loading

Logout succeed

Logout succeed. See you again!

ebook img

jpet # 100677 attenuation of oxygen-induced abnormal lung maturation in rats by retinoic acid PDF

pages45 Pages
release year2006
file size1.4 MB
languageEnglish

Preview jpet # 100677 attenuation of oxygen-induced abnormal lung maturation in rats by retinoic acid

JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 JPET FaTshtis Farotircwle aharsd n.o Pt bueebnl icsophyeeddi teodn a nFde fobrrmuaatterdy. T2h3e, f i2n0al0 v6er saiosn DmOayI d:1iff0e.r1 fr1o2m4 t/hjips evetr.s1io0n5..100677 JPET # 100677 ATTENUATION OF OXYGEN-INDUCED ABNORMAL LUNG MATURATION IN RATS BY RETINOIC ACID: POSSIBLE ROLE OF CYTOCHROME P4501A ENZYMES XANTHI I. COUROUCLI, YANHONG W LIANG, WEIWU JIANG, ROBERTO BARRIOS, AND BHAGAVATULA MOORTHY D o w n lo a d e DEPARTMENT OF PEDIATRICS, BAYLOR COLLEGE OF MEDICINE (X.I.C; Y.W.L; d fro m W.J.; B.M.), HOUSTON, TX AND DEPARTMENT OF PATHOLOGY, THE METHODIST jp e t.a s p e HOSPITAL (RB), HOUSTON, TX tjo u rn a ls .o rg a t A S P E T J o u rn a ls o n F e b ru a ry 1 , 2 0 2 3 1 Copyright 2006 by the American Society for Pharmacology and Experimental Therapeutics. JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 Running Title: Attenuation of oxygen-induced abnormal lung maturation Corresponding Author: Xanthi I.Couroucli, M.D. Assistant Professor of Pediatrics Baylor College of Medicine 6621 Fannin, F.C. 530.01 Houston, TX 77030 Email: [email protected] Tel: (832) 824-3209 FAX: (832) 825-3204 D o w Number of Text Pages: 33 n lo a d e Number of Tables: 2 d fro m Number of Figures: 12 jp e t.a s p e Number of References: 40 tjo u rn a Number of words in abstract: 243 ls .o rg a Number of words in Introduction: 747 t A S P E T Number of words in Discussion: 1224 J o u rn a ls o n F Abbreviations: BPD, bronchopulmonary dysplasia; ROS, reactive oxygen species; CYP, eb ru a ry cytochrome P450; AHR, Ah receptor; EROD, ethoxyresourufin O-deethylase; MROD, 1 , 2 0 2 3 methoxyresorufin O-demethylase; ANOVA, analyses of variance; AHREs, Ah response elements; ARNT, Ah receptor nuclear translocator; SDS-PAGE, SDS-polyacrylamide gel electrophoresis; H & E, hematoxylin & eosin; RA, retinoic acid; RAR; retinoic acid receptor; RXR, retinoic acid X receptor; VEGF, vascular endothelial growth factor. Section Assignment: Gastrointestinal, hepatic, pulmonary, & renal 2 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 ABSTRACT Supplemental oxygen is frequently used in the treatment of infants having pulmonary insufficiency, but prolonged hyperoxia may contribute to the development of bronchopulmonary dysplasia (BPD) in these infants. Cytochrome P450 (CYP) 1A enzymes have been implicated in hyperoxic lung injury. Retinoic acid (RA) plays a key role in lung development. Here, we tested D o w the hypotheses that newborn rats exposed to a combination of RA and hyperoxia would be less n lo a d e susceptible to lung injury than those exposed to hyperoxia only, and that modulation of CYP1A d fro m enzymes by RA contribute to the beneficial effects of RA against hyperoxic lung injury. jp e t.a s p e Newborn rats exposed to hyperoxia for 7 days showed higher lung weight/body weight tjo u rn a (LW/BW) ratios compared to those exposed to RA + hyperoxia. Hyperoxia for 7 days also ls .o rg a caused a significant increase in hepatic and pulmonary CYP1A1/1A2 expression compared to t A S P E T air-breathing controls. RA + hyperoxia treatment lowered the expression of these genes. Seven J o u rn a to 30 days after withdrawal of hyperoxia, the animals showed marked induction of hepatic and ls o n F pulmonary CYP1A1/1A2 expression, but animals that had been given RA + hyperoxia displayed eb ru a ry lower expression of these enzymes. On postnatal days (PND) 22 or 38, the hyperoxic animals 1 , 2 0 2 3 displayed retarded lung alveolarization; however, the RA + hyperoxia-exposed animals showed improved alveolarization. The improved alveolarization in animals given RA + hyperoxia, in conjunction with the attenuation of CYP1A1 and 1A2 expression in these animals suggests that this phenomenon may play a role in the beneficial effects of RA. 3 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 Introduction Supplemental oxygen therapy is frequently used in preterm and term infants and in adults with acute respiratory distress syndrome (Northway and Rosan, 1968). Considerable evidence links oxygen to the development of bronchopulmonary dysplasia (BPD) in premature infants (Tsai et al., 1972). Exposure of experimental animals to hyperoxia causes lung damage (Frank, 1991; Couroucli et al., 2002; Jiang et al., 2004). Hyperoxia exposure in the newborn rodents leads to arrested alveolarization and abnormal lung maturation in adulthood (Frank, 1991; Lin et D o w al., 2005; Bourbon et al., 2005). The molecular mechanisms responsible for oxygen toxicity are n lo a d e not completely understood, but reactive oxygen species (ROS) have been implicated (Frank, d fro m 1991). jp e t.a s p e Cytochrome P450 (CYP) enzymes are a superfamily of hemoproteins that metabolize a tjo u rn a large number of endogenous and exogenous compounds through mechanisms that include ls .o rg a oxidation, reduction, and peroxidation (Guengerich, 1990). Among these, the CYP1A enzymes t A S P E T are of particular interest to oxygen toxicity, as indicated by differential susceptibilities of aryl J o u rn a hydrocarbon (Ah)-responsive mice and Ah-nonresponsive mice to oxygen-induced lung injury ls o n F (Gonder et al., 1985). Exposure of adult rats to hyperoxia for 48 h leads to induction of CYP1A eb ru a ry enzymes in liver and lung (Okamaoto et al., 1993; Moorthy et al., 1997; Couroucli et al., 2002), 1 , 2 0 2 3 Interestingly, the induction of CYP1A enzymes in liver and lung declines after continuation of hyperoxia for 60 h, the time period that coincides with overt respiratory distress in these animals, suggesting that decline of CYP1A enzyme induction contributes to hyperoxic lung injury (Moorthy et al., 1997; 2000; Couroucli et al., 2002). Mansour et al. (1988a; 1988b) observed protection against hyperoxia-induced lung injury by pretreatment of adult rats or mice with the CYP1A1 inducer 3-methylcholanthrene (MC). We recently showed that the CYP1A inducer β- 4 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 naphthoflavone protects adult rats against hyperoxic lung damage (Sinha et al., 2005). Adult mice deficient in the gene for the Ah receptor (AHR) (Jiang et al., 2004) or the liver-specific CYP1A2 (Moorthy et al., 2005) are more susceptible to hyperoxic lung injury than wild type mice, supporting the hypothesis that the CYP1A enzymes play a beneficial role against lung injury in adult animals. Since CYP1A2 is specifically expressed in the liver, it is possible that hepatic CYP1A enzymes also play important role(s) in the effects of hyperoxia (Moorthy et al., 2005). In contrast, oxygen-induced lung damage in neonatal rats is potentiated by pretreatment D o w with the CYP1A inducer MC (Theibault et al., 1991). The paradoxical effects of CYP1A n lo a d e inducers on hyperoxic lung injury in adult and newborn rats strongly suggest that the d fro m developmental status of the animal significantly influences the susceptibility of the organism to jp e t.a s p e modulation by CYP1A inducers. tjo u rn a Retinoic acid (RA) and its synthetic analogs are potent regulators of a diverse group of ls .o rg a biological processes, including growth, differentiation, cell proliferation, and morphogenesis t A S P E T (Gudas et al., 1994). The biological effects of RA and its synthetic analogs are mediated by RA J o u rn a receptors (RARs) and RXRs (Chambon, 1996; Kimura et al., 2002). The RARs and RXRs are ls o n F RA-inducible transcriptional regulatory proteins that regulate gene expression via specific cis- eb ru a ry acting DNA sequences [retinoic acid response elements (RAREs)] located in the promoters of 1 , 2 0 2 3 target genes. RA may modulate CYP1A1 gene expression through retinoid receptors or through the AHR (Suprano et al., 2001). Recent work has suggested that RA plays a key role in induction of formation of septa during lung alveolarization (Massaro and Massaro, 2002). Furthermore, it has been recently reported that early lung bud formation and subsequent branching and morphogenesis are characterized by distinct stages of RA signaling. If alveolarization is compromised at this stage 5 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 by exposure to hyperoxia or other insults, the changes persist into adulthood. These observations are of clinical significance because a similar type of altered lung development (retarded alveolarization) is seen in infants who develop BPD (Margraf et al., 1991). Recently, Veness- Meehan et al. (2002) and Ozer et al. (2005) have reported that RA treatment during hyperoxia has beneficial effects on lung alveolarization, but the mechanisms are not understood. Randomized double-blinded clinical trails have suggested that vitamin A supplementation in extremely low birth weight infants might decrease the risk for chronic lung disease (Tyson et al., D o w 1999). n lo a d e Since CYP1A enzymes in the newborn animals appear to play important roles in lung d fro m injury, and because RA may modulate CYP1A expression, in this investigation, we tested the jp e t.a s p e hypothesis that pretreatment of newborn rats with RA, prior to exposure to hyperoxia would tjo u rn a protect animals from oxygen-induced abnormal lung maturation during adulthood and that ls .o rg a modulation of pulmonary as well as hepatic CYP1A enzymes contribute to the beneficial effects t A S P E T of RA. J o u rn a ls o n F e b ru a ry 1 , 2 0 2 3 6 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 Materials and Methods Animals. Timed pregnant newborn Fisher 344 rats were purchased from Charles River. Newborn rats were delivered from these mothers. Newborn rats were treated i.p. with RA (0.5 mg/kg) or vehicle [(corn oil (CO)], once daily for 5 days and were either maintained in room air or placed in oxygen chambers (> 95% O ) immediately after the first RA treatment. Exposure to 2 hyperoxia was continued for 7 days, and the animals were either sacrificed immediately (PND 8) or were returned to room air and were sacrificed on PND 15, 22, or 38. It was ensured that D o w minimum air exposure (less than 5 min) occurred when hyperoxic animals were treated with RA n lo a d e from day 2 to day 5. Lung injury was analyzed measuring ratios of lung weight to body weight d fro m (LW/BW) and by histology. All animal experiments were carried out in accordance to the Guide jp e t.a s p e for the Care and Use of Laboratory Animals as adopted and promulugated by the U.S. National tjo u rn a Institutes of Health. The experiments reported herein were reviewed and approved by the Baylor ls .o rg a Institutional Animal Care and Use Committee. t A S P E T J o u rn a Hyperoxia Exposure. The newborn animals were either maintained in room air or exposed to > ls o n F 95 % O for 7 days using pure O at 5 L/min, as we have described previously (Couroucli et al., eb 2 2 ru a ry 2002). The dams were rotated between hyperoxic and room air chambers once every 24 h to 1 , 2 0 2 3 prevent toxicity to the mothers. Perfusion and tissue harvesting. At the termination of their respective exposures, 8 rats from each group were anesthetized with sodium pentobarbital (200 mg/kg), i.p. and euthanized by exsanguination while under deep pentobarbital anesthesia. The lungs were perfused with phosphate buffered saline, and microsomes were prepared for subsequent analyses of CYP1A1- dependent activities and immunoreactive protein contents in individual animals. The livers were 7 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 also obtained for CYP1A1/1A2 analyses. For histological studies, the left lungs were inflated through the intratracheal catheter and were fixed at constant pressure (20 cm H O) with zinc 2 formalin after which the lungs were embedded in paraffin for subsequent histological analyses for assessing lung injury (Couroucli et al, 2002). The right lungs were used for subsequent RNA isolation and analyses. Chemicals. Calcium chloride, Tris, sucrose, NADPH, bovine serum albumin, ethoxyresorufin, glutathione reductase, glucose 6-phosphate, and glucose 6-phosphate dehydrogenase were D o w purchased from Sigma Chemical Co. (St. Louis, MO). Buffer components for electrophoresis n lo a d e and western blotting were obtained from Bio-Rad laboratories (Hercules, CA). The primary d fro m monoclonal antibody to CYP1A1, which cross-reacts with CYP1A2 (Thomas et al., 1984), was a jp e t.a s p e generous gift from Dr. P.E. Thomas. Goat anti-mouse IgG conjugated with horseradish tjo u rn a peroxidase was from Bio-Rad laboratories (Richmond, CA). ls .o rg a Preparation of Microsomes and Enzyme Assays. Lungs and livers were perfused with ice- t A S P E T cold phosphate-buffered saline, pH 7.4. Lung microsomes were prepared by differential J o u rn a centrifugation, as reported previously (Couroucli et al., 2002) from individual animals. Liver ls o n F microsomes were isolated by the calcium chloride precipitation method (Moorthy et al., 1997). eb ru a ry Protein concentrations were estimated by the Bradford dye-binding method (Bradford, 1976). 1 , 2 0 2 3 Ethoxyresorufin O-deethylase (EROD) (CYP1A1) activities in lung and liver microsomes and methoxyresorufin O-demethylase (MROD) (CYP1A2) activities in liver microsomes were assayed as we have described previously (Moorthy et al., 1997). Western blotting. Liver microsomes (20 µg of protein) prepared from individual animals were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) in 7.5% 8 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 acrylamide gels. The separated proteins on the gels were transferred to polyvinylidene difluoride membranes, followed by Western blotting (Moorthy et al., 1997; 2000; Couroucli et al., 2002). Reverse transcriptase-polymerase chain reaction (RT-PCR) Assays. Total RNA (20 µg) from livers of air-breathing and hyperoxic animals was reverse-transcribed (Wang and Strobel, 1998; Couroucli et al., 2002), and the resulting cDNA was used as template for PCR analysis. Primers specific for CYP1A1 (5' GGCCAGACCTCTCTACAGTTC-3’) and 5' GCCAAGCATATGGCACAG-3'); and cyclophilin (CYC) (5' CGAGCTTTTTGCAGCCAAAG 3' D o w and 5' AGCCACTCAGTCTTGGCAGT 3'), as internal control, were used in PCR reactions to n lo a d e d amplify the corresponding cDNAs made in the reverse transcriptase step (Wang and Strobel, fro m 1998; Couroucli e al., 2002). jpe t.a s p e Southern Blot Analysis of PCR Products. The PCR products, generated by PCR amplification tjo u rn a of cDNA for 35 cycles, were separated on 1% agarose gel, transferred to nylon membranes by ls.o rg a capillary blotting, and probed with random prime labeled cDNA probes for CYP1A1 or t A S P E T cyclophilin (CYC), which were prepared by PCR amplification, followed by purification and J o u rn a extraction of the PCR-products from agarose gels (Wang and Strobel, 1998). The membranes ls o n F e were exposed to a phosphor-imager, and pixel densities of the PCR products were measured b ru a ry (Couroucli et al., 2002). 1, 2 0 2 3 Lung weight/body weight ratios. Lung weight/body weight (LW/BW) ratios were calculated as an index of lung injury in animals whose lungs were not perfused for isolation of microsomes. Lung histology. Routine histology was performed on lung tissues from individual animals as described previously (Couroucli et al., 2002; Jiang et al., 2004; Sinha et al., 2005). Statistical Analyses. Data are expressed as means ± SE. Two-way analyses of variance (ANOVA), followed by modified t-tests, were used to assess significant differences arising from 9 JPET Fast Forward. Published on February 23, 2006 as DOI: 10.1124/jpet.105.100677 This article has not been copyedited and formatted. The final version may differ from this version. JPET # 100677 exposure to hyperoxia and RA for different time points. P values < 0.05 were considered significant. D o w n lo a d e d fro m jp e t.a s p e tjo u rn a ls .o rg a t A S P E T J o u rn a ls o n F e b ru a ry 1 , 2 0 2 3 10

See more

The list of books you might like