Logout succeed
Logout succeed. See you again!

Molecular Evidence on the Origin of Osmunda ×mildei (Osmundaceae) PDF
Preview Molecular Evidence on the Origin of Osmunda ×mildei (Osmundaceae)
Osmunda Molecular Evidence on the Origin of Xmildei (Osmundaceae) C. TsuTsuMi*, Y. HiRAYAMA, and M. Kato Tsukuba 305-0005, Japan Yatabe-Kakugawa Y. Botanical Gardens, Graduate School of Science, the University of Tokyo. Hakusnn. Zhang S.-Z Shenzhen Luohu Fairylake Botanical Garden, Shenzhen, Guangdong, China 518004 District, The Osmunda genus Osmundaceae of the leptosporangiate fern family has natural hybrids Tsutsumi One Osmunda (Kato, 2009; such et ah, 2011). is Xmildei = homonym C.Chr. 0. bipinnata Hook., a later of O. bipinnata L.), { which became known nearly Hong extinct in range in Kong. However, its this was hybrid found recently Shenzhen, Guangdong, and in Mt. Qiyun, Jiangxi (Zhang and et al, 2008), less than 10 individuals are known. was also found It Hunan in Zhangjiajie, (Y.-H. Yan, pers. comm.). can propagate via spores in It experimental conditions Yang, unpubl. but uncertain data), the (J.-F. it is if individuals were derived from spore propagations from independent or Osmunda formations of the hybrid. Xmildei characterized by subcoria- is ceous, bipinnate-bipinnatifid leaves with round, entire pinnules, and fertile pinnae below inserted the middle of the For the origin of O. Xmildei, leaf. two possibilities were proposed Based on and karyological (Fig. 1). He morphological analyses. suggested Xmildei et (2006) that O. al. a is hybrid of O. japonica Thunb. (subgenus Osmunda) and Ching O. angustifolia (subgenus Plenasium]. Zhang et al. (2008) observed the absence of chromosome and pairings meiosis at resulting abortive spores in O. Xmildei, and suggested that it is a sterile Fl hybrid, but argued that the parents were O. * Corresponding author: (e-mail: [email protected]) AMERICAN FERN VOLUME NUMBER JOURNAL: 102 (2012) 1 and japonica O. vachellii Hook, (subgenus Plenasium], because O. vachellii co-occurs with O. Xmildei, but O. angustifolia does not occur in some of the Xmildei Gou proposed localities of O. (Fig. et (2008) also that O. 2). al. vachellii the maternal progenitor of O. Xmildei, based on inferences from is DNA chloroplast sequence data. Under either parentage hypothesis O. Xmildei an between Osmunda likely intersubgeneric hybrid the subgenera is and Plenasium. known There are three more hybrids reported Osmundaceae in (Kato, 2009). Eastern North American O. Xruggii Tryon is O. regalis L. (subgenus Osmunda) X O. claytoniana L. (subgenus Claytosmundd) (Tryon, 1940; Wagner al, et Whetstone and and 1978; Atkinson, 1993; Li Haufler, 1994). Japanese O. Xnipponica Makino Osmunda) x O. japonica (subgenus O. claytoniana is (subgenus Claytosmunda) Sugimoto 1964), but (1979) suggested that (Ito, is it an X Osmundastrum cinnamomeum intergeneric hybrid, O. japonica i.e., (L.) X Neither given molecular C.Presl. evidence. Finally, Japanese O. intermedia is X (Honda) Sugim. O. japonica O. lancea Thunb. (both in subgenus is Osmunda; Tagawa, 1959; Iwatsuki, 1995; Tatuno and Yoshida, 1966; Yatabe et 2009). al., — Samples Materials. of three species of subgenus Plenasium [O. vachellii, O. Kuhn, banksiifolia (C.Presl) O. angustifolia], the putative intersubgeneric AMERICAN FERN JOURNAL: VOLUME NUMBER 102 1 (2012) hybrid O. Xmildei, one species of subgenus Claytosmunda (O. claytoniana], Osmundastrum cinnamomeum, and Todea barbara T.Moore, along with (L.) Osmunda three species subgenus of (O. japonica, O. lancea, O. were regalis], The collected in the field or botanical gardens. sources of materials used are shown Table in 1. DNA— Sequencing and of chloroplast nuclear Leaf fragments were used for DNA molecular was analysis. extracted from fresh or silica-gel-dried material QIAGEN using a DNeasy Mini Kit (QIAGEN, Valencia, CA) following the DNA manufacturer's instruction. Three nuclear markers (EST_L058, EST_L110, EST_L258) from selected the expressed sequence tag library developed by Yatabe and et (2009) the chloroplast locus rbcL were al. analyzed. Primers for amplification and sequencing, and detailed information on shown the three nuclear markers are in Table 2 and Table respectively. 3, PGR DNA was performed using Perkin-Elmer 9700 a thermal (Applied cycler DNA Biosystems, Foster, GA) with Ex Taq polymerase (TaKaRa Tokyo, Bio, and Ampdirect Japan) Plus (Shimadzu, Kyoto, Japan) in 35 denaturation, and annealing, elongation cycles (30 sec at 94 G; 30 sec at 50 G for the rbcL and G 58 in the three nuclear markers; and 90 with sec at 72 G) a final elongation min PGR The step (7 at 72 G). products were purified with ExoSAP-IT (USB OH) corporation, Gleveland, following the manufacturer's instructions. Sequencing was conducted ABI PRISM using an 3130x1 Genetic Analyzer (Applied Biosystems). The raw sequence data were assembled using Seqman II DNA (Dnastar, Madison, WI). For the sample of O. Xmildei, PGR of the nuclear DNA markers was performed with PrimeSTAR Max polymerase (TaKaRa Bio) G in 35 cycles (10 sec at 98 G, 5 sec at 55 and 5 sec at 72 G). The PGR products pGEM-T were cloned using a Vector System (Promega, Madison, WI) and at I least 10 clones were sequenced. Minor variants from single clones, presumably sequencing errors, were observed. Therefore a consensus sequence was used for each allele type; the differences between each consensus sequence and the shown original clones are in Table The assembled sequences were aligned 4. X by program (Thompson Glustal 1997) and then aligned manually. et al., — Molecular phylogeny. Phylogenetic analyses were performed by maximum parsimony (MP) and Bayesian Osmundaceae analysis. Registered sequences of Genbank were added Maximum in into the analyses Table parsimony (see 1). (MP) was PAUP* inference conducted with 4.0bl0 (Swofford, 2002). The bases that could not been identified were treated as unknown (N), and gaps were treated as missing data. All characters were equally weighed and heuristic searches were conducted with 1000 random TBR addition replicates involving branch swapping. were Bootstrap values calculated from 1000 pseudorepli- random each with 100 MrMod- cates, additions. For the Bayesian analyses, was eltest 2.0 (Nylander, 2004) used to determine the nucleotide substitution MGMG model. Bayesian searches were conducted by with two independent sets of four chains, each run for ten million generations, sampling every 100 generations by MrBayes 3.1.2 (Huelsenbeck and Ronquist, 2001; Ronquist and Huelsenbeck, The model GTR 2003). nucleotide selected was: rbcL, + + G; \ HKY GTR GTR EST_L058, + EST_L110, + EST_L258, + The program I; I; I. m iiiii! m iiiiiiii iSr II iiiii i I i li i! ii ii i I i mm Jill! il i! I if i ii j i yiS liiiiil! iI iifi fi 1= alS 1= n il 1 iiiiiyiiiiiil i ii !l i I i i i i i i I iiiiiiiiifiili yyHiiiiiiii iiiiflp! 111 II 1! iiiimii iiliii S555 isi i 5 It VOLUME NUMBER 102 1 EST ATAAGGTTTCGCCCTCGAAT L058 tc:ttggagttgggagttcac EST GATTGGAGATGGGAGATGAT LI 10 CAGAGGTGAAACAGGGTGAA EST TCATGGCGAGTGTGAAGAAG L258 GGCCCTTTGGATTTAGGATA Tracer (Rambaut and Drummond, 2009) was used to check the runs had reached and sample was stationarity effective size of the parameters high all The (>100). first 2.5 million generations before sufficient stationary genera- tions were discarded as burn-in periods and the rest of trees were used to Osmundastrum cinnamomeum calculate posterior probabilities. and Todea barbara were used as outgroups (Yatabe et 1999; Metzgar et al, 2008). al., Results maximum Bayesian and parsimony analyses of each dataset produced congruent shown topologies (Bayesian consensus Maxi- trees in Figs. 3-6). mum parsimony analyses resulted in three shortest trees of a length of 146 = = = HI steps (CI 0.77, 0.23, RI 0.93) for chloroplast rbcL (1227 bp) with 101 parsimony-informative characters, 78 shortest trees of a length of 47 steps (CI = = = HI EST_L058 0.89, 0.11, RI 0.88) for nuclear (198 bp) with 18 MP parsimony-informative characters, ten shortest trees of a length of 125 = = = HI EST_L110 steps (CI 0.91, 0.09, RI 0.91) for nuclear (572 bp) with 57 parsimony-informative and two characters, shortest trees of a length of 122 = = = HI EST_L258 steps (CI 0.89, 0.12, RI 0.94) for nuclear (361 bp) with 59 parsimony-informative characters. uLg sequenc (blastn) 1 GenBank hit ^ Marker no. (bp) gion (bp) region (bpf (specie^s) (E-value) EST_L058 FS9936B1 AYl 198 101 97 glycolate oxidase 73074 X "*) 10 (gox) (2 hi d [Z t EST_L110 FS993713 548 148 400 EU964956 glycerol-3- 10^") X phosphate (9 [Zea mays) EST_L258 FS993861 317 79 238 ribosomal AF334838 TSUTSUMI ET ORIGIN OF OSMUNDA XMILDEI AL.: The rbcL sequence Xmildei and of O. identical that of O. vachellii also is to was and Blume The similar to those of O. banksiifolia O. javanica (Fig. 3). Osmunda Xmildei sequence was more distantly related to O. angustifolia (but with low support), and very far from O. japonica and other species of subgenus Osmunda. In the three nuclear markers, the O. Xmildei sample has two distinct allele One types (Figs. 4-6). type (Type A) had the same sequence as some plants of O. japonica, while the other (Type B) had the same sequence as O. vachellii (in EST_L58 and LllO in Figs. 4 and or a sequence very similar to (in 5) it EST_L258 in Fig. In each of the three nuclear-marker trees, O. Xmildei was 6). more closely related to O. vachellii than to O. angustifolia. Discussion DNA Our trees constructed from the chloroplast gene and nuclear sequences with monophyly Osmunda agree previous trees in the of the three subgenera of Gou (Yatabe et al., 1999; et al, 2008; Metzgar et al, 2008). The rhcL same phylogenetic relationships of the subgenera are the as Yatabe et al.'s (1999) from the same gene and Metzgar et (2008) from seven chloroplast al.'s loci including rbcL, and different from Gou et (2008) rbcL relationships. al. 's The deduced EST relationships from the three nuclear markers are not consistent with each other, but the relationship of the EST__L110 agrees with Osmunda the rbcL relationship in the subgenera and Plenasium being sister to each other. EST All the phylogenetic trees inferred from the three nuclear markers show Osmunda that Xmildei has two distinct allele types, and one identical is to those of O. japonica, and the other formed a monophyletic clade with those Plenasium of species (Figs. 4-6). suggested that O. Xmildei an It is is Osmunda intersubgeneric hybrid between the subgenera and Plenasium. The Type B Xmildei have same EST_L058, EST_L110 alleles of O. the sequences and EST_L258 the closest sequences to those of O. vachellii, suggesting that O. Xmildei is most likely derived by hybridization of O. japonica and O. vachellii AMERICAN FERN VOLUME NUMBER JOURNAL: 102 1 (2012) The (Figs. 4-6). chloroplast rbcL sequence of O. Xmildei is identical to that of O. vachellii (Fig. suggesting that is the maternal progenitor of O. Xmildei; 3), it hence O. japonica is paternal. This suggested parentage agrees with Zhang et and Gou who al. (2008) et al. (2008), suggested O. vachellii as the maternal DNA parent, based on chloroplast and Osmunda data distributional data. banksiifolia is also very closely related to O. Xmildei, however, comparative morphology does not support that O. banksiifolia a parent, because has is it prominently dentate pinnae, whereas O. vachellii and O. Xmildei (and also O. japonica) are both distinct with entire or somewhat serrate pinnae or pinna- segments. This study analyzed a sample of O. Xmildei from Shenzhen, Guangdong (Fig. 2). It has very low spore viability and a very low offspring reproduction even rate in carefully controlled culture conditions (Zhang 2008; et al., J.-F. Yang et al., unpubl. data). Considering the low reproductive ability and a few isolated localities in southern China, possible Xmildei it is that O. is of multiple origins, although no molecular evidence Osmunda available. is Xruggii of eastern North America (Connecticut and USA) an Virginia, is