loading

Logout succeed

Logout succeed. See you again!

ebook img

Molecular detection of Rickettsia bellii in Ixodes loricatus (Acari: Ixodidae) ticks associated with rodents from Buenos Aires province, Argentina PDF

release year2020
file size0.87 MB

Preview Molecular detection of Rickettsia bellii in Ixodes loricatus (Acari: Ixodidae) ticks associated with rodents from Buenos Aires province, Argentina

Nota Note www.biotaxa.org/RSEA. ISSN 1851-7471 (online) Revista de la Sociedad Entomológica Argentina 79(4): 51-55, 2020 Molecular detection of Rickettsia bellii in Ixodes loricatus (Acari: Ixodidae) ticks associated with rodents from Buenos Aires province, Argentina MELIS, Mauricio E.1,*, SEBASTIAN, Patrick S.2, BALCAZAR, Darío E.1, LARESCHI, Marcela1 & NAVA, Santiago2 1 Centro de Estudios Parasitológicos y de Vectores (CEPAVE) (CONICET-UNLP). La Plata, Argentina. *E-mail: [email protected] 2 Instituto Nacional de Tecnología Agropecuaria, Estación Experimental Agropecuaria Rafaela. Consejo Nacional de Investigaciones Científicas y Técnicas. Rafaela, Santa Fe, Argentina. Received 24 - VI - 2020 | Accepted 28 - X - 2020 | Published 28 - XII - 2020 https://doi.org/10.25085/rsea.790409 Detección molecular deRickettsia belliien garrapatasIxodes loricatus(Acari: Ixodidae) asociadas a roedores de la provincia de Buenos Aires, Argentina RESUMEN. El objetivo de este estudio fue detectar Rickettsiaen garrapatas de roedores sigmodontinos del Noreste de la provincia de Buenos Aires, Argentina. Se capturaron 222 roedorescolectando10garrapatasidentificadascomoIxodesloricatusNeumann,lascuales fueronanalizadasporlastécnicasdePCRreal-timeyPCRconvencional.SedetectóADNde RickettsiabelliienninfasdeobtenidasdelosroedoresAkodonazaraeFischer,Oxymycterus rufusFischer yDeltamyskempiThomas. Este es el primer reporte deR.belliiinfectandoI. loricatusenArgentinayelprimerreportedeestabacteriaasociadaagarrapatasderoedores sigmodontinos. PALABRAS CLAVE.Cricetidae.Ixodida.PCR.Vectores. ABSTRACT. The aim of this study was the detection of Rickettsiain ticks of sigmodontine rodents from Northeastern Buenos Aires province, Argentina. A total of 222 rodents were capturedcollecting10ticksidentifiedasIxodesloricatusNeumann,whichwereanalysedby thereal-timePCRandconventionalPCRtechniques.DNAofRickettsiabelliiwasdetectedin nymphs obtained from the rodentsAkodonazaraeFischer,OxymycterusrufusFischer and DeltamyskempiThomas. This is the first report ofR.belliiinfectingI.loricatusin Argentina and the first report of this bacterium associated with ticks of sigmodontine rodents. KEYWORDS.Cricetidae.Ixodida.PCR.Vectors. Ticks (Acari: Ixodidae) are hematophagous with worldwide distribution which includes zoonotic arthropods,parasitesofvertebrateswithmorethan920 speciesusuallytransmittedbyarthropodvectors(Parola valid species worldwide, 52 of them reported from et al., 2013). In Argentina, clinical cases of rickettsial Argentina (Guglielmone et al.,2014, 2015; Nava et al., diseases have been reported in different provinces, 2017; Saracho-Bottero et al., 2021). Ticks have including Buenos Aires (Romer et al., 2020). relevance as parasites themselves and as vectors of Sigmodontinerodents(Cricetidae)arecommonhosts zoonoticdiseases(Jongejan&Uilenberg,2004).These of immature stages of ticks (Beldoménico et al., 2005). arthropods can acquire pathogenic agents by feeding These mammals are widely distributed in Argentina blood of infected animals or by transstadial and inhabiting almost all habitat types, and some species transovarial transmission. The pathogenic agents are reservoirs zoonotic agents, such as rickettsias include Rickettsia, a group of gram-negative bacteria (Meerburg et al., 2009; Patton et al., 2015). Moreover, Copyright MELIS, M.E. et al.- This is an open access article distributed under the terms of the Creative Commons Attribution Licence (CC BY 4.0) 51 Revista de la Sociedad Entomológica Argentina 79(4): 51-55, 2020 some of the ectoparasites associated with fragments were purified using a commercial kit (Wizard® sigmodontines, such as ticks, are involved in the SV Gel and PCR Clean-Up System, Promega) and enzootic cycle of these bacteria. Because of the sequenced in ABI 3130XL Genetic Analyser (INTA proximity of the habitats of sigmodontine with humans, Castelar, Buenos Aires, Argentina). Obtained partial these rodents are important from an epidemiological sequences were edited using BioEdit software (Hall, perspective (Meerburg et al., 2009; Guglielmone et al., 1999) with manual edition whenever it was necessary, 2014). aligned with the program Clustal W (Thompson et al., Herein, we analyze the presence of Rickettsia in ticks 1994) and compared with sequences deposited in parasitic of sigmodontine rodents in two areas of GenBank™ by using BLAST tools (https:// northeastern Buenos Aires province, Argentina, where blast.ncbi.nlm.nih.gov/Blast.cgi) Phylogenetic analyses cases of rickettsiosis were reported but the vector were performed with Maximum-likelihood (ML) method remains unknown. by using the program Mega 5 (Tamura et al., 2011). Best Samplings were carried out between 2017 and 2018 fitting substitution models were determined with the throughout nine collection campaigns in two localities Akaike Information Criterion using the ML model test with different degrees of anthropization situated in La implemented in MEGA 5 (Substitution models were T92 Pampa biogeographic province (Morrone, 2006). One of (G+I). Support for the topologies was tested by these (Arana) is mostly rural, located in the suburbs of La bootstrapping over 1,000 replications and excluding Plata (35º00’S, 57º54’W), with a surface of five hectares gaps. mostly composed of pasturelands (five sampling Rodents were identified by Ulyses Pardiñas (IDEAus, campaigns). The other location (La Balandra) is situated CONICET) and Carlos Galliari (CEPAVE) and will be on the margin of Río de la Plata, in the city of Berisso deposited at the Colección de Mamíferos del Centro (34º56'S, 57º42'W) and it is characterized by forested Nacional Patagónico, Puerto Madryn, Chubut, Argentina. wetlands intercalated with coastal strips emerging from The 222 rodents were determined as Oxymycterus water (four sampling campaigns). The sampling effort rufus Fischer (n = 70), Akodon azarae Fischer (n = 66), was 80 traps per night placed in a distance of five meters Oligoryzomys flavescens (Waterhouse) (n = 35), one from each other for 24 hours. Rodents were captured Scapteromys aquaticus Thomas (n = 33); Oligoryzomys alive by using Sherman-like traps baited with oat. nigripes Olfers (n = 15) and Deltamys kempi Thomas (n = A total of 222 rodents were captured, and ticks were 3) (Cricetidae, Sigmodontinae). A total of ten ticks (nine collected from their furs in the field and preserved in nymphs and one larva) were collected and determined ethanol 96%. At the laboratory ticks were identified under as Ixodes loricatus Neumann. Ticks collected on each stereoscopic binocular microscope by using the host species and localities are shown in table I. taxonomic keys and morphological descriptions Out of these ten specimens of I. loricatus screened in presented in Nava et al. (2017). Afterwards, for molecular real-time PCR, three nymphs showed amplification for studies, ticks were processed individually. Tick genomic the gltA gene. These samples were also positive in the DNA was extracted with phenol-chloroform conventional PCR showing amplicons of the expected method, as described in Mangold et al. (1998). Tick sizes for the gltA gene. No amplification was observed in DNA samples were tested for the presence of rickettsial the ompA and ompB PCR tests of these three ticks. citrate synthase (gltA) gene (primers CS5: The three positive gltA samples were obtained from GAGAGAAAATTATATCCAAATGTTGAT and CS6: three I. loricatus nymphs collected each one on D. AGGGTCTTCGTGCATTTCTT) by real-time PCR as kempi, O. rufus and A. azarae, respectively. Sequences described by Labruna et al. (2004) and Guedes et al. of gltA were deposited in the GenBank™ (Accession (2005). Positive samples were further analysed by a numbers: MT407574; MT407575 & MT407576 battery of conventional PCR methods targeting a 834 bp respectively). These sequences matched with more than fragment of gltA gene (primers CS-239: 99% of similarity with gltA sequences available in CTCTTCTCATCCTATGGCTATTAT and CS-1069: GenBank™ of R. bellii. The phylogenetic tree CAGGGTCTTCGTGCATTTCTT) (Labruna et al., 2004), constructed with the sequences obtained in this work a 512 bp fragment of outer membrane protein A (Fig. 1) clearly shows that they are grouped with R. (ompA) gene (primers Rr190.70p: bellii (Accession numbers KX137900, CP000087, ATGGCGAATATTTCTCCAAAA and Rr190.602n: LAOI100001, CP015010) and separated from other AGTGCAGCATTCGCTCCCCCT) (Regnery et al., 1991) rickettsial groups. and a 862 bp fragment of outer membrane protein B The present study evaluates the rickettsial infection (ompB) gene (primers 120-M59: in I. loricatus ticks collected on sigmodontine rodents CCGCAGGGTTGGTAACTGC and 120-807: in the northeastern region of Buenos Aires province. CCTTTTAGATTACCGCCTAA) (Roux & Raoult, 2000). In Ixodes loricatus is distributed in areas of Argentina, all PCR methods, DNA of R. parkeri sensu stricto from Brazil, Paraguay and Uruguay belonging to the Pampa, Brazil was used as positive control. Positive PCR Chaco and Parana forest biogeographic provinces 52 MELIS, M.E. et al. Rickettsia bellii in Ixodes loricatus Fig. 1. Maximum-likelihood tree constructed from gltA partial sequences for different Rickettsia species. Partial sequences generated in this study are written in bold letters. Numbers represent bootstrap support generated from 1,000 replications. GenBank™ accession numbers are given in brackets. Table I. Ixodes loricatus ticks collected with their prevalence values (%) followed by number of parasitized hosts / number of hosts examined between parentheses in every host species, and number of ticks collected per locality 53 Revista de la Sociedad Entomológica Argentina 79(4): 51-55, 2020 sensu Morrone (2006), with adults usually Guglielmone,A.A.,Robbins,R.G.,Apanaskevich,D.A.,Petney, found in marsupials (Didelphidae) and their immature T.N.,Estrada-Peña,A.,&Horak,I.G.(2014)TheHardTicks stages in sigmodontine rodents (Cricetidae) of the World (Acari: Ixodida: Ixodidae). Springer, The Netherlands. and also in marsupials (Didelphidae) (Nava et al., 2017). In this work, I. loricatus was the Guglielmone, A.A., Sánchez, M.E., Franco, L.G., Nava, S., only tick species collected, which is in accordance Rueda, L.M., & Robbins, R.G. (2015) Nombres de Especies de Garrapatas Duras (Acari: Ixodidae: Ixodidae). with the literature that indicates that this specie is Available at: http://rafaela.inta.gob.ar/nombresgarrapatas/ the most prevalent in sigmodontine rodents from Last accession May 25, 2020. Buenos Aires (Beldoménico et al., 2005). Even Hall, T.A. (1999) BioEdit: A User-Friendly Biological Sequence though a small number of ticks was collected and AlignmentEditorandAnalysisProgramforWindows95/98/ tested (n = 10), 30% of them were positive for NT.Nucleic Acids Symposium Series,4411, 95-98. R. bellii suggesting a high prevalence of this Jongejan,F.,&Uilenberg,G.(2004)Theglobalimportanceof bacterium in I. loricatus from the study area. ticks.Parasitology,112299((11)), S3-S14. According to previous reports, R. bellii was only Krawczak, F.S., Labruna, M.B., Hecht, J.A., Paddock, C.D., isolated in ticks and it is widely distributed in America & Karpathy, S.E. (2018) Genotypic Characterization of as resumed by Krawczak et al. (2018). In Argentina, R. Rickettsia bellii Reveals Distinct Lineages in the United StatesandSouthAmerica.BioMedResearchInternational, bellii was detected in free living ticks of Amblyomma 22001188, 8505483. sculptum Berlese, A. ovale Koch, A. neumanni Ribaga, Labruna, M.B., Whitworth, T., Horta, M.C., Bouyer, D.H., A. tigrinum Koch, Haemaphysalis juxtakochi Cooley and McBride,J.W.,Pintér,A.,Popov,V.,Gennari,S.M.,&Walker, A. dubitatum Neumann collected on Hydrochoerus D.H. (2004) Rickettsia Species Infecting Amblyomma hydrochaeris L. (Caviidae) (Nava et al., 2017; Sebastian cooperiTicksfromanAreaintheStateofSaoPaulo,Brazil, et al., 2017). Where Brazilian Spotted Fever Is Endemic. Journal of This is the first report of R. bellii infecting I. loricatus Clinical Microbiology,4422((11)), 90-98. in Argentina and the first isolation of this bacterium in Mangold, A.J., Bargues, M.D., & Mas-Coma, S. (1998) Mitochondrial 16S rDNA sequences and phylogenetic ticks associated with sigmodontine rodents. relationships of species of Rhipicephalus and other tick Nevertheless, additional research is required to genera among Metastriata (Acari: Ixodidae). Parasitology determine the role of these mammals and their Research,8844((66)), 478-484. ectoparasites in the enzootic cycle of R. bellii. Until the Meerburg, B.G., Singleton, G.R., & Kijlstra, A. (2009) Rodent- epidemiological relevance of this species is fully borne diseases and their risks for public health. Critical clarified, the importance of its isolation should not be Reviews in Microbiology,3355((33)), 221-270. underestimated. Morrone,J.J.(2006)BiogeographicAreasAndTransitionZones Of Latin America And The Caribbean Islands Based On Panbiogeographic And Cladistic Analyses Of The ACKNOWLEDGMENTS Entomofauna. Annual Review of Entomology, 5511((11)), Authors thank Luis Giambelluca, Ekaterina 467-494. Savchenko and Carlos Galliari (CEPAVE) for their Nava, S., Venzal, J.M., González-Acuña, D., Martins, T.F., & contribution to the fieldwork; to C. Galliari and Ulyses Guglielmone, A.A. (2017) Ticksofthesouthernconeof America. Elsevier, Academic Press, London, United Pardiñas (IDEAus, CONICET, Argentina) for the Kingdom. identification of the rodents. We also thank the Parola, P., Paddock, C.D., Socolovschi, C., Labruna, M.B., Ministerio de Agroindustria (Buenos Aires province) for Mediannikov,O.,Kernif,T.,Abdad,M.Y.,Stenos,J.,Bitam, the permission to collect rodents (Authorization 66/17). I.,etal.(2013)UpdateonTick-BorneRickettsiosesaround This work was supported by the Agencia Nacional de the World: a Geographic Approach. ClinicalMicrobiology Promoción Científica y Tecnológica (PICT 2015-1564), Reviews,2266((44)), 657-702. Universidad Nacional de La Plata, Argentina (N854) Patton, J.L., Pardiñas, U.F.J., & D’Elia, G. (2015)Mammalsof (both granted to M. Lareschi) and CONICET (PUE SouthAmerica.Rodents.Vol.2.UniversityofChicagoPress, 22920160100036CO). Chicago, Illinois, United States. Regnery,R.L.,Spruill,C.L.,&Plikaytis,B.D.(1991)Genotypic identification of rickettsiae and estimation of intraspecies LITERATURE CITED sequence divergence for portions of two rickettsial genes. Journal of Bacteriology,117733((55)), 1576-1589. Beldoménico, P.M., Lareschi, M., Nava, S., Mangold, A.J., & Romer, Y., Borrás, P., Govedic, F., Nava, S., Carranza, J.I., Guglielmone,A.A.(2005)Theparasitismofimmaturestages Santini,S.,Armitano,R.,&Lloveras,S.(2020)Clinicaland of Ixodes loricatus (Acari: Ixodidae) on wild rodents in epidemiological comparison of Rickettsia parkeri Argentina. ExperimentalandAppliedAcarology, 3366((11--22)), rickettsiosis,relatedtoAmblyommatristeandAmblyomma 139-148. tigrinum,inArgentina.TicksandTick-borneDiseases,1111((44)), 101436. Guedes, E., Leite, R.C., Prata, M.C., Pacheco, R.C., Walker, D.H., & Labruna, M.B. (2005) Detection of Rickettsia Roux,V.,&Raoult,D.(2000)Phylogeneticanalysisofmembers rickettsii in the tick Amblyomma cajennense in a new ofthegenusRickettsiausingthegeneencodingtheouter- Brazilian spotted fever-endemic area in the state of Minas membrane protein rOmpB (ompB).InternationalJournalof Gerais. Memórias do Instituto Oswaldo Cruz, 110000((88)), Systematic and Evolutionary Microbiology, 5500((44)), 841-845. 1449-1455. 54 MELIS, M.E. et al. Rickettsia bellii in Ixodes loricatus Saracho-Bottero, M.N., Beati, L., Venzal, J.M., Guardia, L., Tamura,K.,Peterson,D.,Peterson,N.,Stecher,G.,Nei,M.,& Thompson,C.S.,Mangold,A.J.,Guglielmone,A.A.,&Nava, Kumar, S. (2011) MEGA5: Molecular Evolutionary Genetics S. (2021). Ixodessilvanusn. sp. (Acari: Ixodidae), a new AnalysisUsingMaximumLikelihood,EvolutionaryDistance, memberofthesubgenusTrichotoixodesReznik,1961from and Maximum Parsimony Methods.MolecularBiologyand northwesternArgentina.TicksandTick-borneDiseases,1122, Evolution,2288((1100)), 2731-2739. 101572. Thompson,J.D.,Higgins,D.G.,&Gibson,T.J.(1994)CLUSTAL Sebastian, P.S., Tarragona, E.L., Bottero, M.N., Mangold, A.J., W: improving the sensitivity of progressive multiple Mackenstedt,U.,&Nava,S.(2017)Bacteriaofthegenera sequencealignmentthroughsequenceweighting,position- EhrlichiaandRickettsiain ticks of the family Ixodidae with specific gap penalties and weight matrix choice. Nucleic medicalimportanceinArgentina.ExperimentalandApplied Acids Research,2222((2222)), 4673-4680. Acarology,7711((11)), 87-96. 55

See more

The list of books you might like