Logout succeed
Logout succeed. See you again!

Molecular and Cytogenetic Analyses of Stably and Unstably Expressed Transgene Loci in Tobacco PDF
Preview Molecular and Cytogenetic Analyses of Stably and Unstably Expressed Transgene Loci in Tobacco
The Plant Cell, Vol. 9, 1251-1264, August 1997 O 1997 American Society of Plant Physiologists RESEARCH ARTICLE Molecular and Cytogenetic Analyses of Stably and Unstably Expressed Transgene Loci in Tobacco Victor A. Iglesiasyall Eduardo A. Moscone,a12 lstván Papp,a Franz NeuhuberyaS usan Michalowski,b Thomas Phelan,b Steven SpikerybM arjori Matzke,a and Antonius J. M. Matzkeas3 alnstitute of Molecular Biology, Austrian Academy of Sciences, Billrothstrasse 11, A-5020 Salzburg, Austria Department of Genetics, North Carolina State University, Raleigh, North Carolina 27695-7614 To study the influence of genomic context on transgene expression, we have determined the T-DNA structure, flanking DNA sequences, and chromosomal location of four independent transgene loci in tobacco. Two of these loci were sta- bly expressed in the homozygous condition over many generations, whereas the other two loci became unstable after several generations of homozygosity. The stably expressed loci comprised relatively simple T-DNA arrangements that were flanked on at least one side by plant DNA containing AT-rich regions that bind to nuclear matrices in vitro. Of the unstably expressed loci, one consisted of multiple incomplete T-DNA copies, and the second contained a single intact T-DNA; in both cases, however, binary vector sequences were directly contiguous to a right T-DNA border. Fluores- cence in situ hybridiration demonstrated that the two stably expressed inserts were present in the vicinity of telomeres. The two unstably expressed inserts occupied intercalary and paracentromeric locations, respectively. Results on the stability of transgene expression in F, progeny obtained by intercrossing the four lines and the sensitivity of the four transgene loci to inactivation in the presence of an unlinked “ frans-silencing” locus are also presented. The findings are discussed in the context of repetitive DNA sequences and the allotetraploid nature of the tobacco genome. INTRODUCTION The reliable and stable expression of transgenes is a prereq- marily to the genomic context (“position effects”; Peach and uisite for the successful application of gene technology to Velten, 1991) and/or to multiple copies of a transgene con- agriculture. Many investigators, however, have observed struct at a given locus (Linn et al., 1990). The latter effect, significant variability in the expression of the same trans- which has been termed “homology-dependent” (M.A. Matzke gene construct in different transformed lines. Although it is et al., 1994) or “repeat-induced” gene silencing (Assaad et widely assumed that the flanking plant DNA sequences and al., 1993), can also include interactions between two unlinked chromosomal integration site can influence transgene activ- loci in which one transgene locus is capable of trans-inacti- ity, little is actually known about the specific features of vating a second, homologous transgene locus or a homolo- plant DNA and chromosomal location that might be favor- gous endogenous gene (reviewed in Meyer and Saedler, able for the stable expression of transgenes. 1996). In several cases, trans-silencing loci have been asso- During the past several years, transgene silencing has re- ciated with specific arrangements and/or modifications of ceived considerable attention. A variety of silencing effects, transgenes. For example, with certain transgene constructs, which involve either single transgene loci or interactions inverted repeats provoke post-transcriptional silencing of un- between unlinked loci, has been observed. Single loci that linked homologous genes (Hobbs et al., 1993; Van Blokland appear to be stably expressed initially can become progres- et al., 1994; Jorgensen et al., 1996; Stam et al., 1997). Tran- sively silenced over several generations, particularly when scriptional inactivation resulting from promoter homology has maintained in the homozygous state (Kilby et al., 1992; been associated with multicopy transgene inserts that are Neuhuber et al., 1994). Silencing of single loci can be due pri- methylated in the promoter regions (Vaucheret, 1993; A.J.M. Matzke et al., 1994; Park et al., 1996). When analyzing the effects of the immediate genomic envi- ’ Current address: Friedrich Miescher-lnstitut, P.O. Box 2543, CH- ronment on transgene expression, one must also consider 4002 Basel, Switzerland. the potential broader impact of the genome organization of *Permanent address: Instituto Multidisciplinario de Biologia Vegetal the host plant with respect to the chromosomal distribution of (IMBIV), Casilla de Correo 495, 5000 Cbrdoba, Argentina. 3T0 whom correspondence should be addressed. E-mail amatzkeO structural genes, the abundance, diversity, and arrangement oeaw.ac.at; fax 43-662-63961- 29. of repetitive DNA, and the constitution of subgenomes in 1252e hT Plant Cell polyploids. Transgene silencing has been reported for dip- codes resistance to hygromycin, and the second gene (cat) loids (e.g., Arabidopsis, petunia, tomato, ri dcNneai, cotiana encodes chloramphenicol acetyltransferase activity. Both sylvestris), autopolyploids (e.g., potato)d n,a allopolyploids coding sequences were undere ht contro S53 ehtl pfo ro- (e.g., tobacco [N. tabacum] and wheat [Srivastava et al., motf eocra uliflower mosaicH cv oeirnhusTst.r uct also con- 1996]) (reviewen diM .A. Matzkt eea l., 1994; McEldrnoay tae ihnlte etfatd bordea r (i-glucuronidase (gus) coding Brettell, 1994; Pawlowsd knSai omers, 1996). These species sequence ad ajma cS ionep5itnmro3 tam loter (35Spro). all have distinctive genomic attributes that might influence Transgenic plants coe usblS cda rU-ceeGtedivn roiteoyt df the frequency and types of silencing effects that are ob- termine whether general transcriptional enhancers were served. roF example, wherea transgene integrates relative presenn fitl anking plant DMAA .f inal feae tcuhtor feon struct to gene-rich regions or to specific classes of repetitive DMA was an Escherichia coli origin of replication from pBR325 in a particular species could affect its own expression and/ that permitted rescue cloning of the transgene inserts to- or its ability to interact with other transgenes or endogenous gether with some flanking plant DNA. gene ese a fsamhla rm tenhtay meakfb etborde ep reat fam- The t aegcxepn dreenssad s inintopahnh e reithatn fcoe ily. In allopolyploids, integration of transgenes into one or more in four independent transgenic tobacco lines have- ebeden constituent subgenomes could leo astdi lencing effetocnts scribed previously (Neuhuber et al., 1994; Matzke and evident in plants with less complex genomes. The repetitive Matzke, 1996). Although initially these lines had been re- character of many transgene loci that are subject to silencing tained for further analysis because they each appeared to might reflect how natural repeats are treated in a given spe- contaa ins ingle active T-DNA locus, cultivatir oosfne veral cies; that is, the degree to which multiple copies of trans- generationss a homozygotes revealed differencese ht nsi ta- genesr o transgene loci comprising repeated elementsera bility of expression of the hpt and cat genes. In two lines, H9 tolerated or modified (e.g., by methylation) could depend on and H83, stable expression of both genes was observed in the extent to which endogenous repeats had accumulated sexo ueatil g pphurt os greeolfnefy dl lgae nneir adtinoans and become modified in the genome of the host plant. plants regenerated from single cells of leaves. Moreover, the To encompass all of the aforementioned aspects, analy- sf oteras nsgene expression should ince lduhedttee rmina- ti )o1t(r nfoa nsgene copy numbd enaar rrangemeenht )t2(, nucleotide sequence and repetitive nature of flanking plant e hcth )r3o(Dm dMnoaAs, omal location (inclu-dlain ngi, B B K KE lopolyploe idhsstu, bgenomic alloce ahinttito efong) rated transgene. Although progresss ah been maden i assessing Gl'S KAN(b) OR1 H\C CAT e hitnfluencef ot hese parameters individue ahetl nxlyop res- sion of different transgene inserts, an integrated study incor- poratinf ot gllha emo t compare genetically well-characterized Left Border HVG CAT Right Border transgenic lines has not been published. H9 Hll H59 H8J H9 Hll H59 H83 H9 Hll H59 H8J H9 Hll H59 H83 Here,e w present results from such na analysis with four transgenic tobacco lines that containe eshdta me construct integrated into distinct chromosomal locations but that ex- hibited difference ehts snit abilitf yo transgene expression. e hlie nthte rftsao, n sogwetInn e is nasswte-axrbt ely presse ehht dnoi mozygous conditior onmf any generations, whereae hto sni ther two, marked instabilityf o expression was displayed after several generations of homozygosity. Resultse raa lso presented no stabilityf o transgene expres- sion in F! progeny of intercrosses among the four lines and on the susceptibility of each transgene locus to inactivation Figure 1. H Construct Map and T-DNA Border Analysis. in the presence of a frans-silencing locus. The H construct consists of a T-DNA left border (LB); a (3-glucu- ronidase (GUS) coding sequence under the control of 35Spro; a bacterial selection marker (KAN[b a]b) ;acterial of rirogeipn lication (ORI); genes encoding resistanco eht ygromycin (HYd Gcnah) loram- RESULTS phenicol acetyltransferase activity (CAT), both eucanohd nfteto rro l 35S promoter (hatched region); a split nopaline synthase gene (unla- beled white ba oTx d-eDnsaN); A right border (RB). T-DNA border Transgenic Lines analysis was performed using EcoRV (V) and EcoRI (E), which cut in e hTt -DNA (the second sites weren i plant flanking DNA). InternaGYHl The H transgene construct used in this study (Figure 1) T fisrAaCgm dennats were detecy tuebsd ing rBoKa pm)BnHl( I(K), composed of two chimeric marker genes: one gene (hpt) en- respectively. Probes are indicated by the dark bars above the map. Genomic Context and Transgene Expression 1253 H9 and H83 parental plants and their progeny contained de- Stable tectable GUS activity in leaves (data not shown). In contrast, the expression of the bpt and cat genes in the MARjA‘V (AV9 T-DNA other two lines, H11 and H59, became progressively unsta- H9 LW ’/’ 3163bp I’ 457 bp ble after severa1 generations of homozygosity. In addition, the H59 parental plant and its progeny were GUS-negative (H11 did not have an intact gus gene). The nature of the unstable expression differed in the two lines. When homozygous (HH), line H59 behaved as if it had an epigenotype of HH* (i.e., one Unstable active [H] and one inactive [H*] allele). The H* allele was transmitted sexually and was semidominant to the H allele. Consequently, strong hygromycin resistance was obtained most frequently in backcrosses to untransformed tobacco when the two “epialleles” segregated away from each other. The homozygous H11 line initially produced 100% hygro- pa,.t. T-DNA bin.vert. --’ T-DNA bin.vect. Pul. T-DNA H11 = - mycin-resistant progeny, which subsequently turned yellow ZW bp and died 6 to 8 weeks after germination on selection me- Figure 2. T-DNA Structure and Features of Plant Flanking DNA. dium. Regeneration from single cells of leaves yielded plants that had one of three possible epigenotypes, HH, HW, and T-DNA sequences are indicated by heavy black lines. Left and right H*H*, suggesting that leaves developed over time into epi- T-DNA borders are denoted as black and white arrowheads, respec- genetic mosaics (Neuhuber et al., 1994; Matzke and Matzke, tively. Plant DNA is represented as white bars and binary vector se- quences as black bars. Matrix attachment regions (MARs) and AT 1996). The demise of seedlings after 6 to 8 weeks on hygro- microsatellites are hatched. The retroelement remnant @o/ region) is mycin-containing medium was presumably the result of a crosshatched. For lhe Hll,n onoverlapping rescue (left) and h (right) preponderance of HW and WW epigenotypes. In contrast clones were obtained; these could not be fully pieced together (thin to the H59 lhe, the inactive H* allele in the H11 line was not dashed line), and the exact relationship to the T-DNA and binary transmitted sexually; that is, the W allele was only recovered vector sequence in the rescue clone could not be determined (wavy from regenerated plants in which it was then meiotically her- verticle line). The drawing is basically to scale (1 cm = 1.2 kb); diag- itable for at least two generations. The meiotic heritability of onal lines indicate regions that have been truncated. If known, the the silenced W alleles and the increased promoter methyla- size in base pairs of the plant DNA or binary vector fragments is tion of the bpt gene are consistent with transcriptional si- shown below the bars (except for the H83 right region, in which lencing (Neuhuber et al., 1994; Matzke and Matzke, 1996). sizes of interspersed fragments are provided in the text). The extent of left plant DNA in the rescue clone (a in H7 7) could not be deter- mined accurately (dashed bar). The EMBL accession numbers for the ,459 left flanking DNA and H83 right flanking DNA, including the po/ region, are 412534 and 412536, respectively. bin. vect., binary T-DNA Structure and Sequences of T-DNA-Plant DNA vector; part., partial. Junctions and Flanking DNA Although the initial genetic analysis indicated that each of H9 the four lines contained a single active transgene locus, a T-DNA border analysis revealed one to three more or less The simplest T-DNA structure was observed with the stably complete copies of the T-DNA construct at each locus. The expressed line H9, which contained (as predicted from the copy number did not correlate with stability of expression: border analysis) a single copy of the H construct bounded the two stably expressed lines, H9 and H83, appeared to by nearly complete left (-4 bp) and right (-2 bp) T-DNA contain one and two copies, respectively; the unstably ex- border sequences (Figure 3). This relatively normal configu- pressed line H11 appeared to have three left border frag- ration was slightly complicated by a partial duplication (20 ments and one right border fragment; the unstable line H59 bp) of right border sequences adjacent to the left T-DNA had a single left and a single right border fragment (Figure 1, border. Contained within this 20 bp was 6 bp of sequence left and right border probes). All four loci contained intact homologous to plant DNA at the target site (AGTTTA) (Fig- coding sequences for the bpt and cat genes; only the unsta- ures 3 and 4). Flanking plant DNA sequences of -3.16 kb to bly expressed H77 locus contained an additional larger the left and -460 bp to the right of the T-DNA were recov- HYG-hybridizing sequence that deviated from the expected ered (Figure 4). No extensive similarity was found with any size (Figure 1, HYG and CAT probes). known sequences. Severa1 AT-rich regions were present in Rescue cloning was used to recover the T-DNA inserts the left flanking plant DNA: two microsatellites, (AT)29 and and varying amounts of flanking DNA. The results from DNA (AT),3, and -640 bp of an AT-rich region that bÒund to to- sequence analysis and restriction enzyme mapping of these bacco nuclear matrices in vitro (Figure 5). Because the H9 clones are summarized in Figure 2. insert was relatively simple, it was possible to use primers 1254 The Plant Cell Theoretical T-DNA Left Border: TGG*C AGGATAT ATTGTGGTGTRAACRRATTGACGCTTAGACA ACTT - H9: CTTGGT~AGTTTPJAACTATCAGTGTTTAATATATTGTGGTGT~C~TTGACGCTTAGACAACTT - (right border) H83 :, CCGGCTAGTTGTGTAAAGATCCCTTTACTTTTCTCCACTGACGTAC~TTGACGCTTAGACAACTT left border #I O C A T G T T C A G G 4 T O T X G G G A G T ~ T G AGCCATCGCAUXTGTGCCTCGCCCAGGAGT~TGGXGAG~ ~AKAGACATTMTCGACATCI'l'ATATCAAATGTTAlTlTlT TGCARU\TGTAGTATCMTCGTAGTlTTCAUACATTTCTKATAM Theoretical T-DNA Right Border: TTTGACTGmTTACGATATITrT~TGTTATTG~AC~TA mAGTATCAAATGTCA~ATARCATTTAATA~~WAT TTTCCCGCCTT&F&ACTATCAGTGTTTGA*CTTATTGATGTAACAT~GATATTCAAATATTOGTaGjTACATGmGGAGCGTATAAmA A TM~TCGTTATTATl'ACCACATTI?CITATCAAATGTCA CA'2TTAGTATCARATGTCOTARTGlTl'~GTATCAAATGTCG -H9: TAGTAmACGACA~ATTCATAAATGACATWULTTTCATAT AGATTTATTTCAAATGCGaZGTATCOXCMTTK CTATCAGTGTTTaaactgaagTTTGATTCGGCCACGAACTTTTACCTG TTGGTAGTGGGTTGGACGGGAGGTCATGAA"ICTACTACMXTTTGCA 9 bp filler TCTTOCATGUULATGlTGGAT~TGATGTl'~~GATC~~TTG O R T T T G A R G A C G T ~ G T A ~ C ~ T ~ ~ ~ G T l ' C A ~ T A G C C G l T l ' A l C T ~ C X A T G A T G -H83: T A ~ A T A T T A G T T A M ~ M A T ~ ~ C A ~ m G T A C T R C W \ A T C C T T G ~ T A T ~ ~ ~ A T T A T TTTCCCGCCTTCAGTTTATATcAGTGTTatt~at~acacgtattaccgcctttgagt C A T T T C m T C G G A T A G " T T G A C TNLTCTGACGGGTT~TTATGT~T~GACTAGGTGATlTT~TC gctacagtgttattgtcaatttgtttatcagtgtaaagtgataaaCAAATTGACGCTTAGACAACTT O T A R C A T T A A T C C C T A A T A ~ ~ ~ T T I4 bp filler left border #Z AGGATAAGAGGTOAAARRAWICACrPGAGROCCPACCA ACRRTT~TCCATCTCPUC~TACTATATAGTTA~~ Figure 3. Nucleotide Sequences of Plant DNA-T-DNA Junctions. CRTCCCCCGCrrGTl'AT~ATAT~T~T~~TTAR CT~TMTCTAATAAGAAATCTGAAARAOTAO Theoretical left and right T-DNA borders based on the VirD2 nicking AGGARRlTATCTTTRUjATATAATlTCCCACRCOATO AGGAAAATCTATCCCCCMT~ACTCTAGAMT~CG site (arrows) (Tinland and Hohn, 1995) are shown. T-DNA sequences u I C T m G A T T T C C w ~ - ~ ~ T are underlined. Plant DNA sequences are not underlined. Filler DNAs TT~TATTACOAROATTTbROTATATAMTAGATCTAATGATG GGA~TGTTGTATATAAGATl'GCCTAGAAGTTGlTW&3Cm of unknown origin are shown in lowercase letters. Right border se- CTGTAGA~TACCCC~~TATATAGA-A-TZLGA quences found to the left of the H9 left border are shown in italics. T G C I T C T - T T - T A WLARARCACATCCA-TTmmTTT The boxed regions show the short region of homology found be- ~ T ~ T T ~ C C T G T T ~ - T A M T A T T A ~ A T T ~ T A tween.the T-DNA right border and plant DNA at the H9 insertion site A T A C A T A T A T A T T A ~ A T A T A T - ~ ~ A ~ ~ ~ ACATTAWGCCGAkXCTlTClQCl'GTCAG&%CGGACGTAGC (Figure 4). CATATAGGTGCGGGTTCGG-TXAWNXTTlTl'GTTTZAACATTAT A m R T A C G G T ~ T A T T T M ~ ~ CCGTAACFRRGRCGATCTATGGGlTCCGATGCAAA~CATAAA homologous to the left and right flanking plant DNA to clone a j T A A T G A G ~ ~ - T T G T A T l ' m G T G A AMGTCATACAGTTGATGGTl'~CAGCPTCTATTTcAT~~ the target site from untransformed tobacco. A comparison ATGATAGGCAAGTTTTACCTAGTGCACAGCCMATGCACCCAAGGGATTG TCARCCGACGT~GTCT~CTA~AG~GATAATAT of the target site sequence with the sequence of the T-DNA- TTTAMMMAT GTATATATACPATATATARTGGAT~GFCPT plant DNA junctions revealed that 32 bp of plant DNA had ~ T ~ t t c t t u t l t t ~ t ~ ~ t - t t ~ t ~ T I T T G A T T C ~ ~ ~ A ~ ~ T T A ~ T T C A T C C A T A T C A A T been deleted upon T-DNA integration; a 9-bp filler DNA se- CAATGATGTGACAGAllTGTAAGAGTTAAGATAAC~TCCAAAC A T A T A T A ~ T C ~ ~ G T G l C ~ M T quence was interposed between the right T-DNA border and ATCAAACl'CCARCCTAACITCCTPIUiPITCPlTPGACA plant DNA, and no filler sequence was found between the A T C A l T l T A G T T A T C G G C G A G T G O T A R C C C G C C A A G A G C ~ ~ fused left-right border and plant DNA (Figures 3 and 4). TTCCGAAGAGACAGCATTAAGGGGl'GAGlGCGAQTATAC A T G A T A T A C T C P G A T C ~ T T ~ ~ G T ~ TACTCTPCGRGARGCCTAGG H83 Figure 4. Tobacco DNA Sequence at the H9 Target Site. The stably expressed H83 lhe, which had two left and two The arrowhead adjacent to the boxed region indicates the site where right border fragments, according to the DNA gel blots, was the H9 T-DNA integrated into the tobacco genome. resulting in a found to contain one intact copy of the H construct together 32-bp deletion of plant DNA (lowercase letters). The boxed region shows the short region of homology between plant DNA and the with a largely truncated second copy and three borderless T-DNA right border sequence (Figure 3). AT-rich regions are indi- fragments from the T-DNA or binary vector that were inter- cated by white letters on a black background: these include two AT spersed with putative plant DNA (Figure 2). The intact copy microsatellites and an -640-bp Munl-EcoRV fragment (CAATTG of the H construct was bounded by partia1 T-DNA border se- and GATATC recognition sequences are underlined) that binds to quences: the first left border lacked 20 bp relative to theo- tobacco nuclear matrices in vitro (Figure 5). The EMBL accession retical sequence, and the right border lacked 3 bp (Figure 3). number of the H9 target site is Y12535. Genomic Context and Transgene Expression 1255 To the right of the intact T-DNA copy was 74 bp of filler DNA H9 MAR H83 MAR of unknown origin, followa s eyebdc ond left T-DNA border (also mis safwso saiu n,pbn g02d wite hhft irst left border) I PS T PS a Tdna-DNA sequence extending onp bl i0y6n1 sutg oeht coding sequence, which then broke off and led into a 24-bp DNA fragmentf o unknown origif on pbb 41,8i nary vecto-res quence, 492 bp of (presumably) plant DNA, and 30 bp of the 2.9kb 35Spro plus 96 bp of the gus coding sequence (Figure 2 and data not shown). These fragments of the H construct, which I 2.2kb wt oeanrses ociated with T-DNA borders, were followyebd I 1.411 bp ~3f o u.b2kn interrupted plant DNAs A.s hownn i Figure,6 this sequence containa s putative open reading frame that encodes a polypeptide with significant amino acid similarity einhtetg roaste regf isooen veral retroelements. Figure 5. Nuclear Matrix Binding Assays. In addition to the —3.2 kb of plant DNA to the right of the T indicates total end-labeled fragments derived from rescue clones entire complex T-DNA insert, ~7.4 kb of plant DNA to the 3 c8loHoc ndint aa( 9idnHoi enuhgtb ly digested with Munl-EcoRV left was sequenced. Figure 7 shows an —1.8-kb flanking se- and Xbal-Hindlll, respectively; see Methods) before incubating with quence directly ae dThja-tDc eoNntA t left border; -tehsis tobacco nuclear matrices. After incubation and centrifugation, spe- quence contains three AT-rich regions. Two restriction cific fragments of ~640 bp (H9) and 2.2 and 2.9 kb (H83) partition enzyme fragments (2.2 and 2.9 kb) comprising these regions more completely with the matrix preparation in the pellet (P) (arrow- bound ott obacco nuclear matricen siv itro (Figur. )eE5 xten- heads), identifying these fragmentss a MARs. Their positions relative sive similarity to known sequences was not found in left e ht otrespective T-DNAse ra shownn i Figur-es ANeD eht ni dna 2 flanking DNA. quences shon wFiing7 (uH , r4 d8Sse(3uHsn )p .9ae) rnatant con- Although several different primers were tested,e ht T-DNA taining unbound fragments. target site in the H83 line could not be recovered from un- transformed tobacco. Ts hpaiwos so spt ieobusldyt integra- tion scrambf olminug ltiple T-DNA d canospsaioecs iated plant DNA, as suggested by the presence of borderless vector sequences directly contiguous with a standard right T-DNA fragments to the right of the intact copy. T-DNA border sequence (Figure 2). Extensive flanking plant t ono sabw AtNaDinedn ie ithee hrrt escue clonX ce rol one, although 685 bp of putative plant DNA that was present be- H59 tween the binary vector sequence to the left and pBR325 (i.e., T-DNA) sequences to the right (Figure 2, H17-b) was re- As expected fre obhmot rder analye suhisnt, s9 tal5inbHele covered and sequenced; noteworthy features were absent contained a single intact copy of T-DNA. Although the left (dat toans hownn )Au. nambigous sequence froe mhlte ft border (shortened by 32 bp from the expected sequence; flanking plant DNA (Figure 2, H11-a) could not be obtained Figure 3) was fused to plant DNA (681 bp of which were re- we Tihtht- DNA primers tested, presumably bec-aesu sfoe covered and sequenced; data not shown), the right T-DNA quence duplications elsewhere in the clone. border led directly into binary vector sequences (of which ^18p 0wb0 ere pre erhsete snnciut e clone) (eFhiTg u.)r2e e hptl oelat AfnNtD,t which consistedf o previously unre- T-DNA Chromosomal Location, Subgenomic Allocation, ported sequences, comprised two microsatellites: (AAAG) and Species Specif fFioclaitny kAingN PDlan t 5 and (AAT) (Figure 2). We have not yet been able to obtain a 12 rescue clone of this locus that contains plant DNA to the right. To characterize fue rgthheetnr omic envir eofohnumt rfeon t transgene loci, we examined two aspects. First, fluorescent d gnaenomn isic itu hybridization (FISH/GISH) were useodt H11 establish, respectively, the chromosomal location of the transgene s istniu sdbengart enomic allocat. iNtoa(nb acum As suggested by the border analysis, the second unstable [tobacca o nsi] atural allotet] 8rd4a =ep xr4li o=v nie2d[d line (H11) harbora ecdo mplex transgene locus that com- ] 4p2ro o gf=rdweoin pmtni lt2oo. Nis[rdsy :lvesStr[is prist ealed ast three truncated T-DNA copies -(lFAig .u)r2e genome] and N. tomentosiformis, N. otophora, or N. to- thoe urnegoshX c c luoeneno ec ldcononane taining partial mentosa, all of which are very closely related [T genome]; T-DNA copies were recovered from this linee ww, ere unable Okamuro and Goldberg, 1985; Parokonny and Kenton, 1995). o tpiece togethe ehctr omplete stru 11lcHot ceuhutr sfeo . Second, to investigate the possible repetitiveness and spe- Two of the three truncated T-DNAs were adjacent to binary cies specificit ehyt ffo lanking planA NstD equencese ,ht res- vector sequences, althou nge iohnc noalys e were these cue clones containing left and right flanking sequences were 1256 The Plant Cell 1 60 61 120 a . b . c E d P YA PIANK 12 1 158 a b C d Figure 6. Comparison of Deduced Amino Acid Sequences of the Putative Retroelement pol Region in Plant DNA Flanking Two T-DNA Inserts. Sequence a is right flanking plant DNA of H83 (H83R),n ucleotides 1 to 400; sequence b is flanking plant DNA of a K locus, nucleotides 3456 to 3926 (Papp et al., 1996; EMBL accession number 271319). The most significant similarity was found to sequence c, the upstream region of the tobacco defense-related pseudogene 246N1 (Froissard et al., 1994; PIR protein database accession number S47444). These sequences are also highly homologous to the integrase region of the Pol polyprotein of a number of different retrotransposons equences, the most similar being the Osvaldo retrotransposon and Tn472, both from Drosophila. Tn472 is shown in sequence d (Swiss-Prot accession number P10394). Se- quences a to c are not highly homologous to tobacco retrotransposon Tntl. ldentical amino acid residues are shown as white letters on a black bac kgr oun d. used as probes on blots containing DNA isolated from to- present in an intercalary region of the long arm of a subtelo- bacco, N. sylvestris, and N. tomentosiformis. centric chromosome from the S subgenome, S1 l/t2 (Figure As shown in Figure 8, many of the flanking plant DNA re- 9, H59, and Figure 10). The H59 insert was thus flanked on gions produced hybridization patterns characteristic of dis- the left by “species-incompatible” moderately repetitive plant persed, moderately repetitive sequences, that is, smears DNA (in this study, we define a T subgenome-enriched repeat occasionally overlaid by some bands. With respect to spe- that is present on an ancestral N. sylvestris chromosome as cies specificity of the dispersed repeats, severa1 variations species incompatible) and directly contiguous binary vector were observed. When a rescue clone containing -500 bp of sequences on the right (these produced weak hybridization left flanking DNA from the stably expressed H9 locus was signals on the plant DNA blots; Figure 8, H59R). used as a probe, comparable signals were observed in all One of the few examples from the four lines of flanking three species (Figure 8, H9L).W hen a second rescue clone plant DNA that appeared to be of relatively low copy number containing an additional 2.6 kb of plant DNA to the left and was in the left flanking region of the stably expressed H83 -460 bp to the right of the H9 insert was used as a probe, locus (Figure 8, H83L).T he plant DNA to the right of the H83 signals of similar intensity were again observed in all three insert was moderately repetitive. Although a signal was ob- species, although this probe also hybridized with a tandem served in all three species, two bands were enriched in the repeat (ladderlike pattern) that was enriched in the S subge- N. tomentosiformis genome (Figure 8, H83R).T his DNA gel nome but not found in any of our H9 rescue clone se- blot pattern was virtually identical to that obtained with the quences (Figure 8, H9R +L). FISH/GISH demonstrated that plant DNA adjacent to a T-DNA insert analyzed in a separate the H9 locus is near the long arm telomere of a subtelocen- study (Papp et al., 1996; I. Papp and A.J.M. Matzke, unpub- tric chromosome from the T subgenome, T3 (Figure 9, H9, lished results) and was almost certainly due to the retroele- and Figure 1O ). Moderately repetitive dispersed DNA that ment remnant present in both flanking DNA sequences was common to all three species (“species mixed”) thus ap- (Figure 6), which otherwise shared no additional similarity peared to surround the H9 locus; some copies of this se- over -2 kb. The FISH/GISH analysis localized the H83 insert quence were apparently connected to a tandemly repeated in the vicinity of a telomere on a small metacentric chromo- region that was present primarily in the S subgenome. some from the T subgenome, T9/t3 (Figure 9, H83,a nd Fig- A different pattern was observed with H59. Unlike the ure 1O ). The stably expressed H83 insert was thus adjacent species-mixed dispersed repeats that surrounded the stable to a “species-compatible” repeat (this term is used here to H9 locus, the 681 bp of left flanking plant DNA of the unsta- refer to a T subgenome-enriched sequence that is present bly expressed H59 locus hybridized with moderately repeti- on a chromosome from the T subgenome). tive dispersed sequences that were enriched in the N. The unstably expressed locus H7 7 was present in a para- tomentosiformis subgenome (Figure 8, H59L). The FISH/ centromeric location on a small metacentric or submetacen- GlSH analysis, however, indicated that the H59 locus was tric chromosome from the T subgenome (Figure 9, H77). Genomic Context and Transgene Expression 1257 Because this c fhothr oeremn-eooo t ssf oreaomhwmte N. torn. X. tab. X. syl. N. torn. N. tab. N. syl. bacco (cultivar SR1) karyotype that containo eandd ditional MM H B MH H B M B HB M H B M H B markers for identification (Moscone et al., 1996), we could t oanscer2 t(1aFT iirngo u,8wrTe h,5 eT1 Ats0hNaw)De. tri gel blots were probed with the rescue clone (H11-a) and the X. clone (H17-b) (Figure. )2 Both probes produceda species- mixed pattern, with H11-a e ampbpoed aeo-rriaenttge rly petitive and H11-b of relatively low copy number (Figure 8). Intercrosses To determine whethee rhut nstable loci (H11d nHa 59) could influence the expression of the stably expressed loci (H9 d nHa8d 3nwa) hethee hsrt tably expressed loci wou-ledr main so when combined in a single genome, intercrosses betw lleafoeun r homozygous lines weIFre dmnaade , AATTAGTAAAAGAAGAATTTACCTAAATAGTCGCTCATTTAGTA iGAGCTGGCAGATGTATAATATATGTAAAATTCATATATAAAATGAGTATA IAAGAAGGCAAAAATATATAAAGACCCCATTAAACTTGTTCGAAGTGAATT AAATGCTACCCTAAAGGCTTATATGAAAGAAAAGGAAAAAAAAAAAAAAA |AGAGCGTAAAATTTTTTAAAAAATGGGCCCGCTGATAATATGTAATAAAA 'TAAAAATAAAAAATAAAATTGGGCTCCTCTCATTTTTTT/ --•-••--•-•--• TOCCTICTTTCTCCTTCTICTAACCCCCCrCCCCCCCTCTATTCOCCCAO ^VlCTTTTTTC TTTTTTTCTTTCTCGCCATCTGCCTCATCTTCTTTCTTTTTCTT- ....... TCAGTCCCAACATATTAA.GAACATGATAATGAAATTTTCTTTGTTCU ' AATTAAGAAATTAATATAGCATCTTTTCGTATTTTCTCTGTTGCGGT'ln., TTAAATAAGAAAAAATCATAGTGGATGTTGAAGATTGAAATAAAAAATT.a AAAATAATTAATATGATAAGATAACGAAACAAAAAAAGAGGAGAGTAAAC CAAGATCGAAGGGATTTAAATTTGTAGGATATACGGATGAGAATTCGATG AAAAAATATAATTAAGAGGAATTTATTAATTAATTAGAGATTTATTAGTG TATTAAATAAAGAGCAAGGAAAAAAATATGATAGACAAAAAAGAAACGAA "UIGGT TAAAAAAAT TAAAATT TAP1 "™=™= OTGCTQATATOGCTCTGATATGOCAATOATOTOOCOCGTGTOTAAAaCAC ATCACATTGTGAGGTTGOTATTATGTGTTAGGGTAGCATTTAATTCACTC CaAACAAGAATAOOOGTAAAAGACACCCGTT TAATTAAOAOTTTAAACCT ATTTTTTGAACAAGTTTAATGOGGTCTTTATGTATTTTGCCTGTAGAQAC Figure 8. Gel Blot Analysis of DNA Flanking the T-DNA Inserts. GGATCCCAGOACTTTTATAAGGTTCAAATAAGTTCCCAACATGACTGTTG TAGTCACAGTCATTTCATGGGAGCTAOTAGTTACACATAAGAGAAOOOaO Each blot contains three lA aisnNoelasD tee dafoc fhr . otNomm en- QAAAAOOCAAGT3TGCAATTGAATATTTOAAACATGTCGT TTATGATTOA CGTACAACGGAOTTTTTAAATGATTTTTAAATGATCAAQATGATOCAAAT tosifor. mNto(irsn .N.t)a, ba. cNs .uNyt amdl(vb ne.as). N, stry(isl .). QATATQTATATAATTAGCGIATAATTTAIATTAATTTTCTAGAAOQTCAA DNA preparations were digested with BamHI (B) alone or with BamHI ATOAAOCTATOTGOOCOGOCCTQATTAAAOT TTTCATTTCATGAATAACC plus Hpall (H) or Mspl (M) to test for possible methylation. The TATACAAATTTCACTAATTATTTTCACTCTAAACCAAATTOTCAAAATOC AATCTATTOCTACCTTAATTTCATTTTAOTTOAAATTOGATATACTTTCA probes used are shown in the lower lefthand corner of each blot; L CTTTCATTATTTATATAACCGTGTCCAAATCAAATQACACCQCATG'TOGC R d dnaenote led fnatr ight flanking DNA, respectivele hyti fno, di- TAAAAACTCATAAGTTCTTTTTTCATCATTTACTTTTGAAAAATTAACCC AAAATGTTGCTCACCTAACCGCTTAAACTAAAAATAGCCGGTGGAGGTAT cated T-DNA inse Lrct9o (nHFsi f gi.s~ou)t52sr p ed0 bi0r- edcatly AATATATACATAATTAATGTATTATATATGTATAATTGTGTATAATCAAT e lehfjta tT co-eDntN tA border;L cHo 9+nRt ains this region npluas AIATAAACTATGTATATAGCTAGAAAAAGTAAATAATCAAIATGGCCGGC eht fo pabd d7e itl5eihof4ttn a ffldola nn~ kba2ink .A5g NplDan t TAGTTGTGTAAAGATCCCTTTACTTTTCTCCACTGACG * cttagacaacttutaacacattgcggacgtttttutgtaetgacggtc right flanking DNA (i.e., the entire H9 target site; Figure 4). The posi- gac tions of H7 7-a and H11-b relative to the T-DNA copies at the H11 lo- e rsa suhcownn i Figure. 2 Arrowsn i H83R indicate bands enriched Figure 7. Nucleotide Sequence of the H83 MAR. in the N. tomentosiformis fraction of the genome; these arise from a This fragment of plant DNA, which is directly adjacent to the H83 left retroelement pol remnant, because a virtually identical pattern was T-DNA border (white arrowhead, third line from bottom; see also seen when the probe was either flanking DNA isolated by Papp et al. Figure 2) contains three AT-rich (>75%) regions (white letters on (1996) or a tobacco repeat isolated by Kuhrova et al. (1991) —both of black backgrounde Xh)T. bal site use ehmt ndia trix binding assasyi which also col nospt aeehiqntu ence (Figd nAuar. 6eJ .M. Matzke, underlined (12 lines from bottom); Hindlll sites also used in the assay unpublished results). This retroelement remnant is present in ~1000 are farther upsd d tdTrnoen-Dawa-ameNn srAAt ,reNn apDmila n t cor pehiepasp loid tobacco genome (Kuhrot veaa l., 1991). Based spectively (data not shown). An Xbal-Hindlll double digest of the on similar hybridization intensities with comparably labeled flanking 3 r8eHscue clone b gthekan 2te r.ba2ot uedndnd fara 9gm.2e fnots plant DNA probes, we estimate that the other repeats shown here to tobacco nuclear matrices in vitro (Figure 5). T-DNA right border are also present in ~1000 copies per haploid tobacco genome. sequencn eil eorsaw ercase lettere shET. MBL accession numberorf theH83MARisY12533. ePhlTa1n2t5 C8 ell Fig. u9FreI SH/GIf SoSHo matic Chromosomf oTers ansform. ) NtC8e HaCda4b e oraer nhyc=v hsiutPnctt mrgenn u ti2cit t (H 1aRvaSna Homozygous Condition. Orange-red fluorescent spots indicate hybridization to the biotin-labeled H construct probe specific for the transgene insert, and green fluores- cence indicates hybridization to the digoxigenin-labeled genomic DNA probes of N. sylvestris (S subgenome) (H9 and H83 plants) or N. otophora (T subgenome) (H11 and H59 plants). Unlabeled chromatin, which does not fluoresce, appears brown. Arrows indicate the location of the trans- gene insert. Cross-hybridization of the N. sylvestris or N. otophora genomic probes to T3 (in H9) or S11/12 (in H59) nucleolus organizing regions, respectivels ysi, howy abnr rowheads. Green segmet nointnsd ice cahhtt enrodi mosomes carrye inthrgat nsgene inserts S1/19n /THti(2 d 5n9a) t3 (in H83) are intergenomic translocations (Figure 10). Bar = 10 |xm. Genomic Context and Transgene Expression 1259 seeds were sown on medium containing increasing concen- In contrast, although the unstably expressed loci (H59 and trations of hygromycin. Although some weakening of the H77) were found to contain either a single intact copy or stable loci in the presence of one of the unstable loci was multiple truncated copies of the H construct, respectively, observed in F, progeny, this silencing was not dramatic; F, both comprised binary vector sequences that were directly progeny from these intercrosses were still moderately resis- contiguous with a right T-DNA border. In addition, both in- tant to hygromycin. When hybrid lines were selfed, the si- serts occupied chromosomal sites that were distant from lencing was slightly enhanced (presumably in seedlings the ends of chromosome arms (intercalary in the case of homozygous for the transgene loci); however, complete si- H59 and paracentromeric in the case of H77). Finally, the lencing of H9 and H83 in the presence of either H7 7 or H59 GUS-negative phenotype of line H59 indicated the absence was never observed. Progeny of H9 x H83 crosses contin- of enhancer elements in lefl flanking plant DNA, which was of ued to stably express the hpt gene, as indicated by the undi- a species-incompatiblem oderately repetitive type (Table 1). minished strength of hygromycin resistance of F, seedlings (data not shown). T-DNA Copy Number and Configuration Crosses to the 271 Silencing Locus Previous studies have established that single copies of transgenes tend to be more stably expressed than are multi- The four H loci were also tested for activity in the presence copy or scrambled inserts (Meyer and Saedler, 1996). Al- of the multipurpose silencing locus 277. This locus is able to though our data generally support these former results, transcriptionally inactivate genes under the control of the factors other than T-DNA copy number are clearly involved. 35s and 19s promoters of cauliflower mosaic virus as well The unstable expression of the single T-DNA copy in the as silence endogenous nitrite reductase genes of tobacco H59 line might have resulted from several features of the ge- via a post-transcriptional process (Vaucheret, 1993; Park et nomic context: flanking sequences that could be considered al., 1996). It has previously been localized to the long arm foreign (contiguous binary vector to the right and a species- telomere of a tobacco chromosome from the T subgenome, incompatible repeat to the left) and the intercalary chromo- T3 (Moscone et al., 1996; Figure 10). The poor hygromycin soma1 location, which was distant from the gene-rich ends of resistance conferred by the 35Spro-hpt gene at the two un- chromosome arms (see below). The stable expression of the stable loci, H7 1 and H59, was further weakened in the pres- H83 insert, despite the presence of several T-DNA and binary ente of 277 in newly germinated F, seedlings. In contrast, the H9 and H83 loci displayed reductions in hpt gene activ- ity only after 6 to 8 weeks, manifested by mottling and yel- lowing of F, seedlings, which eventually died if maintained further on hygromycin-containing medium (data not shown). DlSCUSSlON SI S2/tl S3 S4 S5 S6 S7 S8 59 SI0 SIM2 SI2 To study the influence of genomic context on transgene ex- pression, we have determined the T-DNA structure, se- quence of flanking plant DNA, and chromosomal integration site of four independent transgene loci in tobacco. Although similar analyses on additional transgenic lines are required TI T2 T3 T4 T5 T6 T7 T8 T9/t3 TI0 Tll/t4 T12 before we can draw solid conclusions, the data obtained Figure 10. Summary of T-DNA lnserts Localized to Specific N. thus far provide a remarkably consistent picture. As summa- tabacum Chromosomes by FISH/GISH. rized in Table 1, the two stably expressed transgene loci (H9 and H83) contained one intact copy of the T-DNA construct Black and white areas indicate S and T subgenomes, respectively. with no contiguous binary vector sequences and were Four intergenomic translocations are present (S2/tl, S1 l/t2, T9/t3, present in the vicinity of telomeres. They were also flanked and T11/t4). Dotted regions show rDNA loci (S10, S11/t2, S12, and T3), two of them active in nucleolus formation (S10 and T3). Trans- on at least one side by plant DNA that (1) could act as a gene inserts localized so far by FISH/GISH include the four H loci transcriptional enhancer (as indicated by a GUS-positive described in this article (H9, H17, H59, and H83), the 277 trans- phenotype), (2) contained long (-0.5- to 1-kb) AT-rich re- silencing locus (Moscone et al., 1996), and a K locus (Papp et al., gions that behaved as matrix atttachment regions (MARs) in 1996). H11 could be on T5, T8, or T12 (indicated by Hll?), which vitro, and (3) was either of low copy or related to species- are the only three N. tabacum (cv Petit Havana SR1) chromosomes compatible or species-mixed moderately repetitive dispersed that do not have a distinctive morphology or other physical marker sequences. (Moscone et al., 1996). 1260 The Plant Cell Table 1. Genomic Context of Stably and Unstably Expressed H Loci Chromosomal Location Flanking Plant DNAa DNA Motifsb HYG-CAT T-DNA COPY Binary GUS Line Expression Number Chrom. NO.^ Position Left Right Left Right VectorC Expressiond + H9 Stable 1 T3 Telomeric Mod-rep Mod-rep MAR, None - mixed mixed (AT)13, (AT29 + H11 Unstable 2 or 3 T5, T8, Paracentromeric Mod-rep ? ? ? No intact fragments or T12 mixed gus gene + H59 Unstable 1 SI l/t2 lntercalary Mod-rep BV (WG),, ? - T on S (AA-012 chromosome + H83 Stable 1 intact T9/t3 Telomeric Low copy Mod-rep MAR pol region - (+fragments) TonT chromosome a Mixed refers to a moderately repetitive (mod-rep) sequence that is present in comparable amounts in both the S and T subgenomes of N. tabacum. A species-incompatible repeat as defined in this article refers to a copy of a T-enriched repeat present on a chromosome from the S subgenome (e.g., H59); a species-compatible repeat refers to a copy of a T-enriched repeat on a chromosome from the T subgenome (e.g., H83). BV, binary vector sequences; ?, not known. MAR, matrix attachment region; ?, presence of motifs not known because flanking plant DNA was not recovered in rescue clones; pol region, retroelement remnant. CThep lus and minus signs refer, respectively, to the presence or absence of binary vector sequences that are contiguous with a right T-DNA border (see also Figure 2). dA plus sign indicates that a plant and its progeny contained GUS activity in leaves; a minus sign indicates no GUS activity. eChromosome numbers refer to those from the T and S subgenomes, as indicated in the karyotypic diagram of N. tabacum chromosomes shown in Figure 1O . vector fragments, was presumably due to the single intact they affect the expression of adjacent transgenes. A recent T-DNA copy that was flanked by relatively complete border cloning and sequencing study revealed T-DNA inserts that sequences leading directly on both sides into plant DNA. led continuously from the right border into a complete copy The sequences of T-DNA-plant DNA junction fragments of the binary vector (Van der Graaff et al., 1996). and the target site sequence from line H9 confirm features of T-DNA fine structure that have been obtained from previ- ous studies of T-DNA integration events (reviewed in Koncz Chromosomal Location et al., 1994; Tinland, 1996). The right T-DNA borders were better conserved (compared with the theoretical expectation The stably active inserts H9 and H83 were found adjacent to based on the VirD2 nicking site) than were the left ones telomeres. T-DNA might preferentially integrate close to telo- (Tinland and Hohn,1995). In line H9, the 6 bp of homologous meres, as other recent FlSH studies have suggested (Wang et sequence between plant DNA directly at the site of insertion al., 1995; ten Hoopen et al., 1996). The dista1 ends of chromo- and a short region outside of the left T-DNA border (consist- some arms contain high concentrations of genes in wheat (Gil1 ing, in this case, of right T-DNA border sequences that were et al., 1993), maize (Bernardi, 1995), and humans (Saccone et fused to the left border) is consistent with the short patches al., 1992). Although a (sub)telomeric location of stably ex- of plant DNA and T-DNA homology (7 to 14 bp) found for a pressed transgene loci might seem inconsistent with previous number of other T-DNA integration events (Matsumoto et data showing that methylated trans-silencing loci were pres- al., 1990; Ohba et al., 1995; Tinland, 1996). ent at chromosome ends (A.J.M. Matzke et al., 1994; Park et The presence of binary vector (non-T-DNA) sequences di- al., 1996), a distinction must be made between cytogenetic rectly contiguous with a right T-DNA border was found in and molecular resolution. The H9 and H83 loci were obvi- both of the unstably expressed lines H11 and H59. Binary ously not integrated into telomeres, as indicated by the ab- vector sequences appear to be transferred relatively fre- sence of recognizable telomeric repeats in the flanking plant quently into plant genomes, at least as assessed by DNA gel DNA. In contrast, a preliminary analysis of plant DNA in a blot experiments (Martineau et al., 1994; Ramanathan and cosmid clone comprising the H2 trans-silencing locus (Park Veluthambi, 1995; Cluster et al., 1996). These previous stud- et al., 1996) has revealed the presence of a high-copy-num- ies have not addressed whether these binary vector se- ber tandemly repeated sequence (J. Jakowitsch, I. Papp, quences are actually continuous with 1-DNA or whether and A.J.M. Matzke, unpublished results). Such tandem ar-