loading

Logout succeed

Logout succeed. See you again!

ebook img

Molecular phylogenetics of stream treefrogs of the Hyloscirtus larinopygion group (Anura: Hylidae), and description of two new species from Ecuador PDF

release year2012
file size18.8 MB
languageEnglish

Preview Molecular phylogenetics of stream treefrogs of the Hyloscirtus larinopygion group (Anura: Hylidae), and description of two new species from Ecuador

Zootaxa 3364: 1–78 (2012) ISSN 1175-5326 (print edition) Monograph www.mapress.com/zootaxa/ ZOOTAXA Copyright © 2012 · Magnolia Press ISSN1175-5334(online edition) ZOOTAXA 3364 Molecular phylogenetics of stream treefrogs of the Hyloscirtus larinopygion group (Anura: Hylidae), and description of two new species from Ecuador LUIS A. COLOMA1, SOFÍA CARVAJAL-ENDARA1, JUANF. DUEÑAS1, ARTURO PAREDES-RECALDE2, MANUEL MORALES-MITE3, DIEGO ALMEIDA-REINOSO1, ELICIO E. TAPIA1, CARL R. HUTTER4, EDUARDO TORAL1, & JUAN M. GUAYASAMIN5 1Centro Jambatu de Investigación y Conservación de Anfibios, Fundación Otonga, Geovanni Farina 566 y Baltra, San Rafael, Quito, [email protected], [email protected], [email protected], [email protected], [email protected], [email protected] 2Universidad San Francisco de Quito, Colegio de Ciencias Biológicas y Ambientales, Laboratorio de Zoología Terrestre. Campus Cumbayá USFQ, Vía Interoceánica y Diego de Robles. Casilla Postal 17-1200-841. Quito, Ecuador. [email protected] 3Museo Ecuatoriano de Ciencias Naturales, División de Herpetología, calle Rumipamba 341 y Av. de Los Shyris. Casilla Postal 17- 07-8976, Quito, Ecuador. [email protected] 4Department of Ecology and Evolution, Stony Brook University, Stony Brook, NY 11794-5245, USA. [email protected] 5Centro de Investigación de la Biodiversidad y Cambio Climático, Universidad Tecnológica Indoamérica, Av. Machala y Sabanilla, Quito, Ecuador. [email protected] Magnolia Press Auckland, New Zealand Accepted by S. Castroviejo-Fisher: 20 Jun. 2012; published: 4 Jul. 2012 LUIS A. COLOMA, SOFÍA CARVAJAL-ENDARA, JUANF. DUEÑAS, ARTURO PAREDES-RECALDE, MANUEL MORALES-MITE, DIEGO ALMEIDA-REINOSO, ELICIO E. TAPIA, CARL R. HUTTER, EDUARDO TORAL, & JUAN M. GUAYASAMIN Molecular phylogenetics of stream treefrogs of the Hyloscirtus larinopygion group (Anura: Hylidae), and description of two new species from Ecuador (Zootaxa 3364) 78 pp.; 30 cm. 4 Jul. 2012 ISBN 978-1-86977-927-6 (paperback) ISBN 978-1-86977-928-3 (Online edition) FIRST PUBLISHED IN 2012 BY Magnolia Press P.O. Box 41-383 Auckland 1346 New Zealand e-mail: [email protected] http://www.mapress.com/zootaxa/ © 2012 Magnolia Press All rights reserved. No part of this publication may be reproduced, stored, transmitted or disseminated, in any form, or by any means, without prior written permission from the publisher, to whom all requests to reproduce copyright material should be directed in writing. This authorization does not extend to any other kind of copying, by any means, in any form, and for any purpose other than private research use. ISSN 1175-5326 (Print edition) ISSN 1175-5334 (Online edition) 2 · Zootaxa 3364 © 2012 Magnolia Press COLOMA ET AL. Table of contents Abstract . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .3 Resumen . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4 Introduction . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .4 Materials and methods . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .6 Results . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .14 New species . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20 Hyloscirtus criptico sp. nov. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .20 Hyloscirtus princecharlesi sp. nov. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .26 New country record for Ecuador: Hyloscirtus trigrinus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .31 Tadpoles . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .32 Hyloscirtus larinopygion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .32 Hyoscirtus lindae . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .34 Hyloscirtus pantostictus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 39 Hyloscirtus princecharlesi . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .42 Hyloscirtus psarolaimus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .43 Hyloscirtus tigrinus . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .45 Osteology . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .50 Calls . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .67 Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .71 Systematics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .71 Genetic distances and speciation . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .73 Timing of species origin . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .73 Acknowledgments . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .74 References . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .75 Abstract We review the systematics of frogs of the Hyloscirtus larinopygion group. A new phylogenetic tree inferred from mitochondrial DNA (partial sequences of 12S rRNA, valine-tRNA, and 16S rRNA genes; ~2.3 kb) of eleven species of the H. larinopygion group is provided, based on maximum parsimony, maximum likelihood, and Bayesian analyses. Our phylogeny confirms the close relationship of members of the H. larinopygion group with Andean relatives of the H. armatus group, which also occurs in the Andes. Hyloscirtus tapichalaca is placed as sister species to the rest of the H. larinopygion group, in which two clades (A+B) are evident. Although ingroup relationships are well supported, the monophyly of the H.larinopygion group and placement of H. tapichalaca require additional testing. Genetic divergences among species of the H.larinopygion group are shallow compared to those observed in many other anurans, with genetic distance among sister species (H. princecharlesi and H. ptychodactylus) as low as 1.31%. However, this pattern is concordant with radiations in other highland Andean lineages of anurans that show marked morphological or behavioral differentiation, but low divergence in mitochondrial markers. Divergence-time analyses (using BEAST) indicate that the Hyloscirtus clade is a relatively ancient lineage that appeared in the Eocene, at a minimum age of 51.2 million years ago (MYA), while the H. larinopygion group originated in the Middle-Late Eocene at a minimum age of 40.9 MYA. Our results might suggest a rapidradiationofHyloscirtus startingin the Miocene into the Pliocene, from at least 14.2 MYA to the most recent divergence between sister taxa at ~2.6 MYA. We also describe two sympatric new species of Hyloscirtus from northwestern Ecuador: H. criptico sp. nov. and H.princecharlesi sp. nov. We diagnose them by their phylogenetic position (they are not sister to each other), genetic divergence, and a unique combination of color patterns, and other morphological features. Additionally, we describe the suctorial tadpoles and the extreme ontogenic color changes in H. larinopygion, H. lindae, H. pantostictus, H.princecharlesi,H. psarolaimus, and H. tigrinus. Furthermore, we describe the osteology of H. criptico,H. lindae, H. pacha, H. pantostictus, H. princecharlesi, H. psarolaimus, H. ptychodactylus, and H. staufferorum. We describe vocalizations of H. lindae,H. pacha,H. pantostictus,H. pasarolaimus,H. staufferorum, and H. tapichalaca. Hyloscirtus tigrinus is recorded for the first time in Ecuador and its range is extended 62.4 km (airline distance), from its southernmost locality record in Departamento de Nariño, Colombia. Most species of the H. larinopygion group are currently severely threatened by extinction, after surviving the catastrophic extinctions in the 1980s and 1990s that led to the disappearance of many other sympatric anurans that bred in swiftly flowing water and had lotic water tadpoles in the Andean highlands. Research and conservation actions are urgently needed for these species. In order to better call attention to these conservation issues, we name one of the new species in honor of Prince Charles of Wales, who is contributing significantly to the growth of awareness in the battle against tropical deforestation, climate change,and the catastrophic extinction of rainforest amphibians. PHYLOGENY, MORPHOLOGY, AND NEW SPECIES OF HYLOSCIRTUS Zootaxa 3364 © 2012 Magnolia Press · 3 Key words: Anura; Ecuador; Calls; Conservation; Extinction; Hylidae; Hyloscirtus criptico sp. nov.; Hyloscirtus lar- inopygion; Hyloscirtus lindae; Hyloscirtus pantostictus; Hyloscirtus princecharlesi sp. nov.; Hyloscirtus psarolaimus; Hyloscirtus ptychodactylus; Hyloscirtus staufferorum; Hyloscirtus tigrinus; Morphology; New species; Osteology; Phy- logeny; Systematics; Tadpoles Resumen Se revisa la sistemática de las ranas del grupo Hyloscirtus larinopygion. Se provee un nuevo árbol filogenético basado en el ADN mitocondrial (secuencias parciales de genes 12S rRNA, tRNA valina, y 16S rRNA; ∼2.3 kb) de once especies del grupo H. larinopygion, el cual se basa en análisis de máxima parsimonia, máxima verosimilitud, y Bayesiano. Nuestra filogenia confirma la estrecha relación de los miembros del grupo H. larinopygion con parientes andinos del grupo H. armatus.Hyloscirtus tapichalaca se ubica como la especie hermana del resto de especies del grupo H. larinopygion, en el cual dos clados (A+B) son evidentes. Aunque las relaciones intragrupales tienen fuerte soporte estadístico, la monofilia del group H.larinopygion y la posición de H. tapichalaca requieren pruebas adicionales. Las divergencias genéticas entre las especies del grupo H. larinopygion son pequeñas al compararlas con aquellas observadas en muchos otros anuros, con una distancia genética entre especies hermanas (H. princecharlesi e H. ptychodactylus) tan baja como el 1.3%. Sin embargo, este patrón concuerda con las radiaciones de otros linajes de anuros de las zonas Altoandinas que muestran notoria diferenciación morfológica o comportamental a pesar de la baja diferenciación genética en marcadores mitocondriales. Análisis de tiempos de divergencia (usando BEAST) señalan que el clado de Hyloscirtus es un linaje relativamente antiguo pues habría surgido en el Eoceno, hace cerca de al menos 51.2 millones de años, mientras que el grupo H. larinopygion se habría originado en el Eoceno Medio-Tardío hace al menos 40.9 millones de años. Nuestros resultados sugerirían una rápida radiación de Hyloscirtus desde el Mioceno hasta el Plioceno desde al menos 14.2 millones de años hasta la más reciente diversificación de taxa hermanos que ocurrió hace al menos ~2.6 millones de años. También describimos dos especies nuevas simpátricas de Hyloscirtus del noroccidente de Ecuador: H. criptico sp. nov. e H. princecharlesi sp. nov. Las diagnosticamos por su posición filogenética (no son taxa hermanos), divergencia genética y una combinación única de patrones de color, y otras características morfológicas. Adicionalmente describimos los renacuajos suctoriales y los excepcionales cambios de color ontogénicos de H. larinopygion, H. lindae, H. pantostictus, H. princecharlesi,H. psarolaimus, e H. tigrinus. Además describimos la osteología de H. criptico, H. lindae, H. pacha, H. pantostictus, H. princecharlesi, H. psarolaimus, H. ptychodactylus, e H. staufferorum. Describimos las vocalizaciones de H. lindae, H. pacha, H. pantostictus, H. psarolaimus, H. staufferorum, e H. tapichalaca. Registramos a Hyloscirtus tigrinus por primera vez en Ecuador ampliando en 62.4 km su rango (en línea recta) hacia el sur desde su registro previo de una localidad en el Departamento de Nariño, Colombia. La mayoría de las especies del grupo H.larinopygion están hoy severamente amenazadas de extinción, después de sobrevivir a las extinciones catastróficas ocurridas en las décadas de los 80–90, las cuales produjeron la desaparición de muchos otros anuros simpátricos que se reproducían en aguas torrentosas y tenían renacuajos lóticos en zonas Altoandinas. Se requieren acciones urgentes de investigación y conservación de estas especies. Para llamar la atención sobre estos aspectos de conservación, nombramos a una de las especies nuevas en honor al Príncipe Carlos de Gales, quien está contribuyendo de manera significativa al crecimiento de la conciencia en la lucha contra la deforestación tropical, el cambio climático, y la extinción catastrófica de los anfibios de los bosques lluviosos. Palabras claves: Anura;Ecuador;Cantos; Conservación; Especies Nuevas; Extinción; Filogenia; Hylidae; Hyloscirtus criptico sp. nov.; Hyloscirtus larinopygion; Hyloscirtus lindae; Hyloscirtus pantostictus; Hyloscirtus princecharlesi sp. nov.; Hyloscirtus psarolaimus; Hyloscirtus ptychodactylus; Hyloscirtus staufferorum;Hyloscirtus tigrinus; Morfología; Osteología; Renacuajos; Sistemática Introduction The Neotropical Andean stream-breeding frogs of the genus Hyloscirtus (Peters 1882) were recognized by Faivovich et al. (2005) as a monophyletic group (currently containing 32 species; updated from Frost, 2011) on the basis of 56 molecular (nuclear, mitochondrial, and ribosomal genes) and one morphological (wide dermal fringes on fingers and toes) synapomorphies. Within this genus, three previously proposed (see Duellman et al. 1997 and references cited therein) and putative monophyletic groups were also recognized by Faivovich et al. (2005), pending evaluation of their status: the Hyloscirtus armatus, H. bogotensis, and the H. larinopygion groups. Wiens et al. (2005) accommodated these three groups in the genus Boana, cautioning that their placement “should not be taken as a sign of confidence in the monophyly of the species groups”. Wiens et al. (2006) adopted the 4 · Zootaxa 3364 © 2012 Magnolia Press COLOMA ET AL. nomenclature of Faivovich et al. (2005) and Wiens et al. (2010) found strong support for the monophyly of Hyloscirtus. Additionally, Sánchez (2010) delimited two species groups within Hyloscirtus based on larval morphology. Frogs of the Hyloscirtus larinopygion group are relatively large and some species could be considered as some of the most colorful and beautiful frogs on Earth (e.g., H. tigrinus Mueses-Cisneros and Anganoy-Criollo 2008, H. pantostictus Duellman and Berger 1982, H. princecharlesi this paper). Despite these morphological traits, individuals of the H. larinopygion group are remarkably elusive and are therefore difficult to detect. Perhaps this is why the first known species of this group was described less than 40 years ago (H. larinopygion Duellman 1973). Since then, eight species were described by the end of the 20th century, and four more were described only in the last decade. It is clear that a combination of their restricted elevational ranges in habitats difficult to access (undisturbed cascading montane streams), and their nocturnal and apparently seasonal activity have hindered our understanding of their diversity and ecology. Basic knowledge of their natural history is still lacking because most aspects of their reproductive mode and/or behaviors have not been observed. Frogs of the H. larynopygion group are survivors of mass extinctions that affected species living in the same habitats and having similar natural history features (e.g., tadpoles developing in lotic streams of Atelopus and Hyloxalus, in the northern Andes of Ecuador; Atelopus and Telmatobius in the south; La Marca et al. [2005], Bustamante et al. [2005], Merino et al. [2005], Coloma et al. [2007, 2010]) The Andean Hyloscirtus larinopygion group was initially defined by Duellman and Hillis (1990) and included eight species originally described in the genus Hyla(H. caucana [cited as H. sp. A.] Ardila-Robayo, Ruiz-Carranza and Roa-Trujillo 1993, H. larinopygion, H. lindae Duellman and Altig 1978, H. pacha Duellman and Hillis 1990, H. pantosticta, H. psarolaima Duellman and Hillis 1990, H. ptychodactyla Duellman and Hillis 1990, and H. sarampiona Ruiz-Carranza and Lynch 1982). Duellman and Hillis performed a cladistic analysis of allozymes that included five species (Hyloscirtus larinopygion, H. lindae, H. pacha, H. pantostictus, H. psarolaimus) and provided a phylogenetic hypothesis of their relationships.Subsequently, Hyla staufferorum Duellman and Coloma 1993 was described and placed in the group, and Hyla tapichalaca Kizirian, Coloma, and Paredes-Recalde 2003 was described. The allocation of the later to the Hyla groups recognized at that time was considered problematic. Faivovich et al. (2005) diagnosed the group by 32 molecular features of three species (Hyloscirtus tapichalaca, H. pantostictus, H. pacha), resurrected the name Hyloscirtus from its synonym with Hyla (Duellman 1970), and included ten species in the group (H. caucanus, H. larinopygion, H. lindae, H. pacha, H. pantostictus, H. psarolaimus, H. ptychodactylus, H. sarampiona, H. staufferorum, H. tapichalaca), founded on a previous morphology-based taxonomy. More recently, one new species (H. tigrinus) was added to the group by Mueses- Cisneros (2008). Wiens et al. (2010) included four species of the group (H. lindae, H. tapichalaca, H. pantostictus, H. pacha) in molecular analyses based on mitochondrial and nuclear sequence data. Since no morphological features have been identified as unambiguous synapomorphies to diagnose the H. larinopygion group, placement of species that lacked molecular data at the time of description (e. g., H. tapichalaca,H. tigrinus) was tentative and problematic. Furthermore, Paredes-Recalde (1999) and Kizirian et al. (2003) suggested that the H. armata group sensu Duellman et al. (1997) was nested in the H. larinopygion group. The latter hypothesis was not supported by Faivovich et al. (2005), but it was congruent with two groups proposed by Sánchez (2010) based on larval morphology. The osteology, calls, and tadpoles have been been described for only some species in the Hyloscirtus larinopygion group. A complete osteological description for H. tapichalaca (Kizirian et al. 2003), whereas descriptions of cranial osteology have been published for H. caucana, H. lindae, and H. sarampiona (Duellman and Altig 1978, Ruíz-Carranza and Lynch 1982, Ardila-Robayo et al. 1993). Calls are only known for H. staufferorum and H. tapichalaca (Duellman and Coloma 1993, Kizirian et al. 2003). Tadpoles of only fourspecies are known: H. caucana, H. lindae, H. ptychodactylus, and H. staufferorum (Duellman and Altig 1978, Duellman and Hillis 1990, Ardila-Robayo et al. 1993, Duellman and Coloma 1993). Furthermore, these tadpoles are only tentatively assigned to these taxa. Herein, we: (1) test the monophyly of the Hyloscirtus larinopygion group, (2) provide an expanded phylogenetic hypothesis that includes eleven species of the Hyloscirtus larinopygion group based on mitochondrial sequence data, (3) describe two new species, (4) describe the osteology, tadpoles, and calls of most species, (5) describe ontogenic variation in coloration for several species, and (6) report H. tigrinus as a new addition to the Ecuadorian fauna. PHYLOGENY, MORPHOLOGY, AND NEW SPECIES OF HYLOSCIRTUS Zootaxa 3364 © 2012 Magnolia Press · 5 Materials and methods The phylogeny is based on mitochondrial DNA sequence data, and we provide data on various phenotypic traits (e.g., tadpoles, coloration, osteology, calls) that could be informative in future taxonomy and phylogenetic hypotheses based on all the available data. Herein, we use an integrative approach to taxonomy and avoid uncertain boundaries by providing discrete molecular and morphological characters. Nonetheless, we acknowledge that delimitation of species is an active area of research (Wiens 2007, Jarrín-V and Kunz 2008, Padial et al. 2010). The recognition of species is enhanced by genetic data and a phylogeny-based delimitation of species boundaries (see Discussion). Institutional abbreviations follow Leviton et al. (1985) as updated by Frost (2011), with the addition of Centro Jambatu de Investigación y Conservación de Anfibios, Quito, Ecuador (CJ). Specimens examined are housed at CJ, Museum of Natural History of The University of Kansas (KU), Museo de Zoología, Pontificia Universidad Católica del Ecuador (QCAZ), and Museo de Zoología, Universidad Tecnológica Indoamérica (MZUTI). Author contributions. LAC conceived and designed research. LAC, SCE, JFD, APR, and MMM analyzed data and wrote the paper. DAR reared tadpoles and metamorphs. LAC, SCE, JFD, APR, MMM, DAR, EET, CRH, ET, and JMG collected specimens, data, and reviewed the paper. DNA sampling. Phylogenetic relationships of the Hyloscirtus larinopygion group were analyzed using a dataset of ∼2.3 kb of mitochondrial DNA that include 18 species of Hyloscirtus. Muscle and liver tissue samples were collected from 18 populations of Hyloscirtus and stored in 95% ethanol. Ingroup taxon sampling included eleven species (H. criptico, H. larinopygion, H. lindae, H. pacha, H. pantostictus, H. princecharlesi, H. psarolaimus, H. ptychodactylus, H. staufferorum, H. tapichalaca, and H. tigrinus) depicted in Figure 1. The sequences of H. pacha and H. tapichalaca, published by Darst and Cannatella (2004) and Faivovich et al. (2004) respectively, were obtained from GenBank (www.ncbi.nlm.nih.gov). Tissue samples of the Colombian H. caucanus and H. sarampiona were unavailable. As outgroups, we included Myersiohyla inparquesi (Ayarzagüena and Señaris 1994) and five species representing the two remaining species groups recognized in Hyloscirtus (groups defined by Duellman et al. 1997):(1) H. armatus (Boulenger 1902) and H. charazani (Vellard 1970)from the H. armatus group,(2) H. alytolylax (Duellman 1972), H. colymba (Dunn 1931), H. palmeri (Boulenger 1908), and H. phyllognathus (Melin 1941) from the H. bogotensis group. The sequences of H. armatus, produced by Faivovich et al. (2004), as well as the sequences of H. charazani, H. colymba, H. palmeri, and Myersiohyla inparquesi, produced by Faivovich et al. (2005) were obtained from GenBank. Information on voucher specimens, associated locality data, and GenBank accession numbers are summarized in Table 1. DNA amplification and sequencing. Genomic DNA was extracted from frozen and ethanol preserved tissues using standard phenol–chloroform extraction protocols (Sambrook et al. 1989). The polymerase chain reaction (PCR) was used to amplify independently three mtDNA overlapping fragments spanning to ∼2.3 kb, which included partial sequences of 12S rRNA, valine-tRNA, and 16S rRNA genes.DNA amplification was completed using combinations of primers 12SH, MVZ50d, 12SM, 16Sa, 16Sc, and 16Sbr-H (Goebel et al. 1999; Table 2). Mitochondrial fragments were amplified with the following thermal cycle profile: 1 cycle of 2 min at 94˚C, 30 sec at 55˚C, 1 min at 72˚C; 5 cycles of 30 sec at 94˚C, 30 sec at 55˚C, 1 min at 72˚C; 22 cycles of 30 sec at 94˚C, 30 sec at 60˚C, 1 min at 72˚C; 1 cycle of 5 min at 72˚C. Single PCR products were visualized in 1% agarose gel by a horizontal electrophoresis and purified with ExoSap (ExoSap-iT, GE Healthcare). The PCR products were sequenced by the Macrogen Sequencing Team (Macrogen Inc., Seoul, Korea). Sequence analysis. Data from six strands were assembled to construct contiguous consensus sequences for each sample, using Sequencher 4.8 (Gene Codes Corporation). We included data from 34 individuals. DNA sequences were aligned using CLUSTAL X 2.0.10 (Larkin et al. 2007), with default parameters. MESQUITE 2.73 (Maddison and Maddison 2010) was used to visualize the alignment and to make some manual alignment adjustments. Models from the Gutell Lab website (www.rna.ccbb.utexas.edu) of secondary structures were used to facilitate decisions about ambiguous regions. Alignment regions for which homology was ambiguous were excluded from analysis. The final matrix included 2256 characters, after exclusion of 105 ambiguously aligned characters. We excluded regions that presented more than one equally parsimonious alignments. 6 · Zootaxa 3364 © 2012 Magnolia Press COLOMA ET AL. TABLE 1. Taxa included in the phylogenetic analysis, with corresponding museum numbers, collecting localities, and Genbank accession numbers. Species Museum number Locality Genbank Number Outgroup taxa Myersiohyla inparquesi RWM 17688 Venezuela: Amazonas, AY843672 Cerro Neblina (Faivovich et al. 2005) Hyloscirtus alytolylax QCAZ 24377 Ecuador: Cotopaxi: JX155798 ca. San Francisco de las JX155825 Pampas, 1760 m (this study) Hyloscirtus alytolylax QCAZ 24376 Ecuador: Cotopaxi: JX155799 ca. San Francisco de las JX155826 Pampas, 1760 m (this study) Hyloscirtus armatus AMNH 1651632 Bolivia: Santacruz: AY549321 Caballero: Canton San Juan: (Faivovich et al. 2004) Amboro National Park Hyloscirtus charazani AMNH-A165132 Bolivia: La Paz, Bautista AY843618 Saavedra, Canton Charazani, (Faivovich et al. 2005) Stream 2 Hyloscirtus colymba SIUC H-7079 Panama: Cocle, Parque AY843620 Nacional El Cope (Faivovich et al. 2005) Hyloscirtus palmeri SIUC H-6924 Panama: El Cope, Parque AY843650 Nacional Omar Torrijos (Faivovich et al. 2005) Hyloscirtus phyllognathus QCAZ 23938 Ecuador: Morona Santiago: JX155800 16 km N El Ideal, 1600 m JX155827 (this study) Hyloscirtus phyllognathus QCAZ 41032 Ecuador: Zamora Chinchipe: JX155801 ca. Miazal Alto, 1250 m JX155828 (this study) Hyloscirtus phyllognathus QCAZ 32271 Ecuador: Morona Santiago: JX155802 ca. Nueve de Octubre, 1527 m JX155829 (this study) Ingroup taxa Hyloscirtus tapichalaca QCAZ 15083 Ecuador: Zamora Chinchipe: JX155803 Reserva Tapichalaca, 2625 m JX155830 (this study) Hyloscirtus tapichalaca QCAZ 16704 Ecuador: Zamora Chinchipe: AY563625 Reserva Tapichalaca (Faivovich et al. 2004) 4º29.049'S, 79º8.925'W, 2697 m Hyloscirtus ptychodactylus QCAZ 46030 Ecuador: Cotopaxi: JX155804 ca. Pilaló, 2500 m JX155831 (this study) Hyloscirtus ptychodactylus QCAZ 46031 Ecuador: Cotopaxi: JX155805 ca. Pilaló, 2500 m JX155832 (this study) Hyloscirtus princecharlesi QCAZ 42165 Ecuador: Imbabura: JX155806 ca. Cuellaje, 2720 m JX155833 (this study) Hyloscirtus princecharlesi QCAZ 43654 Ecuador: Imbabura: JX155807 ca. Cuellaje, 2760 m JX155834 (this study) Hyloscirtus psarolaimus QCAZ 27049 Ecuador: Sucumbíos: JX155808 ca. Santa Bárbara, 2600 m JX155835 (this study) ...continued on next page PHYLOGENY, MORPHOLOGY, AND NEW SPECIES OF HYLOSCIRTUS Zootaxa 3364 © 2012 Magnolia Press · 7 TABLE 1. (Continued) Species Museum number Locality Genbank Number Outgroup taxa Hyloscirtus psarolaimus QCAZ 46095 Ecuador: Napo: JX155809 60 km E Salcedo, 2748 m JX155836 (this study) Hyloscirtus tigrinus QCAZ 41351 Ecuador: Sucumbíos: JX155810 ca. Santa Bárbara, 2638 m JX155837 (this study) Hyloscirtus tigrinus QCAZ 31550 Ecuador: Napo: JX155811 ca. Santa Bárbara, 2620 m JX155838 (this study) Hyloscirtus criptico QCAZ 43421 Ecuador: Imbabura: JX155812 ca. Cuellaje, 2560 m JX155839 (this study) Hyloscirtus criptico QCAZ 45466 Ecuador: Carchi: JX155813 Road Tulcán-Maldonado. JX155840 Quebrada Centella, 2806 m (this study) Hyloscirtus criptico QCAZ 43422 Ecuador: Imbabura: JX155814 ca. Cuellaje 2560 m JX155841 (this study) Hyloscirtus pacha KU 202760 Ecuador: Azuay 2.0 km SSE AY326057 Palmas, 2340 m (Darst and Cannatella, 2004) Hyloscirtus staufferorum QCAZ 45967 Ecuador: Pastaza: JX155815 ca. Santa Clara, 2250 m JX155842 (this study) Hyloscirtus staufferorum QCAZ 45962 Ecuador: Pastaza: JX155816 ca. Santa Clara 2250 m JX155843 (this study) Hyloscirtus larinopygion QCAZ 41826 Ecuador: Carchi: JX155817 Morán, 2452 m JX155844 (this study) Hyloscirtus larinopygion QCAZ 45462 Ecuador: Carchi: JX155818 Road Tulcán-Maldonado. JX155845 Quebrada Centella, 2806 m (this study) Hyloscirtus pantostictus QCAZ 45438 Ecuador: Sucumbíos: JX155819 ca. Santa Bárbara, 2709 m JX155846 (this study) Hyloscirtus pantostictus QCAZ 45435 Ecuador: Sucumbíos: JX155820 ca. Santa Bárbara, 2709 m JX155847 (this study) Hyloscirtus lindae QCAZ 41232 Ecuador: Napo: JX155821 Parque Nacional Sumaco, JX155848 Sumaco Lake, 2479 m (this study) Hyloscirtus lindae QCAZ 45346 Ecuador: Napo: JX155822 11–12 km E Papallacta, JX155849 2600 m (this study) Hyloscirtus lindae QCAZ 45463 Ecuador: Sucumbíos: JX155823 ca. Santa Bárbara, 2341m JX155850 (this study) Hyloscirtus lindae QCAZ 45342 Ecuador: Napo: 11–12 km E JX155824 Papallacta, 2700 m JX155851 (this study) 8 · Zootaxa 3364 © 2012 Magnolia Press COLOMA ET AL. TABLE2. Primers used for amplification and sequencing reactions. Primer Sequence (5'–3') Gene Source 12SH AAAGGTTTGGTCCTAGCCTT 12S Goebel, 1996; Cannatella, 1998 MVZ50d TYTCGGTGTAAGYGARAKGCTT tRNA-Val Graybeal, 1997 12SM GGCAAGTCGTAACATGGTAAG 12S Darst and Cannatella, 2004 16SA ATGTTTTTGGTAAACAGGCG 16S Palumbi et al. 1991 16Sc GTRGGCCTAAAAGCAGCCAC 16S Moriarty and Cannatella, 2004 16Sbr-H CCGGTCTGAACTCAGATCACGT 16S Palumbi et al. 1991 Phylogenetic analysis. We analyzed the phylogenetic relationships of the Hyloscirtus larinopygion group using maximum parsimony, maximum likelihood, and Bayesian analyses. Maximum parsimony analyses were performed in PAUP* 4.0a109 (Swofford 2009), using heuristic searches with tree bisection and reconnection (TBR) branch swapping and 10,000 random addition sequences replicates. All characters were weighted equally and gaps were treated as missing data. To obtain estimates of support for each clade, bootstrapping was employed (100 replicates), with each bootstrap replicate using heuristic searches with 10,000 replicates and TBR branch swapping. For Bayesian and likelihood analyses, the best-fitting evolutionary model was selected using jMODELTEST 0.1.1 (Posada 2008, Guindon and Gascuel 2003), under the Bayesian Information Criterion (BIC). The BIC has been suggested to have high accuracy and precision relative to other selection criteria (Luo et al. 2010). For ML analyses, we used GARLI 2.0 (Zwickle 2006). Two partitioning schemes were used: without a partition and with a two-partition scheme (12S rRNA + valine-tRNA; 16S rRNA). We used the best log-likelihood across the search replicates and number of parameters to calculate the AIC for each partition scheme to determine the preferred partition, which was the two-partition scheme. A total of 25 independent runs were performed to infer the best tree, using the model selected in jMODELTEST but with parameter values estimated from the data. Bootstrap support was assessed via 1000 pseudoreplicates under the same settings used during tree search to estimate support for the nodes. Bayesian analyses were performed in MrBAYES 3.1.2 (Huelsenbeck and Ronquist 2001, Ronquist and Huelsenbeck 2003). In order to determine the best partition scheme, we performed a Bayes factor analysis (Kass & Raftery 1995, Brandley et al. 2005) without a partition and a two-partition scheme (12S rRNA + valine-tRNA; 16S rRNA). We used the harmonic means obtained to estimate the Bayesian factor. As a Bayes factor cut off we considered a 2ln Bayes factor > 5 as a strong evidence favoring a partitioning scheme. Subsequent analyses were performed with a two-partition scheme (12S rRNA + valine-tRNA; 16S rRNA), which resulted in the preferred partitioning scheme. To each partition, we assigned its best-fit model of evolution estimated in jMODELTEST. All parameters were unlinked between partitions, except topology and branch lengths. Bayesian phylogenetic analyses consisted of two independent runs of 10 million generations each and four Markov chains (temperature set to 0.20), with trees sampled every 1000 generations. Of the 10000 trees generated per run, the first 2500 were discarded as “burn in”. After confirming that the two analyses reached stationarity at a similar likelihood score and that the topologies were similar, using TRACER 1.5 (Drummond and Rambaut 2007), the remaining 15000 trees were combined to calculate the posterior probabilities in a 50% majority-rule consensus tree. To address intra- and interspecies sequence divergence we used maximum-likelihood corrected pair-wise distances, calculated in PAUP* 4.0a115 (Swofford 2002), under the same model selection strategy used in the phylogenetic analyses. Divergence time estimates. We estimated divergence times among species of Hyloscirtus using BEAST 1.7.1 (Drummond and Rambaut 2007). We used two methods of calibration: (1) the estimated rate of evolution for anuran mitochondrial 12S and 16S from Pseudacris (0.00277 substitutions per site per lineage per MYA; Lemmon et al. 2007), and (2) combined fossil and paleobiogeographic information (Salerno et al. 2012). Because there is no fossil information on species of Hyloscirtus, we used only external calibration points. Following Smith et al. (2005) we included the following minimum ages of clades based on the hylid fossil record: most recent common ancestor (MRCA) of Acris–Pseudacris clade (15 MYA), MRCA of European Hyla (10 MYA), MRCA of H. squirella–H. cinerea clade (15 MYA), MRCA of North American Hyla (33 MYA), and MRCA of the Hyla gratiosa–H. versicolor clade (15 MYA). Additionally, we added a calibration point corresponding to the common PHYLOGENY, MORPHOLOGY, AND NEW SPECIES OF HYLOSCIRTUS Zootaxa 3364 © 2012 Magnolia Press · 9 ancestor of Osteopilus and Phyllodytes auratus based on the Aves Ridge landbridge hypothesis (GAARlandia; Iturralde-Vinent and MacPhee 1999). The substitution rate from Pseudacris was estimated based partially on hylid fossils (Lemmon et al. 2007), and, thus, these two calibration approaches are not fully independent. For the analyses, we used a two partition scheme (12S rRNA + valine-tRNA; 16S rRNA), which included a single representative of each Hyloscirtus species from our dataset, complemented with 24 sequences of other hylid species (Table 3) that represent the clades used for calibration points (also used by Salerno et al. 2012). Analyses Γ were conducted under the GTR + I + model for each partition, with a Yule speciation prior. In the case of fossil calibration, we use a lognormal relaxed-clock and a lognormal distribution of branch lengths. Fossil calibration points were used as priors on clade ages. We used a lognormal prior distribution, where the minimum ages of clades was used as an offset, with an arbitrary mean close to the offset values (+ 2 million years) and a standard deviation of 1 million years. For the common ancestor of Osteopilus and Phyllodytes auratus, we used a normal distribution with a mean of 34 MYA and a standard deviation of 1 MYA (Iturralde-Vinent and MacPhee 1999). In order to achieve an Effective Sample Size (ESS) of at least 200 for all parameters, the length of chain used in these analyses was 35 million in the Pseudacris calibration and 50 million in the case of other fossil calibrations. Results were visualized in TRACER 1.5 and a summary tree was generated using TREEANNOTATOR under the maximum clade credibility in the target tree type option. TABLE 3. Sequences used to estimate divergence times in Hyloscirtus. Species Genbank Number Acris crepitans EF566969 Hyla arborea AY843601 Hyla arenicolor EF566960 Hyla cinerea AY680271 Hyla gratiosa AY843630 Hyla meridionalis EF566953 Hyla squirella AY843678 Hyla versicolor EF566951 Osteopilus crucialis AY843710 Osteopilus dominicensis AY843711 Osteopilus marianae DQ380383 Osteopilus marianae EU034086 Osteopilus pulchrilineatus AY819436 Osteopilus pulchrilineatus EU034087 Osteopilus septentrionalis AY843712 Osteopilus vastus AY843713 Osteopilus wilderi DQ380385 Osteopilus wilderi EU034092 Phyllodytes auratus AY819383 Phyllodytes auratus DQ403730 Phyllodytes auratus DQ403728 Phyllodytes auratus DQ403726 Phyllodytes auratus AY819515 Pseudacris crucifer AY291103 10 · Zootaxa 3364 © 2012 Magnolia Press COLOMA ET AL.

See more

The list of books you might like