Logout succeed
Logout succeed. See you again!

Irish Genes and Ancestry - Eneclann PDF
Preview Irish Genes and Ancestry - Eneclann
Copyright Gianpiero Cavalleri Irish Genes and Ancestry Dr. Gianpiero Cavalleri Eneclann Summer Lunchtime Series 2012 Detailed genetic ancestry information through state of the art gene analysis Copyright Gianpiero Cavalleri Overview.. • Introduction to DNA, Y chromosome, mtDNA • How DNA has informed us about global population history • Patterns of Y chromosome types we see in Ireland • How genetics can inform on genealogy • Sources for more information Copyright Gianpiero Cavalleri •3 billion letter archive written in ACGT •Only small portion of our DNA (the genes) encodes instructions to build a human •Changes (mutations) occur in our DNA with each generation •These chages are inherited down through generations •~99.9% of our DNA is identical Copyright Gianpiero Cavalleri Copyright Gianpiero Cavalleri Single nucleotide polymorphism (SNP) CGTACTATGACCCGAGCTAGCCCTA Pat CGTACGATGACCCAAGCTAGCCCTA Jack M269 M182 Microsatellite/short tandem repeat (STR) CCGTGCATGCATGCATGCATGCACC Pat (5 copies) CCGTGCATGCATGCATGCATGCATGCACC Jack (6 copies) DYS19 “T” at M269 + “G” at M182 + “5” copies at DYS19 = haplotype i.e. combination = haplotype Copyright Gianpiero Cavalleri Groups and types found at different frequencies in different populations Isolation (i.e. within population marriage) and fact that some people have more (grand)children than others Isolation! 0.45 0.4 Distance between spouse 0.35 birthplaces for all marriages 0.3 1855-1955 0.25 % 0.2 0.15 0.1 0.05 0 0-1 1-2 2-3 3-4 4-5 5-6 6-7 7-8 8-9 ? distance (miles) Basis of all genetic history work Copyright Gianpiero Cavalleri mtDA mtDNA tree Y chromosome tree Copyright Gianpiero Cavalleri The evolution of modern humans.. Homo erectus Approx 1.8 – 1.1 mya Radiated from Africa to Europe & Asia Copyright Gianpiero Cavalleri Homo sapiens spread and diversified, moving out of Africa approx 100 kya Early migration towards South East Asia – approx 100 – 60 kya Later migration towards Eurasia 70 – 40 kya As a consequence – we expect to observe in non-Africans, a subset of genetic variation present in modern African populations Copyright Gianpiero Cavalleri R1b across Europe.. ~150k years ago ~80k years ago ~60k years ago ~40k years ago ~25k years ago LGM ~18k years ago