Logout succeed
Logout succeed. See you again!

Microbial communities in streambed sediments recovering from desiccation PDF
Preview Microbial communities in streambed sediments recovering from desiccation
RESEARCH ARTICLE Microbialcommunitiesinstreambedsedimentsrecoveringfrom desiccation Ju¨rgenMarxsen1,2,AnnamariaZoppini3&SabineWilczek1 1LimnologischeFluss-StationdesMax-Planck-Institutsfu¨rLimnologie,Schlitz,Germany;2Institutfu¨rAllgemeineundSpezielleZoologie,Tiero¨kologie, Justus-Liebig-Universita¨t,Gießen,Germany;and3IstitutodiRicercaSulleAcque,ConsiglioNazionaledelleRicerche,Monterotondo,Rome,Italy D o w n Correspondence:Ju¨rgenMarxsen,Institut Abstract lo a fu¨rAllgemeineundSpezielleZoologie, de Climate change affects running waters not only by increasing temperatures but d Tiero¨kologie,Justus-Liebig-Universita¨t also by increasing discharge variability as more frequent and severe floods and fro Gießen,Heinrich-Buff-Ring26-32,35392 m Gießen,Germany.Tel.:1496419935750; morefrequentandlongerdroughtsoccur,especiallyinupperreaches.Mediterra- h fax:1496419935709;e-mail: neanstreamsareknowntoexperiencedroughts,butCentralEuropeanheadwaters ttps [email protected] are also beginning to be affected. The development of bacterial communities ://a c (abundance, composition) and the recovery of microbial functions (bacterial ad Received22June2009;revised29October production,extracellularenzymeactivity)wereexploredafterrewettingdesiccated em 2009;accepted10November2009. ic streambed sediments via a sediment core perfusion technique. The bacterial .o Finalversionpublishedonline23December2009. u communitycompositionchangedonlyslightlyinthesedimentsfromtheCentral p .c DOI:10.1111/j.1574-6941.2009.00819.x European stream Breitenbach (Germany), but distinctly in the Mediterranean om MulargiaRiver(Sardinia,Italy)during4daysofexperimentalrewetting.Breiten- /fe m Editor:RiksLaanbroek bachsedimentsprobablyenabledsurvivalofbacterialcommunitiesmoresimilar se toindigenousstreambedcommunities,becausetheywerelessdry.Highactivityof c/a Keywords enzymes involved in polymer degradation at the beginning of rewetting in both rtic le Y stream;climatechange;drought;rewetting; sedimentsindicatedthepersistenceofextracellularenzymesduringdrought.After -a b G benacztyemrieasl.communitycomposition;extracellular 4fodrayths,eneBarreliyteanllbmacihcr,obbuiatlancottiviftoiersMreauclahregdiaa.leHveerles,immiluacrhtomunoareffeicntteednsseedidmryeinntgs strac O resulted in a more distinct change and reduction of the microbial community, t/71 L responsibleforslowerrecoveryofstructureandfunctions. /3/3 O 74 /4 8 C 9 3 E Introduction of running water networks. These smaller streams have an 71 b important impact on global biochemical processesand the y Y g Global climate change is among the most important poli- preservation of biodiversity (Tockner & Stanford, 2002). u e G s ticalchallengesofthe21stcentury,butitalsoposesscientific Howwillincreasingfrequencies anddurations ofdroughts t o O challenges.Predictedeffectsofthehuman-inducedincrease affect headwater communities? Few systematic measure- n 0 4 L in greenhouse gases include elevated temperatures and ments of stream ecosystem metabolism are available (Wil- A p O i2n0c0r7e)a.seTdhufrse,qugelonbcaielscolifmeaxtetrecmhaenwgeeawthiellr aefvfeecnttsru(InPnCinCg, lmiaemtaszoonanetcoaml.m, u2n00it8ie)s, awrheemreoarserwesidpeolnyseksnobwynp(lHanutmapnhd- ril 20 I 1 B watersnotonlybyincreasingwatertemperatures,buthead- ries & Baldwin, 2003). In addition, droughts can have 9 O watersespeciallywillbeaffectedbymorevariabledischarge, substantialeffectsonmicrobialphysiologyandthecompo- inparticularmorefrequentandseverefloodsaswellasmore sitionofactivemicrobialcommunities.Thishasimportant R frequent and longer droughts (Sutherland et al., 2008). consequences forcarbon and nutrient fluxes in theecosys- C Mediterranean streams are known to experience droughts tem, as was shown forsoils (Schimelet al., 2007).Suchan MI in summer (Mariotti et al., 2002; Amalfitano et al., 2008), assessment can be transferred without risk to benthic butstreamsofthetemperatezonesarealsobeginningtobe systems, because the change inwatercontent is even more affected(Wilbyetal.,2006;Sutherlandetal.,2008). accentuatedinaquaticenvironmentsthaninsoil. Lower order streams (1–3) represent a large portion of Microbialcommunitiesareextremelydiverse,andthusit drainagelength((cid:2)90%)andsurfacearea(uptoone-third) is difficult to assess how they will respond to disturbances (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties FEMSMicrobiolEcol71(2010)374–386 PublishedbyBlackwellPublishingLtd.Allrightsreserved Microorganismsinrewettedstreambedsediments 375 such as drought, for example how microbial diversity will bydiffuseperfusionthroughthestreambedsediments.This change or what the functional consequences are for the approach has been established as a standard technique for ecosystem (Bardgett et al., 2008). A major difficulty arises measuringmicrobialactivitiesespeciallyinstreambedsedi- because most microorganisms are still uncultivable, and ments under controlled conditions close to the natural thus their function is poorly understood (van der Heijden situation(Fiebig,1992;Marxsen&Fiebig,1993;Marxsen& et al., 2008). Drought events not only reduce microbial Schmidt, 1993; Marxsen, 1996, 1999, 2001; Fiebig, 1997). biomassandmetabolismandthedecompositionoforganic Among the advantages of this microcosm system are the matter (Humphries & Baldwin, 2003; Rees et al., 2006; minimalphysicaldisturbancetothesedimentandtheclose Amalfitano et al., 2008), but may also induce shifts in resemblance to the natural situation in the streambed communitycomposition.Atextremesedimentdesiccation, (Marxsen&Fiebig,1993;Marxsen,1996). highbacterialmortalityandthereleaseofNandPthrough This pilot study was designed to explore the response of D increased mineralization of cytoplasmic solutes has been microbialcommunitiestorewettingofstreambedsediments ow n observed(Baldwin&Mitchell,2000),resultinginenhanced using the sediment core perfusion technique. Important lo a NandPavailability.Apulseinactivitywasoftenobserved detailsoftherewettingprocesswereobservedandanalyzed, d e d upon rewetting soils (Anan’eva et al., 1997; Fierer & mainly to answer the following questions: (1) Are bacterial fro Schimel, 2003; Bardgett et al., 2008), which is caused not community structure and microbial activity different in a m only by substances released during drying but also by Mediterranean stream and a temperate stream at thebegin- http ilanrt-rwaceeilglhutlacrasroblouhteysdr(asutecsh)abseianmginreoleaacsieddsianntdoltohwe-emxtorlaecceul-- nchinagngoefraefwteertrteinwge?tt(i2n)gH?(o3w)fHasotwdofaesstthdeoecsommmicruonbiitaylsmtruetcatbuore- s://ac a lularenvironmentafterhavingbeenproducedandstoredto lism recover? and (4) Does microbial community structure de m acclimatize to low water content conditions (Halverson andactivitydevelopdifferentlyduringrecoveryfromdesicca- ic et al., 2000). In addition, many cells may be disrupted tioninasemi-aridandatemperateenvironment? .ou p duringrapidrewetting,becausedisposalofosmolytesmight The bacterial community structure was described by .c o notbefastenoughtopreventrupturebyincreasingosmotic fluorescence-microscopic determination of abundance and m pressure(Fiereretal.,2003;Schimeletal.,2007). group-specific composition via catalyzed reporter deposi- /fem s A lack of knowledge on the development of microbial tion (CARD)-FISH (Pernthaler et al., 2004). A genetic e c communities upon rewetting of desiccated sediments is fingerprinting technique[temperature-gradientgelelectro- /a evident. Only a few investigations have been published on phoresis(TGGE)]wasappliedtoestimatethecomplexityof rticle the effects of drying and rewetting on microbial commu- the community and compare between different samples -a b s nities in streams and rivers, especially from Mediterranean (Beieretal.,2008).Microbialmetabolismwasmeasuredas tra environments.These involvednotonly sediments(Amalfi- BCP via uptake of radiolabelled leucine (Marxsen, 1996) ct/7 tanoetal.,2008;Fazietal.,2007,2008)butalsostromato- andasEEAusingfluorogenicmodelsubstrates(Marxsen& 1/3 litic biofilms (e.g. Roman´ı & Sabater, 1997; Sabater et al., Fiebig,1993). /3 7 2000;Roman´ıetal.,2006). 4/4 8 Amainproblemwhenperformingsuchinvestigationsis 9 Materialsand methods 3 themethodologicalapproach.Usually,slowrewettingwith- 71 b out a dramatic disturbance of the desiccated sediment is y Studysites g observedforstreams.Thus,experimentalapproachesusing u e s sediment slurries are not appropriate, especially for long- Investigations were performed on sediments from two t o termexperimentslastingdaysorevenweeks.Slurryexperi- runningwaterenvironments:(1)theBreitenbachinCentral n 0 4 ments were often criticized because increases in microbial Europeand(2)theMulargiaRiverfromSardiniaIslandin A p awchtievnitiienstabcytosnedeiomremnotsrewoerrdeeerxspoefrmimaegnntiatulldyedwiserruepotbedser(vee.gd. theTMheedBitreerirtaennebaanch. is a small first-order upland stream ril 20 1 Hallet al., 1972; Novitzky, 1983). However, Moriarty et al. situated about 100km to the northeast of Frankfurt am 9 (1991)andMarxsen(1996)foundthatthebacterialcarbon Main (Germany; 91390E, 511390N), originating about production(BCP)ratesweresimilarindisruptedandintact 350ma.s.l.andenteringtheRiverFuldaatabout220ma.s.l. coresofmarineoriginorfromstreambeds,andextracellular after a channel length of 4200m. The upper reach is enzymeactivity(EEA)inastreamwasmeasuredtobeeven borderedbyforestsonatleastoneside,whereasthemiddle higher in undisturbed cores than in sediment suspensions and the lower parts flow mainly through grassland (for (Marxsen & Fiebig, 1993). For this investigation, sediment details: Marxsen et al., 1997; Marxsen, 2006). The upper cores perfused with water were used (Fiebig & Marxsen, reachwasoccasionallydriedoutover thelast 50years, but 1992). This approach simulates the natural process occur- onlyforshorttimesuptoafewweeksinautumn(Marxsen, ringinmanystreamswheregroundwaterentersthestream 1980). In the last decade, desiccation of the upper reach FEMSMicrobiolEcol71(2010)374–386 (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties PublishedbyBlackwellPublishingLtd.Allrightsreserved 376 J.Marxsenetal. occurred more frequently and for longer durations. For Sediment structure was characterized using standard example, this reach even lacked water discharge for nearly methods (Marxsen, 2001).MulargiaRiversedimentshada thewholeyearin2004(Fig.1a). much lower water content and particle surface area and a The river Mulargia is a second-order temporary river highermeangrainsizeandorganicmattercontent(Table1). representativeofthesemi-aridMediterraneanRegion(Fon- nesu et al., 2004; Amalfitano, 2007; Gallart et al., 2008) Experimental system: perfusion cores located in the southeastern part of Sardinia Island (Italy; 391380N,091110E).Themainreachhasalengthof18km.Its In the laboratory, the cores from the Breitenbach were placed in a temperature-regulated incubator in the dark. network has an overall length of around 44km, while the The cores were perfused at 201C from below with filtered distance from the origin to the outlet into the reservoir is (0.22mm)andboiled(30min)streamwateratavelocityof around 15km. The landscape in the catchment is moder- ately influenced by human activities. The vegetation is 2.0mLcm(cid:4)2h(cid:4)1. This perfusion velocity corresponded to Dow the natural diffuse water-inflow velocity through the n typical for low and high Mediterranean macchia. The lo temperatureregimeistypicallyMediterranean,withamax- streambed at a low water level. For the Mulargia River ad e imumofaround401Candaminimumseldombelow01C. ehxopldereirms eansttsh,othseeudsreydsewdiitmhetnhtewBarseifitellnedbaicnhtoseiddeimnteicnatlscaonrde d fro The strong seasonality of rainfall is reflected by the inter- m mpleittteelnytdflryowdurreinggimsuemofmtehremriovnetrh,sw(hFiicgh.1cba)n. become com- ttwrheaeastnueadsteuidnra(tlAhnePuHstarAmie,neAtmWcaoWnnnAcee,nr.WtrAaPrtCtioifiFn,ci2ian0l0rM5iv;ueFlraarwzgiaiateetrraivml.e,art2cw0h0ai8tne)gr. https://a c EEA was determined from water leaving the cores on top ad e Sampling (Marxsen&Fiebig,1993).Thecolumnsweredisruptedfor mic bacterialproductionandbacterialcommunitycomposition .o Cores of sandy sediment measuring 1.5cm in depth and analysis (Marxsen, 1996). For this type of experiment, the up.c 2.0cm in diameter were sampled from the Breitenbach initial measurements (at time t=0) serve as appropriate om streambed(Marxsen&Fiebig,1993)andreturnedimmedi- controls (yielding information about community structure /fe m atelytothelaboratoryinNovember2004.OnNovember3, andactivitywhenrewettingbegins)towhichthemeasure- s e themiddlereachwassampledtoobtaindatafornondesic- c mentsperformedlaterwerecompared. /a catedsediments.OnNovember15,samplesweretakenfrom rtic the desiccated upper reach for determining extracellular le Bacterial communitystructure -a enzyme activities after rewetting and on November 29 for b s determiningbacterialproductionandabundanceaswellas The analysis of bacterial abundance and community com- tra c bacterialcommunitycomposition. positionintheBreitenbachsedimentswasperformedalways t/7 1 Mulargiasedimentwas sampled upstreamof theMular- on one core that was removed from the perfusion system, /3 /3 giareservoironSeptember29,2004,whenthedischargewas opened,carefullymixedandpreparedforfurthertreatment 7 4 at its minimum (0.018m3s(cid:4)1). The uppermost oxic layers atthebeginningoftheexperimentsandafter6,12,24,44, /48 9 (0.5–2cm) were collected, sieved (2mm mesh size) and 68and92h.Mulargiacoresweresampledafter0,17,29,41, 3 7 storedat41C.Thewetsedimentwasanalyzedforbacterial 53,69,78and89h. 1 b y abundance,BCPandEEAandstoredatroomtemperature Samples for determination of bacterial abundance and g u untilrewetting.Itwasrewettedusingtheperfusiontechni- CARD-FISH analysis (0.5mL sediment in duplicate) were e s que on November 22 (bacterial community structure and fixed with 4% paraformaldehyde solution, washed and t o n EEA) and December 6 (BCP). Conditioning corresponded stored at (cid:4)201C in a 1:1 mixture of ethanol (96%) and 0 4 tothesituationofsedimentsexposedtonaturaldesiccation phosphate-buffered saline (PBS) (Llobet-Brossa et al., A p occurringintheMulargiaRiver. 1998). Stored samples were washed with PBS before the ril 2 0 1 9 (a) (b) 5 –1Discharge (L s) 2115050 MUpidpdeler ccoouurrssee 3–1Discharge (m s) 3421 FBirgei.te1n.bHaycdhr(ougprpaeprhasnfrdommid2d0l0e4cofourrs(ae)s)and(b) 0 0 Mulargia(upstreamMulargiareservoir;data I II III IV V VI VIIVIIIIX X XI XII I II III IV V VIVIIVIIIIX X XIXII kindlyprovidedbyHydrocontrol,Cagliari,Italy). (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties FEMSMicrobiolEcol71(2010)374–386 PublishedbyBlackwellPublishingLtd.Allrightsreserved Microorganismsinrewettedstreambedsediments 377 sediment was diluted with 20mL PBS. The bacteria were was performed with Bray–Curtis dissimilarities calculated detached from the sediment particles by ultrasonic treat- for each pair of lanes. The dendrogram was constructed ment and, after coarse particles had settled, appropriate using the unweighted pair-group method with average volumesof thesupernatantswerefilteredontowhite poly- linkages.Correspondenceanalysis(CA)wasusedasanother carbonate filters (pore size 0.2mm, GTTP, Sartorius, approach that enabled the analysis of major tendencies of Go¨ttingen, Germany) as suggested by Buesing & Gessner the variance of the bacterial community structures on the (2002). The filters were treated with the CARD-FISH basisofTGGEprofiles(Frominetal.,2002).TheShannon– procedure of Pernthaler et al. (2004) using horseradish- WienerdiversityindexH wascalculatedas: S peroxidase-labelled oligonucleotide probes (biomers.net, S Ulm, Germany; Table 2) and tyramide molecules fluores- X H ¼(cid:4) P lnP; ð1Þ S i i cently labelled with Alexa . For determining the total 488 i¼1 D bacterial abundance via SybrGreen I (Buesing & Marxsen, where P is the proportion of OTUi (SP =1) and S is the ow i i n 2005),filterpieceswereseparatedafterthepermeabilization total number of OTUs for each lane. The maximum loa step. Hybridized and SybrGreen-stainedcells werecounted d diversityH wasdeterminedas: e max d using a Zeiss Axiophot2 epifluorescence microscope fro equippedwitha100Whigh-pressurebulbandthefilterset H ¼lnS ð2Þ m max HQ-FITCsel (exciter HQ480/40, beamsplitter Q505LP, andtheevennessJas: http eGmerimttearny)H.CQe5l2l7n/u3m0,beArsHwFereAdneatleyrsmeninteecdhninik1,0–T20u¨bminigcreon-, J ¼HS=Hmax ð3Þ s://ac a scopicfields(typically 4400cells;Kirchman,1993). de m For TGGE analysis, sediment was stored at (cid:4)201C Activity ic without further treatment. Extraction of DNA, amplifica- .ou Extracellular enzyme activities were determined using p tion of eubacterial 16S rRNA genes, separation of gene .c fragments and evaluation of gels were performed as de- 4-methylumbelliferyl (MUF)- and 7-amino-4-methylcou- om scribed earlier (Beier et al., 2008). The TGGE bands were marin(MCA)-substrateanalogues,MUF-b-D-glucopyrano- /fem sideforthemeasurementofb-glucosidase,MUF-oleatefor s treatedasoperationaltaxonomicunits(OTUs),asurrogate e forbacterialspecies.Therelativeintensitiesofthebands(as lipase, MUF-phosphate for phosphatase and leucine-MCA c/a ameasureofabundance)werecalculatedforeachlaneand for the measurement of leucine-aminopeptidase (all com- rticle used for further statistical treatment (XLSTAT 2008.6.01, pwoeurendsadfdroedm aStigmfian,alMucnonicche,ntGraetrimonasny)o.fTh0e.5smumbsotrlaLt(cid:4)e1s -abs Addinsoft SRAL, Andernach, Germany). Cluster analysis (0.3mmolL(cid:4)1 for phosphatase and 1mmolL(cid:4)1 for leucine trac aminopeptidase)totheperfusionwater(tworeplicatecores t/71 Table1. CharacteristicsoftheMulargiaRiverandBreitenbachstream per substrate), which had been determined to be in the /3/3 sedimentsbeforerewetting 7 saturationrangeofEEA.Thefluorescentproducts4-methyl- 4 /4 Mulargia Breitenbach umbelliferone or MCA released by enzyme activity were 8 9 Watercontent(%) 0.42 16.1 measured in the water discharging from the cores’ tops 37 1 Specificweight(gdrymattermL(cid:4)1) 1.62 1.48 (Marxsen&Fiebig,1993).Watercontainingtheappropriate b y Averagegrainsize(mm) 0.95 0.22 substrates was perfused through the two coresreservedfor g u Particlesurfacearea(cm2mL(cid:4)1) 14.4 75.7 eachsubstrateatdefinedtimeintervalsaftertheinitiationof es Organicmattercontent(%) 1.07 0.42 rewetting: 0.5–1.5, 1.75–2.75, 3.6–4.6, 21–22, 45–46,69–70 t on 0 4 A p Table2. Sequencesofoligonucleotideprobesusedforthisstudy ril 2 0 Probename Sequence Targetgroup %FA References 1 9 ARCH915 GTGCTCCCCCGCCAATTCCT Archaea 35 Amannetal.(1995) EUB338 GCTGCCTCCCGTAGGAGT Bacteria 55 ALF1b CGTTCGYTCTGAGCCAG Alphaproteobacteria 35 BET42a GCCTTCCCACTTCGTTT Betaproteobacteria 55 GAM42a GCCTTCCCACATCGTTT Gammaproteobacteria 55 CF319a TGGTCCGTGTCTCAGTAC Bacteroidetes 55 HGC69a TATAGTTACCACCGCCGT Actinobacteria 35 LGC354b CGGAAGATTCCCTACTGC Firmicutes 35 Meieretal.(1999) NON338 ACTCCTACGGGAGGCAGC Negativecontrol 55 Wallneretal.(1993) %FA,percentageofformamideusedinthehybridizationbuffer. FEMSMicrobiolEcol71(2010)374–386 (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties PublishedbyBlackwellPublishingLtd.Allrightsreserved 378 J.Marxsenetal. and 93–94h for the Breitenbach, and 1.25–2.25, 3.5–4.5, were much higher in the Breitenbach sediments 16.5–17.5, 29–30, 42–43, 67–68 and 91–92h for Mulargia. (3.0(cid:5)109cellsmL(cid:4)1sediment)comparedwiththeMulargia Water without substrates was perfused through the cores sediments (0.25(cid:5)109cellsmL(cid:4)1 sediment). For both sites, between those intervals, except during the initial rewetting abundancesremainednotfarfromthatleveluntiltheendof phase(4.5/4.6h). the experiments with temporary decreases at day 1 (Brei- BCP was measured via 14C-leucine incorporation into tenbach) or days 2 and 3 (Mulargia). Abundance of the bacterial protein (Marxsen, 1996). Leucine at a concentra- bacteria in the Breitenbach experimental sediment was tion of 50mmolL(cid:4)1 was added to the perfusion water that similar to nondesiccatedsediments, butforMulargia,even was pumped through two cores per time step. These were thefinalabundanceafter4daysofrewettingwasonly14% 0–6, 6–12, 12–24, 32–44, 56–68 and 80–92h for the Brei- ofabundancebeforedesiccation. tenbach, and 0–6, 6–12, 12–24, 31–43, 55–67 and 79–91h D forMulargia.Simultaneously, one corewas runwithwater ow BacterialcommunitycompositionviaCARD-FISH n containing 5% formaldehyde, which was also used to lo a terminate the experiments. At the end of the experiments, There was no trend in the development of bacterial com- d e d pinrcooterpinorwataesde1x4tCracwteads fmroemasutrheed.diBsCruPptwedassecdailmcuelnattesdanbdy mexupneritimyceonmtsp(odsaittaionnootbssheorwvend).vTiahCuAs,RoDn-lyFIaSvHerathgeroduagthatahree from applying the conversion factor from Buesing & Marxsen givenforeachenvironment.Cellshybridizedwiththeprobe http (20E0E5A)fionrcfroersehswfartoemrsethdeimmenidtds.le reach of the Breitenbach f3o6r%Ba(cBtreeriitaen(bEaUcBh3)3o8f)tahcecotuontateldceflolsr.3C9o%m(pMaruedlarwgiiat)hatnhde s://ac a wasdeterminedasfortherewettedcoresatthreereplicates numbers for Bacteria, the sum of specific bacterial groups de m per substrate from samples taken 19.5–20.5h after the investigated(Alpha-,Beta-,Gammaproteobacteria,Bacteroi- ic initiation of perfusion in the laboratory, and BCP was detes,ActinobacteriaandFirmicutes)wasonaverage84%for .ou p determined 5–19.75h after starting perfusion at two repli- Mulargia and 53% for Breitenbach. In both sediments, .c o catecoreswithonecontrol.EEAinwetMulargiasediments Betaproteobacteriaweredominating,followedbyAlphapro- m wasmeasuredafterWobusetal.(2003),withthreereplicates teobacteria (Fig. 3). Actinobacteria achieved a distinctly /fem s per substrate for 1h (1.5h for aminopeptidase), and BCP higher percentage in Mulargia sediments than in Breiten- e c via 3H-leucine incorporation following Buesing & Gessner bach sediments (21% vs. 8%), whereas Bacteroidetes were /a (2003)incombinationwiththemicrocentrifugationtechni- morefrequentinBreitenbachsediments(12%vs.2%).Both rticle queproposedforapplicationinsoilbyBa˚a˚thetal.(2001). Gammaproteobacteria and Firmicutes were always found at -a b s lowpercentages.Archaeaoccurredonlyatverylowpercen- tra Results tages in both sediments at about 1% of the total bacterial ct/7 abundance. 1/3 Abundance of bacteria /37 4 /4 Bacterial abundance showed no distinct trend within the Bacterial communitycomposition viaTGGE 8 9 rewetting period(Fig.2).Initialnumbersindrysediments The total number of TGGE bands of identical position 371 b between samples was 70, of which 27 were detected in y sediment) 10 000 Breitenbach MBdeeuntwlsaierteognimae2st4erdyaimn(Tdeanb3tls6ea3bn)ad,nad1ls2thpioneurgBhrseavimtiespnulbaelacwgheelrseiendisidpmeenecnttiitofisneodhnablydy. guest on 0 –1L M B shownmorebandsforalmostallsamples.Richness(S)was 4 A 610 m 1000 osanmapvleersagtheasnliginhtlMy,ublaurtgisaigsnaimficpalnetsly(Ph=igh0.e0r0i0n3)B.rTeihteensbaamche pril 20 s ( patternwasobservedfordiversity(Shannon–Wienerdiver- 19 ell Mulargia c sity H ) and evenness (J), with P-values of 0.00005 and of S o 0.024, respectively. In all cases, no trends were detected N 100 amongtheindicesduringtheexperiments. 0 24 48 72 96 Time after starting rewetting (h) BacterialcommunitiesinthesamplesanalyzedbyTGGE band patterns separated into two distinct clusters (Fig. 4). Fig.2. Bacterialabundanceduringrewettingofdesiccatedstreambed Differences between the two streams were much more sedimentsfromBreitenbachandMulargia.MeanswithSDsareshown(if pronounced than those between samples from the same notvisible,theSDishidden behindthesquareorthediamond).The columns indicate data from sediments that were not desiccated streamduringtherewettingexperiments.Thesamplesfrom (B,Breitenbach;M,Mulargia). the Mulargia experiment exhibited distinctly higher (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties FEMSMicrobiolEcol71(2010)374–386 PublishedbyBlackwellPublishingLtd.Allrightsreserved Microorganismsinrewettedstreambedsediments 379 (a) Breitenbach (b) Mulargia ACT 8.2%FIR 0.9% FIR 3.2% BAC 12% ALF 27% ACT 21% ALF 31% Fig.3. Averagetaxonomiccompositionof thebacterialcommunitiesinsedimentcoresfrom (a)Breitenbachand(b)Mulargiaduringthe BAC 2.3% GAM 6,5% rewettingexperimentsanalyzedbyCARD-FISH GAM 3.9% (percentagesofaffiliatedcells).ACT, Actinobacteria;ALF,Alphaproteobacteria;BAC, Bacteroidetes;BET,Betaproteobacteria;FIR, Firmicutes;GAM,Gammaproteobacteria. BET 45% BET 39% D o w n lo a Table3. Diversityofbacterialcommunitiesduringrewettingofdesic- M89 de cwaittehd16stSreraRmNAbegdenseedfirmagemntesndtsetermined from TGGE profiles prepared MM6593 d from Site Time(h) S HS Hmax J M78 http M41 s Mulargia 0 28 2.98 3.33 0.90 M29 ://a 17 28 2.95 3.33 0.88 c a 29 26 3.09 3.26 0.95 M17 de 41 30 3.15 3.40 0.93 M0 mic 53 26 3.00 3.26 0.92 B12 .o u 64 29 2.94 3.37 0.87 B6 p.c 78 29 3.09 3.37 0.92 B24 om 89 24 2.92 3.18 0.92 B44 /fe Average 27.5 3.01 3.31 0.91 m B0 s RSange 224.0–30 20..9029–3.15 30..1087–3.40 00..8072–0.95 B92 ec/a Breitenbach 0 29 3.23 3.37 0.96 B68 rtic le 6 31 3.20 3.43 0.93 -a 0 0.25 0.5 0.75 b 12 33 3.21 3.50 0.92 s 24 36 3.37 3.58 0.94 Dissimilarity tra c 44 33 3.21 3.50 0.92 Fig.4. Comparison of bacterial community composition in sediment t/7 1 68 34 3.39 3.53 0.96 coresfromBreitenbachandMulargiaafterdifferenttimesofrewetting /3 92 35 3.37 3.56 0.95 by cluster analysis of TGGE profiles prepared with 16S rRNA gene /37 4 Average 33.0 3.28 3.49 0.94 fragments. M, Mulargia cores; B, Breitenbach cores. The figures are /4 8 S 2.4 0.09 0.07 0.02 equivalenttothehoursofrewetting. 9 3 Range 29–36 3.20–3.39 3.37–3.58 0.92–0.96 7 1 b Time, time after starting rewetting; S, richness; HS, Shannon–Wiener y g diversity; Hmax, maximum diversity; and J, evenness. Indices were all slightvariationoccurredinBreitenbachsediments.Aslight ue s significantlydifferentbetweentheMulargiaandBreitenbachseriesat variationwasfoundinBreitenbachsedimentsatbothofthe t o Po0.001,exceptforJ,wherePwas0.024. first ordination axes. However, little variation during the n 0 4 experimentwasobservedforMulargiasedimentsalongaxis A p dissimilaritiesbetweensamplesintimethanwereobserved 1ax,iws.hereas the main variation occurred along the second ril 20 1 intheBreitenbachsamples. 9 CommunitypatternsaresummarizedinaCAbiplot(Fig.5). BCP Axes 1 and 2 explained 52.0% of the bacterial community variation, and axes 3 and 4 explained 12.2% and 8.9%, BCP in rewetted Mulargia sediments started at rates dis- respectively. This analysis confirmed the results from the tinctly below those in nondesiccated sediments (1.3%), cluster analysis of distinct bacterial communities between followedbyacontinuous,eventually10-fold,increasewith- Breitenbach and Mulargia. It further demonstrated a pro- inthefirst2days.Butevenafter4days,BCPrateshadnot nounced shift of community composition in Mulargia achieved those from sediments before desiccation (Fig. 6). sedimentsduringrewetting,especiallywithinthefirst2days TheinitialproductionratesforBreitenbachsedimentswere of the experiment (samples M0 to M41), whereas only a much closer to the values in nondesiccated regions of the FEMSMicrobiolEcol71(2010)374–386 (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties PublishedbyBlackwellPublishingLtd.Allrightsreserved 380 J.Marxsenetal. 1) 1600 –h M M0 nt 2520 e m 1200 di 22.8% se Breitenbach –1 800 L m B C g 400 n P ( Mulargia C B 0 0 24 48 72 96 Time after starting rewetting (h) D o w Fig.6. BCPduringrewettingofdesiccatedstreambedsedimentsfrom nlo Breitenbach and Mulargia. Means with SDs are shown (for further a d explanationsc.f.Fig.2). ed fro m B12 B0 http B6B24 B44 M17 29.2% cInloMseutolartghioaseseodbimtaeinnetsd,ihniguhnearffiencittieadlsaecdtiivmiteyn(tasbwoeurte1f8o%unodf. s://ac B68 B92 sediments before desiccation) was observed, followed by a ade m M41 nearlycontinuousincreaseupto43%oftheratesfoundin ic M29 nondesiccatedsediments. .ou M78 p Lipase exhibited a very rapid increase in Breitenbach .c M64 o sediments, similar to that observed for b-glucosidase, to a m M89 M53 level even higher than that found in nondesiccated sedi- /fem s ments (Fig. 7c). Lipase in Mulargia sediments started at a e c highinitial activitylevel(equivalent to themaximum level /a Fig.5. CAbiplotofbacterialcommunitycompositioninsedimentcores found in Breitenbach sediments), but then continuously rticle fromBreitenbachandMulargiaafterdifferenttimesofrewetting,based decreased until day4 to a much lower activity level (12%) -a b onTGGEbandpatternspreparedwith16SrRNAgenefragments.The thanhadbeenmeasuredinsedimentsbeforedesiccation. stra dteianmbaocnhdcsorreeps;retsheenfitgtuhreesdaifrfeereeqnutivsaalmenptletso(tMhe,hMouulrasrgoifarecworeetst;inBg,).BTrheie- Initialphosphataseactivitywassimilarinbothstreambed ct/7 points symbolize OTUs (TGGE bands of identical position between sediments,but,relativetonondesiccatedsediments,activity 1/3 wasdistinctlylowerinMulargiasedimentsthaninBreiten- /3 samples). 7 4 bach sediments (Fig. 7d). Steadily declining activity levels /4 8 were measured in Breitenbach cores toward day 4 of the 9 3 stream (66%). Before rates equivalent to nondesiccated experiment. In Mulargia sediments, a temporary increase 71 b habitats were achieved during the second day, BCP had followed,butatday2oftheexperiment,adeclinebeganthat y g temporarilydecreased. eventually reached a value similar to those found in Brei- u e s tenbachsediments. t o n EEA 04 Discussion A p Facotrivtihtye Binrecirteeansbeadchtosedvimaluenests,ceoxmtrpaacerallbulleartbo-glsuecdoimsidenastes ril 20 Suitabilityofthe perfused coretechnique 1 thatwerenotexposedtodrynessevenafter4hofrewetting 9 (Fig.7a).Conversely,b-glucosidaseactivityintheMulargia A perfused core system was applied in this study for sedimentsremainedatlowlevelsuntil30hfromrewetting, exploring the process of re-establishment of microbial when it increased to a rate about half of that found in communitiesandtheirmetabolisminstreambedsediments nondesiccatedsediments. recovering from desiccation. This approach is based on Leucine-aminopeptidase started at a very low initial laboratory simulations of groundwater discharge through activity level in Breitenbach sediments, but within a few the streambed (Fiebig & Marxsen, 1992). It had been hours, nearly half of the activity found in nondesiccated successfullyappliedformeasuringmicrobialmetabolismin sediments was achieved (Fig. 7b). The activity level in- streambed sediments, even in long-term experiments. EEA creasedfurtheruntiltheendoftheexperiment,whenvalues showed no marked change over 4 days of perfusion (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties FEMSMicrobiolEcol71(2010)374–386 PublishedbyBlackwellPublishingLtd.Allrightsreserved Microorganismsinrewettedstreambedsediments 381 (a) (b) 100 –1h) 40 M –1h) 1M51 B nt nt 80 me 30 Breitenbach me Breitenbach di B di 60 e e –1 mLs 20 Mulargia –1 smL 40 Mulargia ol 10 ol 20 m m n n v ( 0 v ( 0 0 24 48 72 96 0 24 48 72 96 Time after starting rewetting (h) Time after starting rewetting (h) D o w n (c) (d) lo a –1ent h) 2205 Breitenbach M58 –1ent h) 2105 15M1 B ded from m m h –1 Lsedi 1105 Mulargia B –1 Lsedi 10 Mulargia ttps://ac m m a mol 5 mol 5 Breitenbach dem n n ic v ( 0 v ( 0 .ou 0 24 48 72 96 0 24 48 72 96 p .c Time after starting rewetting (h) Time after starting rewetting (h) o m Fig.7. EEAduringrewettingofdesiccatedstreambedsedimentsfromBreitenbachandMulargia.MeanswithSDsareshown(forfurtherexplanations /fem c.f.Fig.2).(a)b-Glucosidase;(b)leucine-aminopeptidase;(c)lipase;(d)phosphatase. se c /a (Marxsen&Fiebig,1993;Marxsen&Schmidt,1993)nordid ofthestreamthathadnotbecomedry(Fig.2).InitialBCP rticle BCP (Marxsen, 1996). Fiebig (1997) found no apparent achieved only 66% of BCP at nondesiccated sites. This -a b s change in amino acid metabolism even after 6 months. means that the specific production on a per cell basis was tra Duringthisstudy,thesystemwasusednotonlyformeasur- 2.8-foldhigherinnondesiccatedsediments.After4daysof ct/7 ingmicrobialmetabolism,asintheearlierstudiesbutalsoto rewetting, this relationship was 1.2. However, it cannot be 1/3 follow the development of the bacterial community struc- determinedwhetherthecellscountedwereactive,dormant /3 7 4 ture upon rewetting of desiccated sediments over 4 days. or dead using the fluorescence microscopic counts after /4 8 Thesystemisaveryvaluabletoolforthispurposebecauseit staining with SybrGreen. Thus, there might have been a 9 3 allows the development of microbial community structure higherpercentageofinactivecellsinthedrysediment,and 71 b andmetabolismtobetrackedexperimentally instreambed thispercentagemighthavenormalizedduringthe4daysof y g sediments recovering from desiccation. Perfusion cores rewetting. Bacterial abundance was much lower in dry u e s provide a close simulation to natural settings in most Mulargia sediments, also in relation to abundance in sedi- t o streambeds. They enable complex and well-controlled ex- ments before desiccation (15%). The specific bacterial n 0 4 perimentalmanipulations,forexampleperfusionwithma- production per cell was 11-fold higher in the sediments A p nasipsuamlatpeldinwgaotferpsearfnudsevdarwyaintegrtdhirsocuhgahrg-efldowfrovmelotchietiseesdaismweenltl boeffoarteldeaessticcdaotriomna.nTthoisrsuevgegnestdseaadmuceclhlshiinghethrepevrecreyntdagrye ril 20 1 cores (Marxsen, 1996). Whereas for most methods applied Mulargiasediments(0.42%watercontent;Table1)thanin 9 togetherwiththissystemseparatecoresareneededforeach the Breitenbach sediments (16.1% water content). In pre- point in time, the development of EEA can be followed in viousexperimentsonMulargiasediments,Amalfitanoetal. thesamecoresoverthewholeexperiment.Thisdiminishes (2008) similarly found that bacterial abundance decreased thenumberofcoresneededconsiderably. duringthedesiccationprocess.Theyalsoobservedthatthe percentageofbacteriallivecellswasexponentiallyrelatedto the sediment watercontent, resulting in a decreaseof 84% Bacterial communitystructure fromwettodryconditions,whichisalsoinaccordancewith Bacterial abundance in desiccated Breitenbach sediments the findings from our study. After 4 days of rewetting, wasequivalenttoorslightlyhigherthanabundancesatsites specificBCPachievedinMulargiasedimentsexhibitedrates FEMSMicrobiolEcol71(2010)374–386 (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties PublishedbyBlackwellPublishingLtd.Allrightsreserved 382 J.Marxsenetal. similartopredesiccation(only1.2-foldhigherbefore,asfor period and persisting at a detectable level (40.1–1% of theBreitenbachsediments).However,bacterialnumbers(as bacterial DNA; Muyzer et al., 1993) after rewetting. The well as BCP) for Mulargia sediments were still distinctly reduced intensity of bands, their disappearance and the belowthevaluesbeforedesiccationwhereasvaluessimilarto appearanceofnewbandsorofbandsthatinitiallyappeared nondesiccated sediments were found for the Breitenbach to be weak indicate a distinct change among parts of the sediments. community. This is consistent with the shift along axis 2. Bacterialcommunitystructureintheexperimentalcores PreviousexperimentswithdifferentMediterraneantempor- analyzedbyTGGEbandpatternsseparatedintotwodistinct ary riversedimentsobservedasimilarresponsetodrought clusters, containing either the Mulargia or the Breitenbach conditions, shifting to a larger fraction of Alpha- and samples (Fig. 4). The Breitenbach community was more Betaproteobacteria (Amalfitano et al., 2008), accompanied diverse initially upon rewetting and remained at a higher by a drastic decrease of BCP. However, we did not follow D diversitylevelthroughoutthewholeperiodofexperimental long-term changes after rewetting, which might perhaps ow n rewetting (Table 3). Cluster analysis (Fig. 4) further sug- give a different picture. Rees et al. (2006) had found that lo a gested that differences between cores from one stream drying changed the microbial community structure in a d e d during recovery from desiccation were more pronounced semi-permanentstreaminNewSouthWales(Australia)that fro fortheMulargiathanfortheBreitenbachsediments. didnotreturntoitspredroughtstructurewithin1month. m The main difference between the bacterial communities http omfutchhehtwigohseyrsptermopsoarstiroenveoafleGdrbaymC-pAoRsDiti-vFeISbHactdeartiaawinasMthue- Microbial metabolism s://ac a largiasediments(24%ActinobacteriaandFirmicutesvs.9% BCPinBreitenbachsedimentsstartedatahighinitiallevel, de m inBreitenbach;Fig.3).Gram-positivebacteriaareknownto followedbyatemporarydecrease,beforereturningtoalevel ic be more resistant to drying and rewetting (Schimel et al., equivalent to that found in nondesiccated sites (Fig. 6), .ou p 2007). Their cell wall is much more stable and is able to which is a pattern similar to that for bacterial abundance .c o withstand much higher osmotic pressure (Wood et al., (Fig. 2). However, this contradicts a stable bacterial com- m 2001), which is the critical stress during fast rewetting of munitycompositionduringthewholerewettingphaseand /fem s sediments(Fiereretal.,2003).Thus,itisnotsurprisingto the development of EEA (Fig. 7). However, it might be e c findmorebacteriabelongingtothegroupsofActinobacteria possiblethatthecommunity,dominatedbyGram-negative /a andFirmicutesinanaquaticenvironmentexhibitingregular bacteria (mainlyProteobacteria),lostmanycells(notselec- rticle intense drying phases than in an environment exposed to tively) through rupture by osmotic shock after rewetting, -a b s scarce, short and less intense desiccation. This is in accor- followedbyageneralrecovery thatagainwasnotselective. tra dance with observations on Mediterranean soils where ThecontinuousincreaseofBCPovernearlythefirst2days ct/7 climatichistorywassuggestedtoselectformicrobialpopu- of rewetting in Mulargia sediments (Fig. 6) supports the 1/3 lations resilient to highly variable moisture conditions assumption of the re-establishment of the activity of dor- /3 7 (Cruz-Mart´ınezetal.,2009). mantcellsthatwerenotbelowthedetectionlimitofTGGE, 4/4 8 CA suggested a stable bacterial communitycomposition as well as of the development of bacteria adapted to 9 3 with only slight changes in the Breitenbach sediment drought-prone aquaticenvironments. However, at day3, a 71 b throughoutthedurationoftherewettingexperiment(Fig.5). temporarydecreaseoccurred.After4daysofrewetting,BCP y g On both axes, which explain 52% of the variation, only achieved only 11% of the rate before desiccation, which is u e s irregularandsmallshiftsoccurredforthesamplesfrom0to consistentwiththerelationshipforbacterialabundance. t o 92hoftheexperiment.TheMulargiasampleswerelocated Although extracellular enzymes are generally considered n 0 4 far from Breitenbach samples along axis 1, thus indicating tobeshort-livedbecausetheyaresusceptibletoinactivation A p dbeiftfwereeenncetsheinsOtreTaUmsc.omHpowoseivtieorn, froerprMesuenlatregdiabysedthimiseanxtiss, bhyigmhaanctyiveintiveisroinnmtheenitnalitfiaacltpohrsa,sienotfhrisewsteutdtiyn,gt.hTeyhiesxmhiabyitebde ril 20 1 morevariationalongaxis1(aboutthreefold)wasobserved duetoextracellularenzymespersistingduringdrought.Itis 9 than for the Breitenbach sediments. The occurrence of known that extracellular enzymes may be stable in dry OTUs, which is represented by axis 2 of the CA, is due to soils or aquatic biofilms for weeks. For phosphatases, much more distinct changes in the Mulargia samples Perez-Mateos et al. (1991) observed that 65% of the compared with the Breitenbach samples as well as the indigenous enzymes remained active after 50 days of soil variation of the same samples on axis 1. The changes are storageat221C.Roman´ı&Sabater(1997)showedthatEEA most pronounced within the first day (c.f. samples taken recovered immediately in stromatolitic riverine commu- after 0, 17 and 29h). This indicates that a part of the nitieswhenrewettedaftersummerdrought.Thus,survival bacterial community composition was also less affected by of extracellular enzymes in desiccated sediments is a valid rewetting in Mulargia sediments, having survived the dry assumption. Already, Sirova´ et al. (2006) postulated that (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties FEMSMicrobiolEcol71(2010)374–386 PublishedbyBlackwellPublishingLtd.Allrightsreserved Microorganismsinrewettedstreambedsediments 383 enzyme activity retained in desiccated samplescontributed phosphorusmuchmoreavailableinsedimentsuponrewet- to the extremely high regeneration rates in cyanobacterial ting(Baldwin&Mitchell,2000),makingtheproductionof matsafterflooding. phosphatasesunnecessary. Developmentofactivitywasdistinctlydifferentforextra- cellularenzymesinvolvedinpolymerdegradation(b-gluco- Conclusions sidase, leucine-aminopeptidase and lipase) and in nutrient This pilot study provided valuable results on the develop- remobilization (phosphatase). In general, resumption of mentofbacterialcommunitiesandthere-establishmentof activity of the first group of enzymes was faster for the microbial processes with rewetting following drought, but Central European stream (Fig. 7a–c). Levels similar to also showed important details that await further investiga- nondesiccated sediments were measured for all these en- zymes in the Breitenbach sediments after 4 days of rewet- tion.Forexample,theimpactofthedurationandintensity D ting. Although enzyme activities for rewetted Mulargia of drought, long-term effects or seasonal differences, and ow sedimentsweresimilartoBreitenbachsedimentsattheend shiftsincommunitycompositionduringdryingandrewet- nlo of the experiment, they achieved a much lower percentage ting, including impacts on community metabolism and ad e ecosystem services (Sabater, 2008), require further study. d thaninMulargiasedimentsbeforedesiccation(12–49%). The potential loss of Gram-negative bacteria, which are fro ThefasterrecoveryofEEAintheBreitenbachsediments m cbcaoannctteebrneiatal(ts1ttr6rie.b1au%mte;dcToatmobmlethu1en)ibtdyeutbtreeirncagsuutsrheveiovpfahtlhaoesfehtoihgfehdeirensdmicigoceaisnttiouounres. mt‘ninaogrrreo(swSuc’shcoiermp‘tseiplbelecetitaolaizlo.e,sdm2’0ofu0tin7c)cs,ttiormensissg(hdStucrhrineimsguedlltr,y1iin9n9g5tha)nepdrloorveswisdeeotd-f https://ac a ThehighEEAafterdroughtiscomparabletotheoccurrence by specific groups of Gram-negative bacteria only (Pesaro de of high functional gene abundance (denitrifiers, methano- etal.,2004;Schimeletal.,2007). mic gens) in peatland streams that did not decline through The high activity levels at the beginning of rewetting in .ou drought and exhibited no effects on gene diversity and both environments, especially of extracellular enzymes in- p.c composition (Kim et al., 2008). In addition, bacterial volved in polymer degradation (b-glucosidase, peptidase om population density was not significantly affected (Freeman and lipase), indicated the persistence of extracellular en- /fem zymesinthesedimentsduringdrought.Thefasterresump- s et al., 1994). The situation for Mulargia appears to be e c different. Bacterial community composition changed dis- tionofcommunitystructureandmetabolismintheCentral /a tinctly during the first days of rewetting as TGGE data European stream Breitenbach can be attributed to less rticle showed (Fig. 5). Resumption of EEA as well as BCP took completedesiccation.Thisresultedinsurvivalofamicrobial -a b communitycloserinsizeandcompositiontotheindigenous s moretimethaninBreitenbachsediments.Thissupportsthe tra asussbusmtapnttiioalnlytrhedatucnedo,tbountltyhahtaedspebcaiactlleyriiamlpnourtmanbterpsarbtseeonf slatrregaiam. Tchomusm, tuhneitmyitchraonbiianl ftuhnecMtioendsiteirnrvaensetiagnatsetdrewamereMrue-- ct/71/3 thecommunitywerediminishedduringdrought,whichwas established in the Breitenbach sediments after 4 days of /3 7 rewetting, but they were still distinctly below activities 4 much more drastic (0.42% watercontent; Table 1) than in /4 the Breitenbach. Thus, the Mulargia sediment community found before desiccation in the Mulargia sediments. It 89 3 needed more time to recover its structure and functions. might be speculated from these results that in the Central 71 After4daysofrewetting,abundanceandactivityseemedto European stream Breitenbach the microbial community by be completely restored in the Breitenbach sediments, exhibits high resistance (Allison & Martiny, 2008) against gu e this type of disturbance through comparatively moderate s whereasintheMulargiasediments,theseprocesseshadnot t o yetrecovered. desiccation.However,intheMediterraneanriverMulargia, n 0 acommunitymighthavedevelopedthatisresilient(Botton 4 Adifferent picture emerged for the activity of phospha- A et al., 2006) to the specific conditions of dry–wet cycles p tparsoens.ouAnftceerdaingcrreeaatseer,(tMheuirlaargctiaiv)itoiersadelecsrseearse(dBrteoiwteanrbdacthhe) typicallyoccurringinsemi-aridclimaticregions. ril 20 1 end of the experiment far below the levels occurring in 9 nondesiccated sediments for both environments (Fig. 7d). Acknowledgements However, the demand for phosphorus should not be less duringrewettingandre-establishmentofmicrobialactivity. ThestudywasperformedattheLimnologicalRiverStation However,thedeathoforganismsinducesincreasingminer- of the Max Planck Institute for Limnology in Schlitz, alization of cytoplasmic solutes during the drying process Germany,theDepartmentofAnimalEcology,Universityof (Fierer & Schimel, 2003; Bardgett et al., 2008) as does the Gießen, Germany, and the Water Research Institute of ruptureofcellsandexcretionofosmolytesatinitialphases National Research Council in Rome, Italy. We thank Beate of rewetting (Halverson et al., 2000; Fierer et al., 2003; Kno¨felforherengagedlaboratoryassistance.A.Z.andS.W. Schimel et al., 2007). All these processes make unbound appreciate the financial support of the MaxPlanck Society FEMSMicrobiolEcol71(2010)374–386 (cid:3)c2009FederationofEuropeanMicrobiologicalSocieties PublishedbyBlackwellPublishingLtd.Allrightsreserved