Logout succeed
Logout succeed. See you again!

Molecular cloning of mouse amino acid transport system B0, a neutral amino acid transporter ... PDF
Preview Molecular cloning of mouse amino acid transport system B0, a neutral amino acid transporter ...
JBC Papers in Press. Published on March 25, 2004 as Manuscript M400904200 Molecular cloning of mouse amino acid transport system B0, a neutral amino acid transporter related to Hartnup disorder Angelika Bröer*, Karin Klingel†, Sonja Kowalczuk*, John E.J. Rasko‡, Juleen Cavanaugh§ and Stefan Bröer* *School of Biochemistry & Molecular Biology, Australian National University, Canberra, ACT 0200, Australia D o w n † Department of Molecular Pathology, University of Tübingen, 72076 Tübingen, Germany lo a d e d ‡Gene Therapy Research, Centenary Institute of Cancer Medicine and Cell Biology, fro m h ttp University of Sydney and Sydney Cancer Centre, Royal Prince Alfred Hospital ://w w w § Medical Genetics Research Unit, The Canberra Hospital, Woden ACT 2607, Australia .jb c .org b/ y g u e s t o n Running title: Molecular cloning of system B0 A p ril 6 , 2 0 1 9 Corresponding author: Dr. Stefan Bröer Division of Biochemistry & Molecular Biology Faculty of Science Tel.: +61-2-6249-2540 Australian National University Fax.: +61-2-6249-0313 Canberra, ACT 0200, Australia e-mail.: [email protected] Key words: amino acid transport, Hartnup disorder, system NBB, Neurotransmitter transporter family 1 Copyright 2004 by The American Society for Biochemistry and Molecular Biology, Inc. Summary Resorption of amino acids in kidney and intestine is mediated by transporters, which prefer groups of amino acids with similar physico-chemical properties. It is generally assumed that most neutral amino acids are transported across the apical membrane of epithelial cells by system B0. Here we have characterised a novel member of the Na+-dependent neurotransmitter transporter family (B0AT1) isolated from mouse kidney, which shows all properties of system B0. Flux experiments showed that the transporter is Na+-dependent, electrogenic and actively transports most neutral amino acids but not anionic or cationic D amino acids. Superfusion of mB0AT1 expressing oocytes with neutral amino acids generated ow n lo a d inward currents, which were proportional to the fluxes observed with labelled amino acids. In ed fro m situ hybridisation showed strong expression in intestinal microvilli and in the proximal tubule http ://w of the kidney. Expression of mouse B0AT1 was restricted to kidney, intestine and skin. It is w w .jb c generally assumed that mutations of the system B0 transporter underlie autosomal recessive .org b/ y Hartnup disorder. In support of this notion mB0AT1 is located on mouse chromosome 13 in a gu e s t o n region syntenic to human chromosome 5p15, the locus of Hartnup disorder. Thus the human A p ril 6 homologue of this transporter is an excellent functional and positional candidate for Hartnup , 2 0 1 9 disorder. 2 Introduction Epithelial resorption of amino acids across the apical membrane in the kidney and intestine is thought to be carried out by four different transporters (1). Anionic amino acids are taken up by a Na+-dependent aspartate/glutamate transporter, which has been designated system X- . AG Molecular cloning has identified this transporter as EAAT3 (2). Cationic amino acids are taken up by system b0,+; the molecular correlate of this transporter being the heteromeric amino acid transporter rBAT/b0,+AT (3). Proline and glycine are thought to be transported by the IMINO system (4) and it has recently been proposed that the molecular correlate of this D o transporter may be the proton-dependent amino acid transporter PAT1 (5). Most neutral w n lo a d amino acids are thought to be transported by system B0, which has not yet been identified at ed fro m the molecular level (6,7). System B0 has been characterized in jejunal brush border vesicles http ://w (8-10), bovine epithelial cells (11) and Caco-2 cells (12). These studies suggest that system B0 w w .jb c is a Na+-dependent, chloride independent transporter that accepts a wide variety of neutral .org b/ y g amino acids. Failures to resorb amino acids in the kidney and intestine underlie a number of u e s t o n inherited transporter diseases, with mutations in either rBAT or b0,+AT causing cystinuria A p ril 6 (13), mutations of the IMINO system believed to cause iminoglycinuria (14) and mutations of , 2 0 1 9 system B0 thought to cause Hartnup disorder (15). Hartnup disorder [MIM 234500] is an autosomal recessive disorder resulting from impaired neutral amino acid transport, largely limited to the kidneys and the small intestine. Its diagnostic hallmark is a striking neutral hyperaminoaciduria (15,16). A number of additional symptoms have been reported in Hartnup disorder patients, including photosensitive skin rash, ataxia and psychotic behaviour (15,16). Nevertheless, many of those affected remain asymptomatic despite the hyperaminoaciduria. This variation in manifestations of Hartnup disorder may be a consequence of compensation for the reduced 3 amino acid transport by increased peptide transport in the intestine or the presence of genetic or environmental modifiers, such as dietary variations. Despite its apparently mild phenotype, Hartnup disorder has been a model disease, because it illustrates the principles of amino acid resorption in epithelial cells. Homozygosity mapping in consanguineous families has recently localized the disorder to Chromosome 5p15 (17). Here we describe the cloning and characterization of a neutral amino acid transporter from mouse kidney, which belongs to the family of Na+ and Cl- dependent neurotransmitter transporters, has all the functional hallmarks of system B0, and is expressed mainly in kidney D o and intestine. Its human homologue is found on chromosome 5p15. It is suggested that the w n lo a d human homologue of this gene is an excellent candidate for Hartnup disorder. ed fro m http ://w w w .jb c .o rg b/ y g u e s t o n A p ril 6 , 2 0 1 9 4 Materials and Methods cDNA cloning and plasmids Total RNA was isolated from mouse kidney by the acid-guanidinium-thiocyanate- phenol-chloroform extraction method of Chomczynski and Sacchi (18). For cloning of mouse B0AT1, 0.5 µg oligo(dT) was added to 1.5 µg kidney RNA in a total volume of 4.5 µl. The 15 mixture was incubated for 10 min at 65°C and then chilled on ice. Reverse transcription was carried out in a buffer designed to improve the temperature stability of reverse transcriptase (19). The reaction was assembled by adding the following components to the RNA mixture: 2 D o µl 0.1 M DTT, 1 µl dNTPs (each 10 mM), 0.5 µl 40 x reverse transcriptase buffer, 30 U w n lo a d e RNaseout (Invitrogen, Mulgrave, VIC, Australia), 10 µl 1.8 M trehalose, 2 µl 100% glycerol. d fro m h The mixture (20 µl) was then incubated at 42°C for 2 min. For cDNA synthesis 200 U of ttp ://w w Superscript II-RT (Invitrogen, Mulgrave, VIC, Australia) was added followed by incubation w .jb c .o at 55°C for one hour. The cDNA was purified by using a PCR-product purification kit rg b/ y g u (Qiagen, Clifton Hill, VIC, Australia). For PCR a proofreading polymerase was used (Pfu e s t o n A polymerase, Promega, Madison, Wisconsin, USA). The coding sequence was amplified p ril 6 , 2 during 30 PCR cycles with the temperature profile 94°C 30 sec, 55°C 60 sec and 72°C 12 min 0 1 9 using the sense primer 5’ GAC ACA ACC ACT TGC CCT TT and the antisense primer 5’ GTC CTG CAT CTT GCT TCC TC. The final 11 base pairs of the sense primer correspond to bases 1-11 of the mouse cDNA clone XM_127449 (Riken cDNA 4632401C08). The antisense primer corresponds to bases 2005-2024 of the same cDNA clone. The amplified PCR product was purified by agarose gel electrophoresis and the 2033 bp fragment isolated using a gel elution kit (Qiagen, Clifton Hill, VIC, Australia). The isolated PCR fragment was initially cloned using the Zero Blunt TOPO PCR cloning kit (Invitrogen, Mulgrave, VIC, Australia). The mouse B0AT1 sequence was determined by BigDye Terminator v3.1 Cycle Sequencing using conditions recommended by the manufacturer (Applied Biosystems Foster 5 City, CA, USA) and a ABI 3730 capillary genetic analyser (Biomolecular Resource Facility, Australian National University). Its sequence is deposited as AJ633679 in the EMBL database. For expression studies, mouse B0AT1 was excised with HindIII-XbaI and inserted into the same sites of the oocyte expression vector pGEM-He-Juel. (20). Oocytes and injections Oocyte isolation and management have been described in detail elsewhere (21). For expression in oocytes mouse B0AT1 in pGem-He-Juel was linearised with SalI and transcribed in vitro using the T7 mMessage mMachine Kit (Ambion, Austin Texas, USA). D Oocytes were injected with 20 ng of cRNA encoding mouse B0AT. Transport measurements ow n lo a d were carried out after 3-6 days of expression. ed fro m http ://w Flux measurements w w .jb c For each determination, groups of 7-10 cRNA or non-injected oocytes were washed .org b/ y g twice with 4 ml ND96 (96 mM NaCl, 2 mM KCl, 1.8 mM CaCl , 1 mM MgCl , 5 mM N-[2- u 2 2 e s t o n Hydroxyethyl]piperazine-N’-[2-ethanesulfonic acid] (HEPES); titrated with NaOH to pH 7.4 A p ril 6 unless indicated otherwise) before incubation at room temperature in a 5 ml polypropylene , 2 0 1 9 tube containing 70 µl of the same buffer supplemented with [14C] labelled amino acids and different amounts of unlabeled substrate. Transport was stopped after different time intervals by washing oocytes three times with 4 ml ice-cold ND96 buffer. Single oocytes were placed into scintillation vials and lysed by addition of 200 µl 10% SDS. After lysis, 3 ml scintillation fluid was added, and the radioactivity determined by liquid scintillation counting. In Na+-free incubation buffer NaCl was replaced by NMDG-Cl or LiCl. To determine the dependence of transport activity on the Na+ concentration NaCl-ND96 (pH 7.4) was mixed with NMDG-Cl- ND96 (pH 7.4, NaCl replaced by NMDG-Cl) in different proportions. Different pH values were adjusted by mixing MES-buffered ND96 (5 mM HEPES replaced by 5 mM 6 Morpholinoethanesulfonic acid) with Tris-buffered ND96 (5 mM HEPES replaced by 5 mM Tris-base). Uptake of [14C]phenylalanine or [14C]leucine increased linearly with time for up to 20 min. As a result, uptake was determined using an incubation period of 15 min. To determine substrate specificity the following compounds were used (all Amersham Pharmacia Biotech, Castle Hill, Australia): [U-14C]phenylalanine, [U-14C]glutamine, [U-14C]alanine, [U- 14C]leucine, [U-14C]glycine, [U-14C]arginine, [U-14C]glutamate, [U-14C]histidine, [U- 14C]proline and [U-14C]isoleucine. For competition experiments uptake of 100 µM labeled amino acid was challenged with an excess of 20 mM unlabelled amino acid. D o Electrophysiological recordings w n lo a d Amino acid induced currents were analysed by two-electrode voltage clamp recording. ed fro m The recordings were performed with 1 x LU and 10 x MGU headstages connected to a http ://w Geneclamp 500B electronic amplifier (Axon Instruments, Union City, CA, USA). The output w w .jb c signal was amplified ten times and filtered at 50 Hz. The analog signal was converted into .org b/ y g digital figures by a Digidata 1322A (Axon Instruments, Union City, CA, USA) and data were u e s t o n sampled at 3Hz using pCLAMP software (Axon Instruments, Union City, CA, USA). Oocytes A p ril 6 were chosen that had a membrane potential of more negative than -30 mV. Once a stable , 2 0 1 9 membrane potential was reached under current clamp conditions, the amplifier was switched to voltage clamp mode holding the oocytes at -50 mV. Oocytes were superfused with ND96 solution with or without saturating amounts of amino acids (5 mM). A complete change of the bath to a new solution was accomplished in about 10 sec. RT-PCR Total RNA was isolated from male adult NRMI mouse tissues by the acid-guanidinium- thiocyanate-phenol-chloroform extraction method of Chomczynski and Sacchi (18). For reverse transcription 0.5 µg oligo(dT) was added to 2 µg total RNA in a total volume of 12 15 7 µl. The mixture was incubated for 10 min at 65°C and then chilled on ice. DTT, dNTPs, 5 x reverse transcriptase buffer and 30 U RNasin (Promega, Madison, Wi; USA) were added and the whole mixture (20µl) was incubated at 42°C for 2 min. For cDNA synthesis 200 U of Superscript II-RT (Invitrogen, Mulgrave, VIC, Australia) was added followed by incubation at 42°C for one hour. A standard PCR protocol with 100 pmol of each primer and a 2µl aliquot of the purified cDNA was used for amplification of the fragments during 40 cycles (95°C 30 sec; 55°C 1 min; 72°C, 1 min) in a Thermocycler using Taq-polymerase (Qiagen, Clifton Hill, VIC, Australia). After amplification the samples were analysed by agarose gel electrophoresis. The mB0AT1 specific fragment was amplified with sense primer: 5’ D o CTTCATGGTGGGCCTGTACT (corresponding to positions 428-447 of XM_127449) and w n lo a d antisense primer: 5’ GTCCTGCATCTTGCTTCCTC (corresponding to positions 2005-2025 ed fro m of XM_127449). To determine the identity of the amplified fragment it was cloned into the http ://w pCR-XL-TOPO vector and its sequence was determined (Biomolecular Resource Facility, w w .jb c Australian National University). From both kidney and intestine, six clones were isolated and .org b/ y g all sequences were found to be identical to that of XM_127449. A 1kb actin cDNA fragment u e s t o n was amplified during 30 cycles as a control using the sense primer 5’ GCT CAC CAT GGA A p ril 6 TGA TGA TAT CGC 3’ and the antisense primer 5’ GGA GGA GCA ATG ATC TTG ATC , 2 0 1 9 TTC 3’. In situ hybridization Tissue specimens of kidney, liver, lung, pancreas, small intestine, skeletal muscle, lymph nodes and brain from C57BL/6, SWR/J and DBA1/J mice were fixed in 4% paraformaldehyde /0.1 M sodium phosphate buffer (pH 7.2) for 4 hours and embedded in paraffin. Five µm tissue sections were dewaxed and hybridized as previously described (22). Hybridization probes were generated by in vitro transcription of mB0AT1 cDNA cloned into pCR-blunt II-TOPO using SP6 polymerase (antisense) and T7 polymerase (sense). The hybridization mixture (10 mM Tris HCl, 8 pH 7.4, 50% (vol/vol) deionized formamide, 600 mM NaCl, 1 mM EDTA, 0.02% polyvinylpyrrolidone, 0.02% Ficoll, 0.05% bovine serum albumin, 10% dextrane sulfate, 10 mM dithiothreitol, 200 µg/ml denatured sonicated salmon sperm DNA, 100 µg/ml rabbit liver tRNA) contained either the 35S-labeled RNA antisense or sense control mB0AT1 probe at a concentration of 500 ng/ml. Hybridization with RNA probes proceeded at 42ºC for 18 hr. Following washing steps, the slide preparations were dipped in NTB2 emulsion (Kodak, Rochester, NY) and exposed at 4°C for 3 weeks. After development the slides were stained with hematoxylin/eosin and photographed with a Sony DSC digital camera. D o Calculations, statistics and computer analysis w n lo a d Each datapoint or bar in figures and tables represents the mean ± SD activity of m = 7-10 ed fro m mB0AT1 expressing oocytes minus the mean ± SD activity of m = 7-10 non-injected oocytes. http ://w Kinetic constants were derived by non-linear curve fitting of the means to the corresponding w w .jb c equation using Origin7.0 software (OriginLab corporation, Northampton, MA, USA). To .org b/ y g determine K and V the Michaelis-Menten equation v = (V * S/(K + S)) was used. The u m max max m e s t o n cotransport stochiometry was determined by using a linear form of the Hill equation: A p ril 6 log(v/(V -v)) = n * log [S] + log K . The number “n” of independent experiments is , 2 max m 0 1 9 indicated in the figure legends. Throughout the manuscript we show representative figures from one of these experiments. Sequence alignments and the tree were calculated using programs of GCG and PHYLIP packages supplied by the Australian National Genomic Information Service (ANGIS). Sequence alignment was performed using ClustalW (23). Subsequently, protein distance was calculated by using the Dayhoff PAM matrix (24) and converted into a tree diagram using an additive tree model. The peptide sequence of mB0AT1 was analysed by hydropathy plotting using the TMHMM 2.0 program (http://www.cbs.dtu.dk/services/TMHMM-2.0) and the TMpred program (http://www.ch.embnet.org/software/TMPRED_form.html). The structural plot was 9 computed using the transmembrane protein display software (http://www.sacs.ucsf.edu/TOPO/topo.html). Results Cloning of mouse B0AT1 Hydrophobicity analysis of predicted open reading frames on human chromosome region 5p15 in the NCBI human genome database and the ENSEMBL database revealed the presence of only a limited number of proteins with more than 5 hydrophobic putatively D o w membrane spanning domains (data not shown). Some of these had already been annotated as n lo a d e transporter genes, such as the dopamine transporter (SLC6A3), the Na+/H+ exchanger NHE-3 d fro m h (SLC9A3) and the potassium-chloride cotransporter KCC4 (SLC12A7). These are well ttp ://w w characterised transporters and were unlikely to mediate or affect neutral amino acid transport w.jb c .o and were not considered valid candidates. Two additional proteins with multiple hydrophobic brg/ y g u domains were identified in this region. One of these is XT2, an orphan member of the SLC6 es t o n A family, which does not appear to have a transport activity (25,26). The second lies distal to pril 6 , 2 XT2 on chromosome 5p15, is a close homologue of XT2 and has recently been annotated 01 9 (NCBI accession No. XM_291120). BLAST searches revealed that the mouse homologue of this transporter (94% similarity on the amino acid level) is a cDNA deposited under the accession number XM_127449 in the NCBI database. Because of its functional properties, which will be described below, we named the mouse cDNA mB0AT1. There were no differences between the coding sequence of mB0AT1 obtained by us and the coding sequence of XM_127449 in the NCBI database. The genomic localisation of mouse B0AT1 is on chromosome 13 in cytoband C1. This region is syntenic to human chromosome 5p15. The transcript is deposited as ENSMUST00000022048 in the EMBL database (or as locus 10