Logout succeed
Logout succeed. See you again!

Mitochondrial DNA sequence patterns of Harbour porpoises (Phocoena phocoena) from the North and the Baltic Sea PDF
Preview Mitochondrial DNA sequence patterns of Harbour porpoises (Phocoena phocoena) from the North and the Baltic Sea
ZEITSCHRIFr^P^FÜR Z.Säugetierkunde61(1996) 104-111 © SAUGETIERKUNDE 1996GustavFischer,Jena INTERNATIONALJOURNAL OF MAMMALIAN BIOLOGY DNA Mitochondrial sequence patterns ofHarbour porpoises (Phocoenaphocoenä) from the North and the Baltic Sea ByR. TiEDEMANN,J. Harder, Christine Gmeiner, andE. Haase InstitutfürHaustierkunde, UniversityofKiel, Kiel, Germany ReceiptofMs.29. 11.1995 AcceptanceofMs. 22. Ol. 1996 Abstract To investigate genetic differentiation between harbour porpoises {Phocoena phocoena) of the North andtheBalticSea,atotalof39individualswerescreenedforsequencepolymorphismsatahighlyPoly- morphiepart ofthe mitochondrial DNAcontrolregion. DNAwas extractedfromliverorskin samples ofstranded animals. After PCR amplification and direct sequencing, 420bp were scored. Nine haplo- typeswere found, differingfrom one anotherbyone tofourtransitions. Haplotypes separatedoutinto two ClustersA andB byaspecificnucleotide Substitution. All Baltic harbourporpoisesshowedtype A haplotypes,whichwasfoundonlyin45% oftheNorthSeaspecimens. GeneticVariationintermsofnu- cleotide andhaplotype diversities was much lowerin the Baltic Sea than in the North Seapopulation. HaplotypecompositionandnucleotidedivergencesuggestacolonizationoftheBalticSeaseveralthou- sand years ago and a limited genetic exchange since then. The genetic differentiation between Baltic andNorthSeapopulationsofharbourporpoisesiscorroboratedbypubhsheddatabothonskullcharac- terdifferencesandenzymepolymorphisms. Introduction The harbour porpoise (Phocoena phocoena) is a small cetacean Speeles inhabiting coastal waters in the Northern hemisphere (Nowak 1991; Kinze 1994). On a global scale, the po- pulations ofthe North Atlantic, the North Pacific, and the Black Sea differ significantly in morphology, especially in skull characteristics, and have been described as three different subspecies Phocoena phocoena phocoena, P.p. vomerina, and P.p. relicta (Tomilin 1967; YuRicK and Gaskin 1987; Amano and Miyazaki 1992; Kinze 1994). The subspecies Status A is corroborated by mitochondrial control region differentiation (Rosel et al. 1995). further subdivision into local populations has been proposed due to limited migration and the incoherence of suitable habitat (Gaskin 1984; Kinze 1994). The population definition is controversial for the Eastern part of the North Atlantic: while some authors define three to four local populations (Gaskin 1984), others assume the entire area to be inhab- ited by a coherent population (Andersen 1972). However, there is some support for a se- parate Baltic population from skull character analyses (Kinze 1985) as well as from enzyme electrophoretic data (Andersen 1993). From a population genetic point ofview, the alternatives ofpopulation segregation vs. panmixia may be settled by a quantitative approach. Our comparison of the harbour por- poises from the North Sea and the Baltic Sea aims at estimating the amount and the di- DNA rection of gene flow between those areas. In this context, mitochondrial sequence patterns have been proven to be a suitable measure ofgenetic diversity within and among populations (cf. Avise 1994). MtDNApatternsinHarbourporpoisesPhocoenaphocoena 105 Material and methods A total of 39 harbour porpoises stranded on the coast of the North Sea (n=19) and the Baltic Sea (n=20)wereanalysed(Fig. 1). Liverorskinsampleswerestoredfor0-24monthsat-80°Cuntilanaly- sis. Fig.1. Samplinglocalities(placeofstranding)oftheanalysedharbourporpoisespecimens.Numbers givesamplesizeforeachsite. Total DNA was exctracted from 100mg of tissue using the SuperQuikGene DNA isolation kit (Analytical GeneticTestingCenter,Denver,USA) accordingtomanufacturer'sInstructions.The DNA was dissolved in a final volume of 100\\\ Tris (pH8.5). 5)il DNA Solution were used for an enzymatic amplificationofapartofthe mitochondrial control regionviaPolymerase chain reaction (PCR), using theprimers5'-CACCACCAACACCCAAAGCT-3' and5'-CCTGAAGTAAGAACCAGATG-3'.These primersproduceaproductof471 basepairs(bp),containing45bpoftheProlin-tRNAand426bpofthe control region. The PCR-product contains the most variable part of the control region in Cetacea (Arnasonetal. 1993).Thefollowingamplifcationprofilewasapplied:Afteraninitialdenaturationstep at 95°C for 5min, 40 cycles were carried out with a denaturation at 94°C for 1:30min, annealing at 51.9°C for 1:15min, and extension at 72°C for 1:30min, followed by a final extension at 72°C for 2:30min. The PCR-products were cycle-sequenced directly using the SequiTherm Cycle Sequencing Kit (Epicentre, Madison, USA) and the Digoxigenin-labelled oligonucleotide 5'-DIG-CACCAA- CACCCAAAGCT-3'for30cycles,eachwithadenaturationat95°Cfor30s,ananneahngat53.2°Cfor 30s,andanextensionat70°Cfor1 min.Sampleswererunonadirectblotsequencingdevice(Richter- ichetal. 1989),andsequencesweredetectedusingananti-Digoxigenin/alkalinePhosphataseconjugate (Boehringer, Mannheim, Germany) and the chemiluminescent Substrate CDP-Star (Tropix, Bedford, USA),followingmanufacturer'sInstructions. Mitochondrialhaplotypesweredefinedonthebasisof420bpscoredsequenceofthecontrolregion andcomparedin termsofpairwise nucleotide divergence (Nei andJin 1989), usingtheNeighbor-Join- ing-method (Saitou and Nei 1987) and the PHYLIP 3.5c Computer package (Felsenstein 1993). A published sequence ofa Black Sea harbour porpoise was used as an outgroup (Rosel et al. 1995). A mediangraphoftherelationshipsbetweenmitochondrialhaplotypeswasdeterminedaccordingtoBan- delt (1992). AsmeasuresofgeneticVariationwithin and amongpopulations, meannucleotide diversi- ties within and between the two geographic areas were estimated (cf. Quinn and White 1987), and haplotypediversitieswithinpopulationswerecalculated(NeiandTajima1981). 106 R.TiEDEMANN,J.Harder,CHRISTINEGmeiner,andE.Haase Results The harbour porpoises analysed comprised nine different mitochondrial haplotypes as de- fined by sequence patterns ofthe Control Region. These were defined arbitrarily as Pho I to Pho IX, differing from one another by one to four transitions (Fig. 2, Tab. 1). An analy- sis of haplotype sequence divergence by the Neighbor-Joining procedure suggested two major Clusters A and B, containing Pho I, Pho III, PhoVII, PhoVIII (cluster A), and Pho II, Pho IV, PhoV, Pho VI (cluster B) (Fig. 3). The haplotype Pho IX was sorted to none ofthese Clusters and showed the highest similarity to a specimen from the Black Sea (BS), which served as an outgroup. As shown in a median graph, each haplotype could be A derived from at least one other haplotype by a Single point mutation, and the Clusters and B could be defined by a C and T, respectively, at position 198 (Fig. 4). 000000000000000000000000001111111111111122222222233333333333333 001122333445556666788889990112222344446912445677900111225556888 697837179130281247401456899020126901890897158707413789020153567 NP GTGTTGTATCTTAGTATTCACCTTCTGGCT-CCACACATCCACCCGCTCATAATCCCGGTCCT BS CA. TC. AGG.CG, CAT T T--GTG .G. .T T. .CT.C Pho CAA. TCC.ACGCG.G. CT T T--GTG . .T .TA. TC Pho II CAA. TCCACGCCG. CT T T--GTG T .T TA. TC Pho III CAA. TC. ACGCG.G. CT T T--GTG .T TA. TC Pho IV CA. TC. ,ACGCG CT T T--GTG T .T TA. TC Pho V CAA. TC. .ACGCG CT T T--GTG T .T TA. TC Pho VI CA. TC. ,ACGCG, CT T T--GTG T .T TAA TC PPhhoo VVIIIII CCAAAA.. TTCCC,AACCGGCCGG,, CCTT TT TT----GGTTGG , .TT TTAAAA, TTCC Pho IX CA. TCC.ACGCG, CT T T--GTG .T TA. TC . , Fig.2. Sequencepolymorphismsinthedifferenthaplotypesofharbourporpoisefoundinthisstudy,as comparedtospecimensfromtheNorthPacific(NP)andtheBlackSea(BS) (np1 andbs1 fromRosel etal. 1995).Positionnumbersareindicatedbythreeverticaldigits. Table1. Numberofdifferentnucleotides(abovediagonal)andpairwisenucleotidedivergencein % (belowdiagonal)betweenmitochondrialhaplotypesofharbourporpoise. Pho I II III IV V VI VII VIII IX I 1 1 3 2 4 1 2 1 II 0.24 2 2 1 3 2 3 2 III 0.24 0.48 2 1 3 2 1 2 IV 0.71 0.48 0.48 1 1 4 3 2 V 0.48 0.24 0.24 0.24 2 3 2 3 VI 0.95 0.71 0.71 0.24 0.48 3 2 3 VII 0.24 0.48 0.48 0.95 0.71 0.71 1 2 VIII 0.48 0.71 0.24 0.71 0.48 0.48 0.24 3 IX 0.24 0.48 0.48 0.48 0.71 0.71 0.48 0.71 MtDNApatternsinHarbourporpoisesPhocoenaphocoena 107 The geographic distribution of the haplotypes is given in table 2. The most common haplotypes Pho I and Pho VII were found in 62% of the animals. Over- all mean nucleotide diversity was 0.37%, overall hap- lotype diversity was 0.80%. The genetic Variation of the Baltic Sea population in terms of within popula- tion nucleotide diversity was less than 50% of the Var- iation in the North Sea population, and also the haplotype diversity was considerably lower in the Bal- tic Sea (Tab. 2). The difference in the haplotype com- positions of these two populations was highly significant (p = 0.0001; Fisher's exact test): all Baltic specimens showed Cluster A haplotypes (95%-confi- dence limits: 83%-100%). These had only a frequency of 45% in the North Sea (95%-confidence limits: 26%-69%). The frequency of the most common hap- Fig.3. Sequencedivergenceamong lotype PhoI had an increasing tendency from 26% in haplotypesofharbourporpoises the North Sea through 40% in the Western Baltic Sea fromNorthandBalticSea(Neigh- to 60% in the Eastern Baltic area (the last value was bor-Joining-tree,basedonnucleo- based on a very small sample size, however). As a tidedivergenceaccordingtoNeiand measure of the divergence between the North Sea and JiN 1989).Aspecimenfromthe the Baltic Sea population, net nucleotide diversity be- BlackSeapopulation(BS;cf.Fig.2) tween them was estimated to be 0.13%. Net nucleo- servedasanoutgroup. tide diversity between the Western and Eastern subpopulation of the Baltic Sea was negligible (0.03%). Fig.4. Mediangraphoftherelationshipsamonghaplotypesintermsofnucleotidesubstitutions.Note, thatthetransitionatposition17isincludedtwice,i.e. astwodifferentvectors,toallowathree-dimen- sialrealisationofthegraph. 108 R.TiEDEMANN,J.Harder,CHRISTINEGmeiner,andE.Haase Table2. Geographiedistributionofmitochondrialhaplotypes,nueleotidediversity(n)andhaplotype diversity(S)withinpopulationsofharbourporpoise. INUILlloca Western Eastern BalticSea BalticSea Pho I 14 5 9 6 3 PhoII 1 1 PhoIII 3 2 1 1 PhoIV 4 4 PhoV 2 2 PhoVI 2 2 PhoVII 10 2 8 8 PhoVIII 2 2 2 PhoIX 1 1 n 39 19 20 15 5 7r(%) 0.36 0.42 0.18 0.15 0.23 ö 0.80 0.88 0.66 0.59 0.60 Discussion For the total distribution ränge of the subspecies P.p.phocoena, i.e. the whole North Atlantic, mean nueleotide diversity in the control region was estimated to be 0.48%, and the West Atlantic population was found to be more diverse (0.58%) than the population of the Hast Atlantic (0.40%; all values recalculated from Rosel et al. 1995, using the for- mulae of Quinn and White 1987). Our value for North and BaUic Seas together (0.37%) was in good agreement with the value for the East Atlantic. Since all haplotypes except PhoI were only found either in the West or in the East Atlantic and net nueleotide diver- sity between these areas was high (0.28%; calculated for the combined data set of Rosel et al. 1995 and this study), gene flow between these areas appears very limited or even ab- sent. The predominance of the two ubiquitous haplotypes Pho I and PhoVII, which dif- fered only by one nueleotide, suggests these types to be ancestral. This is corroborated by the results of a comparable study on eight harbour porpoises from Norway and the Dan- ish Skagerrak, containing 4 times Pho I, once PhoVII, and three additional haplotypes, of which two could be derived from Pho I by a Single transition (Rosel et al. 1995). More- over, Pho I is the only haplotype that has been found both at the East and the West Atlantic coasts (Rosel et al. 1995). On the contrary, the characteristic transition at Posi- tion 198, defining the Cluster B haplotypes, was found neither on the West coast of the Atlantic nor in the Black Sea (Rosel et al. 1995) and may thus have arisen locally. Considering the Status of the Baltic harbour porpoise population, three alternative hy- potheses concerning initial colonization and current extent of gene flow are to be dis- cussed: 1. North Sea and Baltic Sea are completely panmictic (cf. Andersen 1972). We would expect the same haplotypes, occuring at similar frequencies, and similar nueleotide and MtDNApatternsinHarbourporpoisesPhocoenaphocoena 109 haplotype diversities within both populations. Net nucleotide diversity between the areas should be close to zero. 2. The Baltic Sea has been colonized once and then remained genetically isolated from the North Sea. Then, the Baltic Sea population could be expected to be genetically less diverse due to a persisting founder effect. The haplotype composition could be differ- ent as an effect ofrandom genetic drift. 3. North Sea and Baltic Sea are inhabited by separated populations, but gene flow oc- curs occasionally. The Baltic Sea population might again be genetically less diverse, but its haplotype composition could represent a subset ofthe North Sea haplotypes. The significant differences found in haplotype composition and nucleotide diversity prompt US to reject the first hypothesis of total panmixia: ClusterB haplotypes are absent in the Baltic Sea, and the nucleotide diversity of the Baltic Sea population is only half that of the North Sea population. When considering the second hypothesis of complete Isolation between the two populations, we may invoke the concept of the molecular clock (cf. Avise 1994): Assuming that the part of the mitochondrial genome studied here may have diverged at a rate of about 15% per million years in an intraspecific comparison (RosEL 1992), the net nucleotide diversity suggests a divergence between Baltic and North Sea population about 8500 years ago. This coincides quite well with the age of the Baltic Sea as a brackish sea (L/rorma-period; cf. Liedtke 1981). However, these values must be taken with caution, since both the divergence rates and the nucleotide diversities may contain stochastic errors. Nevertheless, these values provide some support for the second hypothesis. The haplotype composition of the two respective populations shows that all haplotypes found in the Baltic Sea were also present in the North Sea, except for PhoVIII, which was found only in the Eastern part of the Baltic Sea. This pattern could be explained by a colonization of the Baltic Sea by harbour porpoises with ubiquitous haplotypes (Pho I, PhoIII, PhoVII). The low nucleotide and haplotype diversities in the Baltic Sea indicate a persisting founder effect. However, the Baltic population might be sufficiently large that it is not driven to haplotype uniformity by random genetic drift. Re- cent census data estimated a population size of about 50,000 specimens in the Baltic Sea, which is almost twice as high as in the Eastern part of the North Sea (Germany and Den- mark combined; Kinze 1994; Hammond et al. 1995). It should be noted, however, that the majority of the Baltic Sea population is located in the Kattegat area (Hammond et al. 1995), which was not sampled in this study. Considering the third hypothesis, the significant differences in haplotype composition between the two populations do on a first glimpse not support the Interpretation of con- siderable gene flow between them. If we apply a model of the relation between the amount ofgene flow and the frequency of exclusive genetic characters (i.e. exclusive hap- lotypes), we get a rough estimate of the number (Nm) of individuals migrating between separated populations per generation (Slatkin 1985). In this study, 55% of the North Sea and 10% of the Baltic Sea harbour porpoises have exclusive haplotypes, which gives an Nm estimate for =0.01, i.e. one migrating specimen per 100 generations. Taking into ac- count that Harbour porpoises are not fertile until the age of three to four years (S0RENSEN and Kinze 1993), this would correspond to only one migration event every several hundred years. This value apparently underestimates gene flow, since it would pro- pose only about 10 to 20 migration events since the beginning of the L/rorma-period of the Baltic Sea. The Nm value is possibly biased towards an underestimation for mainly two reasons: 1. There is some evidence that there is a seasonal pattern in the population structure within the North Sea (Andersen 1993; Kinze 1994). Ifthere would be a season- ality both in the mitochondrial haplotype compositon in the North Sea and in the time of migration between North and Baltic Sea, the number of excluxive North Sea haplotypes may be overestimated, which consequently leads to an underestimate ofNm. 2. Mitochon- DNA Nm drial is maternally inherited. Thus, our estimate does not include Immigration 110 R.TiEDEMANN,J.Harder,CHRISTINEGmeiner,andE.Haase Nm of males. Despite these cautions on the estimate, it is an indication for only limited genetic exchange between the Baltic and the North Sea population ofharbour porpoise. The apparent genetic isolation of the Bahic Sea is surprising considering the known Winter migration of Baltic harbour porpoises out of the Baltic (Dudok van Heel 1962), where they are likely to meet North Sea individuals (Kinze 1994). However, fertilization occurs in July and August (M0hl-Hansen 1954), when porpoises are in the Baltic Sea (Schulze 1987). Thus, the observed genetic segregation in the maternally inherited mito- DNA chondrial between North and Baltic Sea could be explained by philopatry, assuming that at least females return to their area ofbirth for fertilization. Differences between these areas are also suggested from investigations on isoenzymes, which are encoded in the nuclear genome and thus susceptible for gene flow in both sexes (Andersen 1993). Moreover, morphological characters indicate population differentiation (Kinze 1985). Thus, we conclude that the Baltic population of harbour porpoise has been genetically isolated after a postglacial colonization and gene flow into this population is a rare event. Acknowledgements We thank Dr.Harald Renke, Dr. Roland Lick, ProfDr.Janusz Markowski, Dipl.-Biol. Gerhard Schulze, and Dr.Ursula Siebert for providing samples. We also thank ProfDr.Dieter Kruska for Support and fruitful discussions during the progress of the study. ProfDr.Jan Duinker and Dipl.- Biol.Helga Dröfn Högnadöttirprovidedvaluable commentson the manuscript. Financial supportis acknowledgedfromtheGermanMinistryofResearchandTechnology. Zusammenfassung UntersuchungenandermitochondrialenDNAvonSchweinswalen (Phocoenaphocoena)ausNord- undOstsee Um das Ausmaß genetischer Differenzierung zwischen der Nord- und der Ostsee-Population des Schweinswals {Phocoena phocoena) zu analysieren, wurden 39Individuen auf DNA-Sequenzun- terschiedeineinemhochpolymorphenAbschnittdermitochondrialenKontrollregionuntersucht. DNA wurde aus Leber- und Hautproben gestrandeterTiere isohert. Nach einerAmplifikation mit derPoly- merase-Kettenreaktion (PCR) und direkter Sequenzierung der Amplifikate wurden 420Basenpaare ausgewertet. 9mitochondriale Haplotypenwurdengefunden, die sichjeweilsaneinbisvierNukleotid- positionen durch Transitionen unterschieden. Auf der Grundlage einer spezifischen Substitution wur- denHaplotypeninzwei Gruppen (AundB) eingeteilt. AlleuntersuchtenSchweinswale ausderOstsee zeigtenHaplotypenderGruppeA, die nurbei45% derNordseetieregefundenwurden. Diegenetische Variation,gemessenalsNukleotid- undHaplotypendiversität,warin derOstseepopulationdeutlichge- ringer als in derNordseepopulation. Aufgrund derFrequenzen gefundener Haplotypen sowie der Nu- kleotiddiversität zwischen den Populationen ist davon auszugehen, daß die Ostsee voreinigen tausend JahrendurchSchweinswalebesiedeltwurde. NachdieserBesiedelungwardergenetischeAustauschmit der Nordseepopulation wahrscheinlich sehr gering. Die in dieser Untersuchung gefundene genetische Differenzierung zwischen Schweinswalen aus Nord- und Ostsee steht im Einklang mit Literaturanga- benzuUnterschiedeninSchädelmerkmalenundEnzympolymorphismen. Literature Amano,M.;Miyazaki,N. (1992):GeographieVariationinskullsoftheharbourporpoise,Phocoenapho- coena.Mammalia56, 133-144. Anderson,S. (1972): Status over den danske hvalbestand. In: Status over den danske dyreverden. Ed. byB.Benzons. Copenhagen:ZoologiskMuseum,Pp.239-242. MtDNApatternsinHarbourporpoisesPhocoenaphocoena III Andersen,L.W. (1993):Thepopulationstructure ofharbourporpoise, Phocoenaphocoena, in Danish watersandpartoftheNorthAtlantic.Mar.Biol.116, 1-7. Ärnason,Ü.; Gullberg,A.; Widegren,B. (1993): Cetacean mitochondrial DNA control region: se- quencesofallextantBaleenwhalesandtwoSpermwhalespecies.Mol. Biol.Evol.10,960-970. Avise,J. (1994): Molecularmarkers, natural history and evolution. New York, London: Chapman and Hall. Bandelt,H.J. (1992): GeneratingmediangraphsfromBooleanmatrices. In: Ll-Statisticalanalysis. Ed. byY.DoDGE.NorthHolland:Elsevier.Pp.305-309. DuDOKvanHeel,W.H. (1962):SoundandCetacea.Neth.J.SeaRes.1,407-507. Felsenstein,J. (1993): PHYLIP (Phylogeny Inference Package) version 3.5c. Seattle: Department of Genetics,UniversityofWashington. Gaskin,D.E. (1984):TheharbourporpoisePhocoenaphocoena (L.): Regionalpopulations,Status, and Informationondirectandindirectcatches.Rept. Int.Whal.Commn.34,569-586. Hammond,P;Heimlich-Boran,S.; Benke,H.;Berggren,P; Collet,A.;Heide-J0rgensen,M.P; Leo- pold,M.;0IEN,N. (1995):Thedistributionandabundanceofharbourporpoisesandothersmallce- taceans in the North Sea and adjacent waters. Cambridge: Final Report of the European Union projectLIFE92-2/UK-U27. KiNZE,C.C. (1985): IntraspecificVariation in Baltic andNorth Sea harbourporpoises (Phocoenapho- coena(L., 1758)).Vidensk.Medd.dansknaturh.Foren.146,63-74. KiNZE,C.C. (1994):Phocoenaphocoena (Linneaus, 1758)-Schweinswal. In: HandbuchderSäugetiere Europas.Ed.byD.Robineau,R.Duguy,andM.Klima.Wiesbaden.:Aula-Verlag.Pp.242-264. Liedtke,H. (1981): Die nordischen Vereisungen in Mitteleuropa, 2.ed. Trier: Zentralausschuß für deutscheLandeskunde. M0HL-HANSEN,U. (1954): Investigations on reproduction and growth ofthe Porpoise (Phocaenapho- caena(L.))fromtheBaltic.Vidensk.Medd.dansknaturh.Foren.116,369-396. Nei,M.; Jin,L. (1989): Variances of the average numbers of nucleotide substitutions within and be- tweenpopulations.Mol.Biol.Evol.6,290-300. Nei,M.; Tajima,F. (1981): DNA polymorphism detectable by restriction endonucleases. Genetics 97, 145-163. Nowak,R.M. (1991):Walker'smammalsoftheworldVol.II,5thed.Baltimore,London:JohnHopkins Univ.Press. Quinn,T.W.; White,B.N. (1987): Analysis of DNA sequence Variation. In: Avian genetics. Ed. by F. CooKEandP.A.Buckley.London:AcademicPress.Pp. 163-198. Richterich,P; Heller,C; Wurst,H.; Pohl,F.M. (1989): DNA sequencing with direct blotting elec- trophoresisandcolorimetricdetection.BioTechniques7,52-58. RosEL,P.E. (1992): Geneticpopulation structure and systematicrelationships ofsome smallcetaceans inferredfrommitochondrialDNAsequenceVariation.PhDthesis,Univ.California,SanDiego. RosEL,P.E.; Dizon,A.E.; Haygood,M. G. (1995): Variability of the mitochondrial control region in populationsoftheharbourporpoise,Phocoenaphocoena, oninteroceanicandregionalscales. Can. J.Fish.Aquat.Sei.52, 1210-1219. Saitou,N.; Nei,M. (1987): The Neighbor-Joining method: A new method for reconstructing phyloge- netictrees.Mol.Biol.Evol.4,406^25. Schulze,G. (1987):DieSchweinswale.WittenbergLutherstadt:A.ZiemsenVerlag. Slatkin,M. (1985):Rareallelesasindicatorsofgeneflow.Evolution39,53-65. S0RENSEN,T.B.; KiNZE,C.C. (1993): Reproduction and reproductive seasonahty in Danish harbour porpoisesPhocoenaphocoena(L.). Ophelia39, 159-176. ToMiLiN,A.G. (1967):MammalsoftheU.S.S.R.andadjacentcountriesVol.IX. Cetacea.Jerusalem:Is- raelProgramforScientificTranslations. YuRiCK,D.B.; Gaskin,D.E. (1987): Morphometric and meristic comparisons ofskulls ofharbour por- poisePhocoenaphocoena(L.)fromtheNorthAtlanticandNorthPacific.Ophelia27,53-75. Authors'address: Dr.Ralph Tiedemann, Jürgen Härder, Mag. Christine Gmeiner, and Prof.Dr.Eberhard Haase, Institut für Haustierkunde, Christian-Albrechts-Uni- versitätzuKiel,Olshausenstraße40,D-24118Kiel,Germany