Logout succeed
Logout succeed. See you again!

Mitochondrial DNA Sequences Coding for a Portion of the RNA of the Small Ribosomal Subunits of Tetragnatha mandibulata and Tetragnatha hawaiensis (Araneae, Tetragnathidae) PDF
Preview Mitochondrial DNA Sequences Coding for a Portion of the RNA of the Small Ribosomal Subunits of Tetragnatha mandibulata and Tetragnatha hawaiensis (Araneae, Tetragnathidae)
1991. The Journal ofArachnology 19:210-214 MITOCHONDRIAL DNA SEQUENCES CODING EOR A PORTION OF THE RNA OF THE SMALL RIBOSOMAL SUBUNITS OF TETRAGNATHA MANDIBULATA AND TETRAGNATHA HAWAIENSIS {ARANEAE, TETRAGNATHIDAE) Henrietta B. Croom: Department of Biology, The University of the South, Sewanee, Tennessee 37375 USA Rosemary G. Gillespie and Stephen R. Palumbi: Department ofZoology, The University ofHawaii at Manoa, Honolulu, Hawaii 96822 USA ABSTRACT. A region ofmitochondrial DNA coding for most ofthe third domain ofthe 12S rRNA ofthe ribosomal small subunit has been sequenced from two spiders in the genus Tetragnatha (Araneae, Tetrag- nathidae): a circumtropical species T. mandibulata and an endemic Hawaiian species T. hawaiensis. The secondary structure ofthe spiderribosomal RNA shows strong similarity to that ofinsects. Acrossthis region, the two Tetragnatha sequences are 22% different. The T. mandibulata sequence is 36% different from the homologous segment in Drosophila yakiiba and 51% different from the same segment in Homo sapiens. The spider sequences are sufficiently variable to be useful in studying genetic relationships among at least some of the species in thisgenus. A powerful approach to studying genetic re- tion make it often more instructivethan nuclear DNA DNA latedness of species involves sequence in comparing taxa (Wilson et al. 1985). DNA comparisons which can be used to estimate This evolves rapidly at the sequence level branching order ofphylogenetic trees as well as in arthropods (DeSalle and Templeton 1988; evolutionary distance between extant taxa (Fel- Palumbi and Benzie 1991) and has proven use- senstein 1988). Recent application ofthe poly- ful for comparing recently-evolved taxa in Ha- merase chain reaction and direct sequencinghas waii (DeSalle et al. 1987). accelerated efforts to examine a wide range of In order to determine nucleotide sequence in taxawithDNAcomparisons(Kocheretal. 1989; a particular mtDNA segment, the segment must Martinetal. 1990). Todatetheuseofthismeth- first be amplified either by genetic cloning or by od in studying spiders has not been reported. usingthe polymerasechain reaction (Mullis and Here we describe a procedure we have used to Faloona 1987;Saikietal. 1988).Thelattermeth- amplify and to determinethe sequence ofnucle- od depends upon knowledge ofoligonucleotide otidesofa279-base-pairregionofmitochondrial sequences that flank the segment ofinterest and DNA (mtDNA) from two species ofthe genus that serve as primers for enzymatic amplifica- Tetragnatha (Araneae, Tetragnathidae). tion. Kocher et al. (1989) have described uni- DNA Sequencing hasthefollowingadvantages versal (highly-conserved) oligonucleotide se- overothertechniques ofgeneticcomparison; (1) quences flankinga 300-base portion ofthe third ithasgreaterresolvingpowerovera hierarchical domainofthe 12SribosomalRNAgenethatcan range of intraspecific to intergeneric compari- be used to amplify mtDNA from animals as di- sons, (2) sequences are easily compared with verse as humans and invertebrates. The conser- known sequences from other species, and (3) vation of these primers makes them useful to DNA functional information on products encoded by investigators sequencingthe ofspecies for DNA allows strong inferences on the selective whichthereisnoprevioussequenceinformation importance of mutations observed, allowing (Simon et al. 1990). We first used insect-specific character weighting for sites that are not selec- primers for the 12S rRNA region, slightly mod- tively neutral (Kocher et al. 1989). Mitochon- ifiedbyC.Simon(pers.comm.)fromtheoriginal drial DNA was chosen for this work because its primers ofKocher et al. (1989), to amplify and DNA matriarchal inheritance and lack ofrecombina- sequence the of Tetragnatha mandibulata 210 5 CROOM ET Ah.-TETRAGNATHA MTDNA SEQUENCES 211 Walckenaer. We then designed a spider-specific location in the Drosophila yakuba mtDNA se- primer based on this sequence to amplify and quenceofClary and Wolstenholme(1985), were sequence the same region from a Hawaiian en- 12St-L (14503), a Tetragnatha-specific primer demic species T.hawaiensis Simon. designed by H. Croom: 5’-GGTGGCATTT- MATERIALS AND METHODS TATTTTATTAGAGG-3’and 12Sbi-H (14214), an insect-specific primer designed by C. Simon: Allsolutionsusedwereeithersterilizedorpre- 5’-AAGAGCGACGGGCGATGTGT-3’. One paredusingsteriledeionized,distilledwater,and mL of the double-stranded product of the first all glass- and plastic-ware were sterile with the amplification was cycled under the same con- exceptionoftheCentricontubes(seebelow).The ditionsasaboveexceptthatonlyoneprimerwas chelicerae and a front leg of each spider were added to the incubation mixture. This produced placed in 70% ethanol as voucher specimens. a single-strand sequencing template, which was Total (genomic) DNA was prepared by homog- processed in a Centricon 30 microconcentrator enizing a single spider in a 1.5 mL Eppendorf (Amicon) to concentrate and purify the DNA mM tubein 200mLof25 TrisHCl (pH 7.5), 100 product. The template was then sequenced by mM EDTA, 2%SDS,and200ntg/mLProteinase thedideoxychainterminationmethodofSanger K, followed by incubation for 1-2 hr in a water etal. (1977)asdescribedbyEngelkeetal.(1988), bath at 65 °C. The homogenate was extracted using the primer that had not been used in the DNA first with phenol, previously-equilibrated with 1 second amplification. from three individ- M Tris HCl buffer (pH 7.5), then with 25:24:1 uals ofeach species was sequenced in both di- phenol/chloroform/isoamylalcohol 1 to 4 times rections, and no intraspecific variation was ob- (until all the protein-containing white interface served. wasremoved),and finallywith 24:1 chloroformM/ HomologoussequencesofDNAfromdifferent isoamyl alcohol. One-half volume of a 7.5 taxa were aligned to minimize deletions or ad- solution ofammonium acetatewas addedto the ditions using software written by S. R. Palumbi M extractto achieve a final concentration of2.5 andC. Parrish. Pairwisepercentdifferenceswere and mixed well before adding 2‘/2 volumes of calculatedbycountingonlysiteswherebothspe- 95% ethyl alcohol and mixing again. This solu- cies have nucleotides in our aligned sequences. tion was incubated at room temperature for 1 One strand ofspider DNA was folded to show min to allow for DNA precipitation. The DNA itssecondarystructureusingthefoldedsequenc- was pelleted by centrifugation at 14,000 x g for esofinsectsasaguide(ClaryandWolstenholme 15 min at room temperature, washed with 500 1987; Simon et al. 1990). mL of70% ethyl alcohol, dried under a vacuum, and resuspended in 25 mLwater. Five ixL ofthis RESULTS AND DISCUSSION preparation was electrophoresed on a 0.8% aga- rose gel in Tris-borate buffer and stained with The DNA sequences from the two Tetragna- ethidium bromide as described in Sambrook et tha species were compared with the 12S rRNA al. (1989) to ensure that high molecular-weight genes from both Homo sapiens and Drosophila DNA was present. The preparation is stable in- yakuba (Fig. 1). The two Tetragnatha sequences definitely when stored at -20°C. are 22%different from each other, 36%different One/iLofa 1:10dilutioninwaterofthisDNA from the homologous segment in Drosophila and 2.5 units ofDNA polymerase from Themus (Clary and Wolstenholme 1985), and 51% dif- aquaticus (Perkin-Elmer Cetus) were incubated ferent from the same segment in Homo (Ander- mM in 100 fxL ofbuffercontaining 67 Tris HCl son et al. 1981). In comparison, the Drosophila (pH 8.8), 3 mM magnesium chloride, 16.7 mM andHomosegmentsdifferby45%. These values ammonium sulfate, each of four deoxynucleo- are based solely on pairwise nucleotide differ- side triphosphates at 200 mM and each oftwo ences, ignoring insertions and deletions, using , primers at 1 according to the protocol of the alignments in Fig. 1. It is difficult to align DNA Saiki et al. (1988). Thermal profile for45 cycles nonconserved regions of from distantly- wasas follows: (1) DNAmeltingfor 1 min at 94 related groups, so other alignments may yield °C, (2) annealing for 1 min at 50 °C, and (3) slightly different percentages. Likewise, the dif- polymerizationfor2 min at 72°Ctoamplifythe ferenees here are uncorrected for multiple mu- double-strandedsequence.Theprimersandtheir tations at the same site, which has the effect of . . 212 THEJOURNALOFARACHNOLOGY Tetragnatha mandibulata aacatgtttattaatcgacattacacgattatttt Tetragnatha hawaiensis .. t .......a atc .......... c .. . Drosophila yakuba ... c ..... tg ....... t a c ..... ggacc Homo sapiens g c ctg t . aa.c c . c acc . . . . . . . . . . . . . . . TACTTTTTTATAA ATTTTATATACCTCCGTCC--AGAATAAATTTTTAATA TTT C AATA T G .... TT ..... AAAA .......... C. .CAACACA.C.TT..GG.CT.AA.TTCC..GGC.C.......... GG.T ...A.. TATTTCC . . C. .A. . TCTCC. . AGA. AG. GAAG.GTCAATA.CAAA . . . . . . . . TATTCAAAATAATATTATAATAATTTA GGTAAAGGTGTAGACTTTAAATTAGT-TT AT C GA A A T AG A A T.-.T.T..A.......A...... TATCA.A.C. . . . . . . C.T...A.. .. TT..A.. . .. A. A A G A GCGC GTACCC CGT AAG CGTTA C C CA G GG G. C. AAG . . . . . . . . . . . . . . . . AAATGTGTTACATTAAAAATTATTT AAGAATTATTTTTTATAA CAATATATGA ......A ... AA ........... G ... AAC AA C T AGT T A T .... G ......A.... -T ... ACGGAT.AAAA. . G. A.A. . .A . T . T. . . G.C. TTCT CCCCAGAAAACTACGA GCCC . . . .. G.. AAC.T.T.. . G. GG.TC . . . . . . . . . . . . . . . AAGAGGATTTATAAGCTACTTTTTAATTAAAATTTTAACTTGAATTAAAAA--TAAATGCG .. A.............. TAA T A ... T ...... TA G T GGT TA .AA . . . TAA. G T AA... T ....... TT GCTC ....AT.AT . G . T GC . . TA . AC . A.-AG. .G. .G.. G.. GC.T.G. .-C. GG.GCCC G GCGC . . . . . . . . . . . . Figure 1.—Comparison ofMitochondrial 12S Ribosomal DNA from Tetragnatha mandibulata, Tetragnatha hawaiensis.Homosapiens,andDrosophilayakuba.Dotsrepresentpositionsthatareidenticaltothetopsequence, anddashesrepresentgapsin the sequencesrequired to maximizealignment. The sequence from theDrosophila isthatofClaryandWolstenholme(1985)betweentheirbasepairs 14236and 14502.TheHomoDNAsequence is that ofAnderson et al. (1981) between their bases 1201 and 1475. making the more distantly-related taxa appear tional ribosomal gene. The third domain ofthe deceptively similar. small rRNA encoded by nuclear DNA is both Whenusingthepolymerasechainreactionwith larger than, and has a structure distinct from, genomic DNA, one must always consider the that represented in Fig. 2 (Woese et al. 1983; possibility that nontarget nuclear or mitochon- Dams et al. 1988). drialDNAhasbeenamplified. Usingthemethod We have sequenced most ofthe homologous of Palumbi and Wilson (1990), we separated regionfrom 19otherspiders:Aphonopelmachal- mtDNA from nuclear DNA of25 specimens of codes Chamberlin (Araneae, Theraphosidae), T. mandibulata on a cesium chloride gradient Doryonychus raptor Simon (Araneae, Tetrag- before amplifying and sequencing the mtDNA nathidae), and 17 endemic Hawaiian Tetrag- fraction. The sequence obtainedwas identical to nathataxa.InthecaseoftheA.chalcodes,cesium that in Fig. 1. In order to verify that the spider chloride gradient purified mtDNA was used for sequencescodeforthethirddomainof12SrRNA, the amplification instead ofgenomic DNA. We a single strand was folded to generate the sec- foundeachofthesesequencestobemoresimilar ondarystructurestabilizedbyhydrogen-bonding to the spidersequences in Fig. 1 than tothose of between complementary bases. In all ofthe taxa any otherknown taxa (Croom and Palumbi, un- studied to date (Dams et al. 1988; Simon et al. published). Such similarity suggests that neither 1990), the foldedstructure ofthisdomain forms ofthe sequences reported in this paper is from helical paired stems and unpaired loops. The contaminating DNA. structure obtained from T. mandibulata (Fig. 2) Interestingly, 83% ofall bases in the two Te- isessentiallythesameasthoseoftheotherknown tragnatha sequences are either A or T. In the taxa. Conservation of secondary structure, de- strand shown in Fig. 2, the frequencies for bases spitethe largeoverallsequencedifferencesamong are: 39% A, 43% T, 8% C, 10% G. The percent taxa (Fig. 1), suggestswe have sequenceda func- AT across this region is 79% forDrosophila and 8 CROOM ET AL.-TETRAGNATHA MTDNA SEQUENCES 213 ACKNOWLEDGEMENTS C C WethankBaileyKessing,ChrisParrish,Chris- G-C C-G tine Simon, and Rob deSalle for their help and encouragement during this study. Lei-Anna Willmanprovidedexcellenttechnicalassistance. ThisresearchwassupportedbyNSFgrantBSR- 8604969 and by the Faculty Research and Fac- ulty Development Funds of The University of the South. LITERATURE CITED Anderson, S., A. Bankier, B. G. Barrell, M. H. L. deBruijn, A. R. Coulson, J. Drouin, I. C. Eperon, D. P. Nierlich, B. A. Roe, F. Sanger, P. H. Schreier, A. J. H. Smith, K. R. Stader& I. G. Young. 1981. Sequence and organization of the human mito- chondrial genome. Nature, 290:457^65. Figure 2.—Mitochondrial DNA of Tetragnatha Clatroy,chDo.ndOr.ia&l DD.NAR.mWoollesctuelnehoolfmDer.oso1p9h8i5l.aTyahkeubmai:- ctmohadenedtsih.ibruDdlaadstohaemsafoilrndeepodrfets1oe2nsSthrohiwybdtorhsoeogmseaenlcobRnodNnadArsyfsbotrertuwwchteiuecrnehoAift Clacnrouydc,el.eDo.Jt.iOdM.eols&.eqEuDve.onlc.Re,.,2g2We:on2le5s2otr-eg2na7hn1oi.lzamtei.on,1a9n87d.genDertoi-c and T orC and G, and dots represent the weaker hy- sophilamitochondrialDNA:conservedsequencein drogen bonds between T and G. The portion ofthe theA-l-Trich region and supportingevidence fora sequence between the asterisks * is that ofthe primer secondary structure model ofthe small ribosomal 12St-L. Folding was based on the structure ofSimon RNA. J. Mol. Evol., 25:116-125. et al. (1990). Dams, E., L. Hendriks, Y. Van de Peer, J-M. Neefs, G. Smits& G. Vandenkempt. 1988. Compilation ofsmallribosomalsubunitRNAsequences.Nucleic Acids Res. 16 supl.:r87-rl73. 53% for Homo. This is consistent with the ob- DeSsaolnl.e,1R9.,87T.. FTreemepdmoana,ndE.mMo.deProafgesre,q&uenAc.eCe.vWoillu-- servation that all known arthropods have high tion in mitochondrial DNA ofHawaiian Drosoph- AT content in this domain (Simon 1991). ila. J. Mol. Evol., 26:157-164. ThethirddomainofrRNAishighlyconserved DeSalle,R.&A.R.Templeton. 1988. Foundereffects across many taxa (Kocher et al. 1989). Hence, and the rate of mitochondrial DNA evolution in the largedifference(22%) between thesetwo Te- Hawaiian Drosophila. Evolution, 42:1076-1084. tragnatha species is surprising but not without Engelke, D. R., P. A. Hoener & F. D. Collins. 1988. precedent.PalumbiandBenzie(1991)havefound Direct sequencing of enzymatically-amplified hu- similar percent diversity in the homologous man genomic DNA. Proc. Natl. Acad. Sci. USA, mtDNA region among species ofshrimp in the 85:544-548. genus Penaeus. In addition, we have found 3- Felsenstein,J. 1988. Phylogeniesfrom molecularse- 13%variation in the homologous DNA from 1 q2u2e:n5c2e1s-:56i5n.ference and reliability. Ann. Rev. Gen., different endemic Hawaiian tetragnathids that Gillespie,R. G. 1991. Hawaiianspidersofthegenus appear(on morphologicalgrounds)to havebeen Tetragnatha: I. Spiny leg clade. J. Arachnol., 19: derived from a singleintroduction to the islands 174-209. (Gillespie, unpublished). Such high diversities Kocher, T. D., W. K. Thomas, A. Meyer, S. V. Ed- implythatthese specieshave eitherdiverged for wards, S. Paabo, F. X. Villablanca& A. C. Wilson. a long period or that their sequences have di- 1989. Dynamicsofmitochondrial DNAevolution verged at a rapid rate. We are currently using inanimals:Amplificationandsequencingwithcon- servedprimers.Proc.Natl.Acad.Sci.USA,86:6196- these sequences, as well as those coding for mi- 6200. tochondrialproteins,toconductsystematicanal- Martin,A. P., B. D. Kessing, & S. R. Palumbi. 1990. ysisofthisgroupwhichhasundergoneexplosive Theaccuracyofestimatinggeneticdistancebetween radiation (Gillespie, in press) in the Hawaiian speciesfromshortsequencesofmitochondrialDNA. archipelago. Mol. Biol. Evol., 7:485-488. . 214 THE JOURNALOF ARACHNOLOGY Mullis, K. B. & F. A. Faloona. 1987. Specific syn- cies boundary: Exploiting conserved and variable thesis ofDNA in vitro via a polymerase catalyzed regionsofthemitochondrialgenomeofanimalsvia chain reaction. Methods in Enzymology, 155:335- directsequencingfrom amplified DNA. In: Molec- 350. ularTaxonomy,NATOAdvancedStudiesInstitute. Palumbi, S. R. & J. Benzie, in press. Large mito- (Godfrey M. Hewitt., ed.). SpringerVerlag, Berlin. chondrial DNA differences between morphologi- Simon, C., S. Paabo, T. D., Kocher, & A. C. Wilson. callysimilarpenaeidshrimp.Mol.MarineBiol.Bio- 1990. Evolutionofmitochondrialribosomal RNA technol. in insects as shown by the polymerase chain reac- Palumbi,S. R. &A.C. Wilson. 1990. Mitochondrial tion. Pp. 235-244, In: Molecular Evolution, DNAdiversityintheseaurchinsStrongylocentrotus U.C.L.A. Symposia on Molecular and Cellular Bi- purpuratusandS.dwebachiensis.Evolution,44:403- ology, New Series, Vol. 122. (M. Clegg & S. Clark, 415. eds.). Alan R. Liss, Inc., New York. Saiki, R., D. Gelfand, S. Stoffel, S. Scharf, R. Higuchi, Wilson, A.C., R. L. Cann, S. M. Carr, M. George, U. G. Horn, K. Mullis& H. A. Erlich. 1988. Primer- B. Gyllensten, K. M. Helm-Bychowski, R. G. Hig- directed enzymatic amplification of DNA with a uchi, S. R. Palumbi, E. M. Prager, R. D. Sage& M. thermostable DNA polymerase. Science, 239:489- Stoneking. 1985. Mitochondrial DNA and two 491. perspectivesonevolutionarygenetics. Biol.J. Linn. Sambrook, J., T. Fritsch, & T. Maniatis. 1989. Aga- Soc., 26:375-400. rosegelelectrophoresis. Pp. 6.2-6.18, In Molecular Woese, C. R., R. Gutell, R. Gupta & H. F. Noller. Cloning,Secondedition,Vol. 1.ColdSpringHarbor 1983. Detailed analysis ofthe higher-order struc- Laboratory Press, Cold Spring Harbor, New York. ture of 16S-like ribosomal ribonucleic acids. Mi- Sanger, F., S. Nicklen, & A. R. Coulsen. 1977. DNA crobiol. Revs., 47:621-669. sequencingwithchain-terminatinginhibitors. Proc. Natl. Acad. Sci. USA, 74:5463-5467. ManuscriptreceivedNovember1990.revisedJuly1991 Simon,C. in press. Molecularsystematicsatthespe-