavidin paramagnetic beads cells were washed with unsupplemented (Dynabeads M280 streptavidin, Dynal) in 50 μl medium, either mock-treated or treated with of 5 mM Tris-HCl, pH 7.5, 0.5 mM EDTA, 1 M chemicals at the specified concentrations in NaCl for 30 min at 20 °C under agitation. After unsupplemented medium at 37 °C in culture washes with the same buffer, DNA- or mock dishes and then harvested at the indicated time treated beads were incubated in 25 μl reaction points. For UV irradiation, cells were washed mixture containing 30 μg nuclear extracts in with phosphate-buffered saline (PBS) and then standard reaction buffer (40 mM Hepes-KOH exposed to UVC-irradiation (254 nm) with a (pH 7.8), 5 mM MgCl2, 60 mM KCl, 0.5 mM germicidal lamp (Bioblock). Immediately after dithiothreitol, 0.5 mM EDTA, 3.4% glycerol, irradiation, unsupplemented medium was added 0.3 mg/ml bovine serum albumin) and 1 mM and cells were post-incubated as above. Fus9 ATP when necessary. For conditions without and Fus1 cells were transiently transfected with ATP, extracts were first incubated for 10 min at the Nucleofector II apparatus (Amaxa) as 30°C in standard reaction buffer without ATP, follows : 2x10 6 cells were transfected with 3μg supplemented with 2 mM glucose and 0.2 U of pcDNA1.1-Artemis-myc vector (37) in 100 μl hexokinase (Sigma) in order to remove trace of Nucleofector V buffer (program A23, about ATP as described (18). For conditions with 43% transfection efficiency), then diluted 15 D wortmannin, extracts were preincubated in the fold and incubated for 48 h in complete medium. o w n presence of 30 μM wortmannin in reaction lo a buffer without oligonucleotide and ATP for 10 Biochemical fractionation and immuno- de d min at for 10 min at 30°C. Control extracts were blotting. Treated or mock-treated cells in culture fro m similarly preincubated in parallel. Incubation dishes were washed twice with ice-cold PBS, h wexatsr acfotsr s3u0p emrniant anatt w30a°s Cr emunodveerd aagnidta ttihoen .b eTahdes cfroalcleticotnedat iobny wascs rcaaprirnige d aonudt byc etnwtroi fcuognesde.c uCtievlel ttp://ww w were washed twice with 250 μl of IP buffer ; extractions. The supernatant was collected at .jb then the beads were heated in SDS sample buffer each step and labeled as fractions S. Pellets of c.o and proteins were separated in a 8% acrylamide about 2x10 6 cells were first resuspended for 3 brg/ y Tris-glycine-SDS gel. min on ice in 200 μl of extraction buffer (50 mM g u Hepes, pH 7.5, 150 mM NaCl, 1 mM EDTA) es t o Coimmunoprecipitation assay. After DNA- containing 0.1% Triton X-100, supplemented n D ends binding assays as above but with five pmol with protease inhibitor cocktail tablets ec e of free C6 ds oligonuclotide, the reaction volume (Complete MiniTM, Roche Diagnostics) and mb e was completed to 100 μl with IP buffer. For IPs phosphatase inhibitors (10 mM NaF, 10 mM (cid:1)- r 2 5 anti-actin, -Ku or -DNA-PKcs, the mixture was glycerophosphate, 1 mM sodium orthovanadate , 2 0 mixed with 10 μl magnetic anti-mouse IgG and 1mM cantharidin, all from Sigma). 18 immunobeads suspension coated with the Following centrifugation at 14,000xg for 3 min, corresponding primary antibodies according to the supernatant was collected (fraction S1) and the manufacturer protocol (Dynal) and the beads the pellet was washed with extraction buffer were mixed gently on a wheel for 3 h at 4°C. For without Triton. The pellet was further incubated IPs anti-Artemis, anti-myc antibodies were first in 100 μl of extraction buffer without Triton but added to the reaction mixture and incubated for supplemented with 200 μg/ml RNaseA (Sigma) 2h at 4°C under agitation, then 20 μl of protein for 30 min at 25°C under agitation. Following A-immunobeads (Dynal) were added per centrifugation at 14,000xg for 3 min, the reaction and further incubated for 90 min at 4°C supernatant (fraction S2) was separated from the under agitation. The beads were pulled down pellet which was then washed with extraction over a magnet, the extracts supernatant was buffer without Triton (fraction P2). When removed, the beads were washed twice with 1 ml necessary, the P2 pellet was incubated for one of IP buffer and proteins in the hour at 37 °C in the presence of 100 U Calf immunoprecipitates were heated in SDS sample Intestine Phosphatase (NEB) in 20 mM Tris- buffer and separated in a 8 % acrylamide Tris- HCl, pH 8, 2 mM magnesium chloride and glycine-SDS gel. protease inhibitors as above. Insoluble P2 fraction was resuspended in PBS buffer supplemented with 1% SDS, heated 10 min at in the protein fraction retained on DNA with no 100°C and sonicated for 10 sec (Vibracel, unspecific binding to the paramagnetic beads in Bioblock Scientific). Whole cell extracts of the absence of DNA. Ku80 bound to DNA was treated or mock-treated cells were obtained by shifted to a slightly slower form under ATP direct lysis in PBS buffer supplemented with 1% conditions corresponding to phosphorylated SDS and treatment as above. Concentrated Ku80 as reported (18). A quantitative loading sample buffer was added for 1X final modulation was observed for DNA-associated concentration in all fractions and the samples Artemis and DNA-PKcs : DNA-PKcs were boiled for 5 min. Equal aliquots of each accumulated on the DNA beads in the presence fraction, derived from equivalent cell numbers, of wortmannin (Fig. 1, lanes 5, 7, 9 and 11) by were separated on SDS-PAGE gels (8% for stalling of DNA-PK at DNA-ends, as reported standard separation or 15% for (cid:3)(cid:1)H2AX and (13). In contrast, DNA-PKcs binding to the HP1(cid:2) isolation) and blotted onto polyvinylidene beads decreased with ATP (Fig. 1, lanes 4, 6, 8 difluoride membranes (Immobilon-P, Millipore). and 10) most probably by autophosphorylation Membranes were blocked for 1 h in 5% dry milk (46). Strikingly, Artemis exhibited a mirror in Phosphate-buffered saline (PBS) containing image since it accumulated on DNA in the 0.1% Tween 20 (PBS-T) and incubated for 1 h presence of ATP and showed a low binding to with primary antibody diluted in PBS containing DNA beads in the presence of wortmannin. In 0.02% Tween 20 and 1% bovine serum albumin the presence of ATP, the association of Artemis D (fraction V, Sigma). After three washes with to DNA-beads increased with the length of the ow n PBS-T, membranes were incubated for 1 h with 5’-protruding DNA end up to four nucleotides lo a secondary antibodies in PBS containing 0.02% but it was also strong with a 3’-protruding ds de d Tween 20 and 5% dry milk. Immunoblots were oligonucleotide (data not shown). In reactions fro m visualized by enhanced chemiluminescence with ATP, Artemis was detected in the DNA h (ImmunofaxA, Yelen). Providing extensive end-associated fraction and in the supernatant ttp://w washing and probing first with polyclonal (data not shown) as a form migrating slower w w antibodies, successive immunoblotting were than in reactions with wortmannin. The slower .jb performed on the same membranes without migrating Artemis was sensitive to protein c.o rg stripping. For data presentation, films were phosphatase indicating that it corresponded to a b/ y scanned and processed with Adobe Photoshop phosphorylated form (data not shown). g u 3.0 software. Artemis was reported to form a stable es t o complex with DNA-PKcs (29). However, the n D RESULTS present data showing an inverse correlation ec e m between DNA-PKcs and Artemis binding to b e DNA-PK kinase activity is necessary to DNA beads could indicate that Artemis alone or r 2 5 maintain the DNA-PKcs/Artemis association associated with a partner other than DNA-PKcs , 2 0 1 during binding to DNA ends in vitro. exhibited a DNA-binding activity. In order to 8 First, we have focused on the protein challenge this hypothesis, we tested under fraction bound to DNA-ends in vitro in order to similar conditions the DNA binding activity of evaluate the capacity of Artemis to be recruited either native or phosphorylated Artemis in the to DNA ends in the context of nuclear extracts. absence of Ku and DNA-PKcs. In the absence of Nuclear extracts from the Guetel-A fibroblasts DNA-PKcs, phosphorylated or native Artemis expressing a C-ter myc-tagged Artemis protein lacked binding activity to the ds easily detected on Western blot were incubated oligonucleotides, which was not restored by with paramagnetic streptavidin beads bearing a adding purified Ku to DNA-beads but restored ds oligonucleotide modified with a biotin moiety upon adding back purified DNA-PKcs (data not at one 5’ end as target DNA. Proteins bound to shown), indicating that DNA-PKcs is necessary DNA ends were analyzed by western blotting. In for Artemis loading to DNA. addition, to assess the role of DNA-PKcs on the Another explanation for the data of Figure assembly of repair proteins onto DNA ends, the 1 was that Ku/DNA-PKcs interaction on DNA reaction was performed either with ATP or in ends destabilized the DNA-PKcs/Artemis the presence of the known DNA-PK inhibitor complex under kinase preventive conditions. In wortmannin. order to analyze the composition of the protein As shown in Figure 1, DNA-PKcs, complex assembled on DNA-ends under kinase Ku70/80 and myc-tagged Artemis were present permissive or preventive conditions, we performed protein assembly on free ds DNA-PKcs (Fig. 3 upper panel, compare lane 4 oligonucleotides followed by immuno- with lanes 3 and 5). In contrast, no significant precipitation experiments with either anti-DNA- variation was detected in the amount of DNA- PKcs or anti-Ku antibodies and checked for PKcs co-precipitated with Artemis from the Ku- coimmuno-precipitation with Artemis (Figure 2). depleted extracts, whatever the incubation None of the three proteins were precipitated by conditions (Fig. 3B lower panel). Low salt the anti-actin control antibody (Fig. 2, lanes 6 conditions promote a Ku-independent DNA- and 11). In contrast, the anti-DNA-PKcs and PKcs binding to DNA (47) and Artemis anti-Ku antibodies precipitated very efficiently phosphorylation with ATP (29). Thus, we have their respective target from the nuclear extracts checked the stability of the DNA-PKcs-Artemis (Fig. 2, compare lanes 2 and 7 with lane 1). In complex on anti-myc immunobeads incubated the absence of added DNA, Ku and DNA-PKcs with DNA under such conditions, in the absence marginally co-precipitated (Fig. 2, lanes 2 and of Ku and in the presence or not of ATP. No 7) as expected (43); in contrast, Ku and DNA- significant release of DNA-PKcs from the beads PKcs co-precipitated in the presence of free ds was detected whatever the incubation conditions oligonucleotides under kinase-preventive (data not shown). Taken together, these results conditions (Fig. 2, lanes 3 and 8, without ATP, indicate that the Ku-mediated assembly of DNA- and lanes 5 and 10, with wortmannin) PK on DNA ends was responsible for a corresponding to the DNA-PK complex stalled dissociation of the DNA-PKcs/Artemis complex D at DNA-ends. On the opposite and as expected, under kinase preventive conditions. o w n ATP dissociated the DNA-PK complex (Fig. 2, In order to focus on DNA-PK assembly lo a lanes 4 and 9). Artemis co-precipitated with onto DNA, we reconstituted the reaction with de d DNA-PKcs but not Ku in nuclear extracts in the purified fractions (Fig. 4). The DNA- fro m absence of DNA (Fig. 2, compare lanes 2 and 7), PKcs/Artemis complex was first immuno- h afrsa ctailorena doyf three pporrotetedi n (i2s9 )e n; gangoetde itnh aat coomnlpyl exa panredc itphietant eidn cfurobmate ndu wclietahr desx troalcigtso nwuictlheooutitd DesN iAn ttp://ww w with DNA-PKcs in extracts from Guetel-A cells. the presence or not of various concentrations of .jb Under conditions in which a whole DNA- purified Ku heterodimer (Figure 4A). DNA plus c.o rg PK/DNA complex was formed, Artemis Ku conditions promoted a dose-dependent loss b/ y remained associated with the complex only of DNA-PKcs from the Artemis immuno- g u when DNA-PKcs was active and it co- precipitates whereas neither DNA nor Ku alone es t o precipitated as a phosphorylated form (Fig. 2, had any effect on DNA-PKcs/Artemis n D lanes 4 and 9). These data confirmed our association. The extreme C-terminal domain of ec e m hypothesis that the Artemis/DNA-PKcs complex Ku80 has been shown to be sufficient for b e was destabilized when DNA-PK assembled on association with DNA-PKcs in the absence of r 2 5 DNA unless the kinase was active. DNA (45,48). Thus, we mimicked the Ku/DNA- , 2 0 PKcs interaction by using a C80 peptide derived 18 Ku is responsible for DNA-PKcs/Artemis from Ku80 C-terminus (45). When the DNA- dissociation upon DNA-PK binding to DNA- PKcs/Artemis complex was immunoprecipitated ends in vitro. as above, addition of the C80 peptide was In order to strengthen these conclusions, sufficient to promote DNA-PKcs/Artemis we performed a similar immunoprecipitation dissociation (Fig. 4B, compare lanes 1 and 2). experiment with standard and Ku-immuno- In contrast, when the DNA-PKcs/Artemis was depleted nuclear extracts in parallel and immunoprecipitated under conditions promoting analyzed the DNA-PK components co- DNA-PK assembly and Artemis phosphorylation immunoprecipitating with Artemis (Figure 3). (ATP plus DNA - Fig. 4B, note the shift of The anti-myc antibody precipitated efficiently Artemis and the presence of Ku in lanes 3 and Artemis from the nuclear extracts (Fig. 3, 4), the Ku80 C-ter peptide rather dissociated Ku compare lane 2 with lane 1). Only a fraction of from the complex and most of DNA-PKcs still DNA-PKcs associated stably with Artemis (Fig. precipitated with phosphorylated Artemis (Fig. 3, lane 2). In control extracts, we found again 4B, compare lanes 3 and 4). that Artemis remained associated with DNA- Taken together, these data from in vitro PKcs only when the latter was active (+ATP) experiments establish that Ku binding to DNA- and under these conditions, it co-precipitated as PKcs in the presence of ds DNA, most probably a phosphorylated form, together with Ku and via its extreme C-terminus promotes Artemis dissociation from DNA-PKcs, unless the kinase IV, XRCC4 and (cid:1)H2AX, the phosphorylated is active. form on serine residue 139 of the histone H2AX variant which is admitted to be a quantitative Artemis is recruited to chromatin containing nuclear marker of DSBs (52). In addition, an DSB in cells. anti-Rad51 antibody was used to probe the In order to validate our previous homologous recombination (HR) route for DSB conclusions in cells, experiments were then repair. WCE of Artemis deficient cells serve as a performed in Guetel-A fibroblasts expressing the negative control for Artemis expression (Fig. myc-tagged Artemis construct after stable 5A, lane 1). As opposed to non-treated cells, retroviral transduction of Guetel Artemis- WCE from Cal-treated cells contain (cid:1)H2AX deficient cells (37). Guetel-A fibroblasts were (Fig. 5A, lane 2), in agreement with the high either treated or not with drugs producing DSB DNA double-strand breaking potency of Cal. In formation, calicheamicin (cid:1)1 (Cal) and untreated cells, the majority of NHEJ proteins neocarzinostatin (Ncs). Cal and Ncs are natural was released during the two extraction steps and enediyne antibiotics which have been shown to only a marginal amount was detected in the produce DSB with selectivity and efficiency insoluble P2 fraction while on the opposite, the higher than IR (49) and to efficiently induce P2 fraction from Cal-treated cells was highly DBS and cytotoxicity when applied to cells enriched for these proteins, including Artemis (50,51). Fibroblasts established from Artemis- (Fig. 5A, compare lanes 8 and 9). Also, (cid:1)H2AX D defective patients as well as Artemis-/- MEFs was exclusively present in the insoluble P2 ow from Artemis-/- mice show increased sensitivity fraction from Cal-treated cells. In contrast, nlo a to IR (26-28) as well as to the radiomimetic drug Rad51 protein was detected identically in the P2 de d bleomycin (27). Accordingly, we observed also fraction of drug treated and non-treated cells. In fro m a marked increased sensitivity of Guetel addition, Artemis and XRCC4 in all the fractions h fibroblasts to the radiomimetic drugs Cal and of Cal-treated cells were detected essentially as ttp://w Ncs, which was fully restored in Guetel-A cells slow migrating forms which were sensitive to w w by expression of myc-tagged Artemis (data not calf intestine phosphatase (data not shown), .jb c shown). corresponding to phosphorylated forms, as .o rg We have described recently a detergent- already reported for XRCC4 (19). b/ y based cellular fractionation protocol allowing to Since Artemis defective mutants are g u e assess in situ the DSB-induced recruitment of selectively sensitive to DSB-inducing agents, we st o the main NHEJ repair proteins, as visualized by then analyzed the specificity of protein n D immunoblot analysis (19). This protocol was recruitment towards the class of DNA lesions ec e m applied to Guetel-A cells in order to check for (Figure 5B). As expected for the recruitment of a b e Artemis mobilization to chromatin after DSB key NHEJ protein, we found that phophorylated r 2 5 infliction. Since Cal yields a 1:3 ratio of DNA XRCC4 was retained in the P2 insoluble fraction , 2 0 1 DSB to single-strand breaks in vivo, compared to following treatment of cells with the DSB- 8 a 1:20 ratio for IR (50), we have chosen this inducing agents Ncs and Cal, in correlation with radiomimetic drug to treat the cells. After one the appearance of (cid:1)-H2AX. Notably, the hour drug treatment, cell nuclei were extracted retention of Artemis paralleled that of XRCC4 with a triton-containing buffer and the clarified and the recruitment of Artemis was accompanied cell extract supernatant was collected (S1) after by its phosphorylation. In addition, Artemis was centrigation. The cell pellet was treated with similarly recruited after cell treatment with RNaseA in the same buffer but without detergent bleomycin and IR (data not shown). In contrast as described (19) and the soluble and insoluble and when compared with the untreated cells, fractions were collected after centrifugation (S2 there was no significant retention of both and P2, respectively). A parallel extraction Artemis and XRCC4 proteins when these cells procedure was performed on untreated and were heavily irradiated with UV-C rays or damaged cells after Cal treatment. Figure 5A treated with the cross-linking agent cisplatin shows the immunoblot analysis following SDS- (Figure 5B). Then, the time course of protein PAGE of cell-equivalent aliquots of the three retention in the extraction-resistant fraction P2 in fractions compared with whole cells extracts Guetel-A cells after exposure to Cal was (WCE), under both untreated and Cal-treated examined. Figure 5C shows that (cid:1)H2AX conditions. Proteins were detected by antibodies formation was detected at 5 min, the earliest against Artemis, DNA-PKcs, Ku80, DNA ligase time point examined and that the kinetics of experiments by assessing in vivo the effect of the Artemis, Ku and XRCC4 proteins retention was DNA-PKcs kinase activity on the association of in close synchrony with the appearance of Artemis with damaged DNA. The selective (cid:1)H2AX, as already shown for the core NHEJ DNA-PKcs inhibitor NU7026 has been shown to proteins (19). In addition, Artemis and XRCC4 exhibit a strong DNA-PKcs-dependent showed a similar retention pattern with the radiosensitization effect on cells at 10 μM when appearance of an intermediate migrating form, added 1h before irradiation (53). Therefore, followed by progressive accumulation of an Guetel-A cells were pretreated or not with 10 even slower migrating form, most likely μM NU7026 for one hour and then Cal was corresponding to multiple phosphorylated forms. added for further incubation at 37°C. The The kinetics of Cal-induced Artemis extraction protocol was achieved as above and phosphorylation is in agreement with the one the WCE and P2 protein fractions were analyzed reported after IR (35,37). by western-blot. As shown in Figure 7A, the DNA-PKcs inhibitor had no obvious effect on DNA-PKcs is necessary for the recruitment of the strong mobilization of Ku and DNA-PKcs to Artemis to DSB in chromatin. the damaged chromatin (Fig. 7A, compare lanes We then tested whether Artemis relied on 3 and 4). XRCC4 was also heavily recruited DNA-PKcs for its damaged-induced recruitment under DNA-PK activity permissive or preventive as we have found in vitro. Thus, M059J conditions, but NU7026 abolished its D glioblastoma cells that do not express DNA- phosphorylation (Fig. 7A, compare lanes 3 and ow n PKcs (DNA-PKcs-deficient cells, Fus9) and 4). Accordingly, we have shown elsewhere that lo a M059J-complemented cells that contain an extra DNA-PKcs-dependent XRCC4 phosphorylation de d copy of the human gene coding for DNA-PKcs was dispensable for its recruitment to damaged fro m (DNA-PKcs-complemented cells, Fus1) (43) chromatin (19). The lack of XRCC4 h were transfected with a pcDNA1.1 vector phosphorylation in the presence of NU7026 is ttp://w expressing the myc-tagged Artemis protein. thus a good indicator of the actual DNA-PKcs w w After 48 hr expression, both cells were treated inhibition under these conditions. Artemis was .jb with Cal and the recruitment of Artemis to the clearly mobilized to the P2 fraction of Cal- c.o rg insoluble chromatin fraction was assessed. As treated cells in which it was detected in a b/ y shown in Figure 6, Artemis was equally phosphorylated form (Fig. 7A, lanes 3). In g u expressed from the transfected vector in both contrast, Artemis was hardly detectable in the P2 es t o DNA-PKcs-proficient and -defective cells, fraction of cells treated with both NU7026 and n D indicating that Artemis is not likely to be Cal, yielding the same marginal amount as in the ec e m stabilized by its interaction with DNA-PKcs control untreated cells (Fig. 7A, compare lanes 2 b e (Fig. 6, lanes 1 and 4). After treatment with Cal, and 4). When the WCE were analyzed, Artemis r 2 5 Ku80 was similarly recruited to the damaged was fully phosphorylated in the Cal-treated cells , 2 0 1 chromatin in both cell lines as reported (19) but but, after treatment with Cal in the presence of 8 in sharp contrast, Artemis mobilization to the P2 NU7026, migrated as the in the control untreated fraction was only detected in the DNA-PKcs cells (Fig. 7B). This indicates that the proficient cells together with DNA-PKcs phosphorylation observed under these conditions recruitment and in addition, it was detected as a mostly relied on the NU7026-sensitive DNA- phosphorylated from (Fig. 6, compare lanes 3 PKcs activity. In conclusion, the stabilization of and 6). Artemis on DSB is dependent on the kinase The simplest interpretation of these results activity of DNA-PK. is that DNA-PKcs is necessary for Artemis stable recruitment to DSB in chromatin in DISCUSSION agreement with our in vitro data. Artemis protein is the factor of the NHEJ The stabilization of Artemis on DSB- apparatus for which the less is known about its containing chromatin is dependent on the interactions with the other components of the kinase activity of DNA-PKcs. reaction. Here, we have analyzed the interactions Since we have set up conditions allowing of Artemis and NHEJ proteins both in a context to analyze in the cells the DNA-PKcs-dependent of human nuclear cell extracts and in cells. mobilization of Artemis to broken chromatin, we In untreated cells, most of Artemis then challenged our conclusions from in vitro belongs to the soluble nucleoplasmic compartment since it is exclusively found in the It could be argued that the short DNA soluble protein fraction as shown here by targets used in vitro may not permit sufficient biochemical analysis. In contrast, DSB induce space for colocalization of DNA-PKcs, Ku and the mobilization of Artemis together with DNA- Artemis. However, this hypothesis is unlikely PK and XRCC4/ligase IV proteins to a since an excess of the Ku80 C-ter peptide detergent-resistant nuclear compartment. The promoted efficiently Artemis/DNA-PKcs Artemis mobilization to damaged chromatin is dissociation even in the absence of DNA, specifically initiated by DSB-inducing agents, implying another mechanism. like that of the other NHEJ factors as detected by Interestingly, Ku dissociates Artemis from us (19) and another group using this technique DNA-PKcs in the presence of DNA whereas the (14,54). The time course of appearance of this C-ter Ku80 peptide is efficient without DNA. It recruitment paralleled that of the DSB-specific has been demonstrated that the conserved C- induction of H2AX phosphorylation and for the terminal motif of Ku80 is required for the milder doses, the disruption of Artemis efficient recruitment of DNA-PKcs to DNA ends recruitment and dephosphorylation of (cid:1)-H2AX in vitro (55). In addition, cells expressing a form occurred concomitantly (unpublished results), of Ku80 lacking the C-terminus exhibit a DNA- compatible with the forming and rejoining PKcs minus phenotype despite the kinase is kinetics of DSB generated in normal cells (50). present and the Ku DNA binding property is Thus, it is most likely that the mobilization of conserved, indicating that the extreme C- D Artemis to a less-extractable nuclear terminus of Ku80 is also required for DNA-PKcs ow n compartment observed here corresponds bona recruitment and activation at DNA DSB in cells lo a fide to its loading onto sites of DNA DSB. This (48,55). Moreover, a C-terminal fragment of de d may reflect the role of Artemis in the repair of a Ku80 confers a dominant-negative effect on fro m subclass of non-V(D)J DSB, as previously DSB repair and radiosensitivity (56) and the h inferred from the inability of Artemis-deficient Ku80 C-ter peptide sensitizes cells to DSB (57). ttp://w cells to rejoin a low percentage of radiation- Since it has been shown that Ku and DNA-PKcs w w induced breaks (34,35). do not associate in the absence of a DNA .jb We report that DNA-PKcs is necessary for terminus (58) while a Ku80 C-ter fragment is c.o rg the loading of Artemis on damaged chromatin in sufficient to interact with DNA-PKcs (45), it is b/ y cells since no Artemis was detected in the most likely that Ku binding to a DNA end g u detergent resistant nuclear fraction in Cal-treated exposes the Ku80 C-terminus as a docking es t o DNA-PKcs deficient cells, despite normal module for DNA-PKcs, probably necessary for n D mobilization of Ku, as already reported (19). other subsequent stabilizing interactions (55). ec e m Moreover, in cell extracts devoid of DNA-PKcs, This region absent in the X-ray structure of the b e Artemis cannot be recruited to DNA ends even Ku heterodimer with DNA (59), was shown r 2 5 in the presence of Ku. Thus, Ku or another flexible in solution by NMR determination and , 2 0 1 partner possibly associated with Artemis fraction exhibited a high helical propensity allowing 8 cannot substitute for DNA-PKcs to load Artemis folding upon Ku binding to DNA or to its onto DSB. Consequently, the Artemis/DNA- protein partner (60,61). Thus, Ku binding to PKcs complex reported by Ma et coll. (29) that DNA or the Ku80 C-ter motif may displace we also found here, is most likely to represent Artemis from DNA-PKcs by competition on the the functional complex in DSB repair. same domain of the kinase. Previous studies We have established here that under have established that residues in the FAT kinase preventive conditions, Ku-mediated domain of DNA-PKcs adjacent to the catalytic assembly of DNA-PK on DNA ends is domain are involved in its interaction with Ku responsible for a dissociation of the DNA- (62), contrarily to the leucine-rich region (54). PKcs/Artemis complex. This result was obtained One possibility is that the DNA-PKcs FAT by monitoring the protein fraction bound to ds domain is involved similarly in interactions with oligonucleotides on beads in cell extracts and Ku80 and Artemis, implying that some domain also the association of Artemis with DNA-PKcs of Artemis may share a structural homology with in co-IP experiments. In addition, experiments in the Ku80 C-ter. Another possibility is that cells corroborated this result since Artemis Artemis dissociation is elicited by a change of recruitment in damaged chromatin was not DNA-PKcs conformation. Indeed, several detected in cells pretreated with a DNA-PKcs studies have revealed extensive conformational specific inhibitor. changes of the DNA-bound kinase consisting of domains rearrangements, including the FAT or sub-phosphorylated and may be necessary to portion to form channels that could load Artemis to its substrate and/or to maintain accommodate duplex and single-stranded DNA a proper configuration of the DNA termini. (63-66). Thus, deciphering whether Ku Alternatively, Artemis phosphorylation per se dissociates the Artemis/DNA-PKcs complex via could change its interactions with DNA-PK an induced change of DNA-PKs conformation or and/or DNA. Artemis phosphorylation takes a competition on the same binding site on DNA- place on the C-terminal domain (31,37) possibly PKcs awaits further experiments. In addition, the allowing extrusion of the inhibitory C-terminal role of another DNA-PKcs partner for this domain (31), which could also be implicated in dissociation in cells cannot be excluded. maintaining Artemis association with the DNA- Our present data from in vitro and in cells PK/DNA complex. experiments showed that the activity of the In Cal-treated cells, Artemis was detected DNA-PKcs kinase prevented Artemis as a phosphorylated protein and a specific DNA- dissociation from the DNA-PK/DNA complex. PKcs inhibitor abrogated this phosphorylation, This is in agreement with the results of Ma et implying that DNA-PKcs was mainly coll. who showed that DNA-PKcs is physically responsible for Artemis phosphorylation under required for Artemis activity after its these conditions. This is in contrast with other phosphorylation (42) and that DNA-PKcs reports which implicated also ATM in Artemis remained associated with Artemis immunobeads IR-induced phosphorylation (35,37). Our results D after phosphorylation and stringent washes (31). more easily conciliate with the biochemical o w n Under our conditions, Artemis accumulation on evidence of the DNA-PK-mediated activation of lo a ds oligonucleotides in vitro was correlated with the Artemis endonucleolytic function (29,42). de d the length of the 5’ or 3’ single-stranded tail. A This discrepancy may rely on the DSB inflicted fro m plausible explanation is that DNA-PKcs which in the case of Cal may be enriched in the h athceti vsas titoanil masa yre pboer tperdo p(o6r7t)i oannadl ttoh atth teh ele nacgttihv iotyf subclassA plrtoocgeestsheedr, boyu Ar rdteatma isa.l l ow to propose a ttp://ww w level may in turn regulate the extent of the model in which a DNA-PKcs mediated .jb Artemis/DNA-PK complex stabilization. The phosphorylation is necessary both to activate c.o rg shift from an unstable Artemis/DNA-PK/DNA Artemis and to maintain its association with the b/ y complex to a stable association relies probably DNA-PK/DNA-ends site (Figure 8). DNA-PKcs g u on a change in the geometry of the protein/DNA may constitute a flexible sensor of various es t o complex involving Artemis and/or DNA-PKcs unusual structures (68) on which an improperly n D phosphorylation. Indeed, differential auto- controlled nuclease activity may cause genetic ec e m phophorylation of DNA-PKcs on two major instability. Thus, a tight functional coupling b e clusters has been shown to greatly influence between the activation of both DNA-PKcs and r 2 5 DNA-end access to processing enzymes Artemis is undispensable. Together with the , 2 0 (reviewed in (11)). A current model is that an incapacity of the sole Artemis protein to load 18 intermediate phophorylated state of DNA-PKcs onto DNA termini, it may avoid undesirable directs a rearrangement of the DNA-PK complex nucleolytic activity on binding sites of DNA- that ensures access to broken ends whereas PKcs other than DSB which may not necessarily complete autophosphorylation dissociates the activate the kinase. complex from DNA-ends (14,15). Thus the DNA-PKcs associated with Artemis under kinase permissive conditions may be either un- ACKNOWLEDGEMENTS We thank P. R. Hamann (Wyeth Research) for the generous gift of calicheamicin (cid:1)1. This work was partly supported by grants from the Association pour la Recherche sur le Cancer (ARC), the Ligue Nationale Contre le Cancer, a Radiobiology grant of Electricité de France (EDF) and the Commisariat à l’Energie Atomique (CEA).